ID: 1175733641

View in Genome Browser
Species Human (GRCh38)
Location 20:61370952-61370974
Sequence CCCAGAGCGCTGAGGCTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 200}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175733641_1175733649 4 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733649 20:61370979-61371001 GGTCGCTTGGAGAGGCTTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 151
1175733641_1175733651 10 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733651 20:61370985-61371007 TTGGAGAGGCTTCCTGGGAACGG 0: 1
1: 0
2: 1
3: 48
4: 351
1175733641_1175733652 11 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733652 20:61370986-61371008 TGGAGAGGCTTCCTGGGAACGGG 0: 1
1: 0
2: 3
3: 39
4: 378
1175733641_1175733655 16 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733655 20:61370991-61371013 AGGCTTCCTGGGAACGGGGCGGG No data
1175733641_1175733647 -9 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733647 20:61370966-61370988 CGCTCTGGGCAGGGGTCGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 178
1175733641_1175733657 30 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733657 20:61371005-61371027 CGGGGCGGGAGCGCGCAGCCTGG 0: 1
1: 0
2: 6
3: 55
4: 376
1175733641_1175733648 -4 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733648 20:61370971-61370993 TGGGCAGGGGTCGCTTGGAGAGG 0: 1
1: 0
2: 0
3: 23
4: 273
1175733641_1175733654 15 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733654 20:61370990-61371012 GAGGCTTCCTGGGAACGGGGCGG 0: 1
1: 0
2: 0
3: 30
4: 285
1175733641_1175733650 5 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733650 20:61370980-61371002 GTCGCTTGGAGAGGCTTCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1175733641_1175733653 12 Left 1175733641 20:61370952-61370974 CCGAGGAGCCTCAGCGCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1175733653 20:61370987-61371009 GGAGAGGCTTCCTGGGAACGGGG 0: 1
1: 0
2: 2
3: 38
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175733641 Original CRISPR CCCAGAGCGCTGAGGCTCCT CGG (reversed) Intronic
901021540 1:6258471-6258493 CCCACAGGTCTGAGGCTCCCCGG - Intronic
901089219 1:6630232-6630254 CCCCGAGCTCTGAGGGTTCTTGG + Intronic
901537200 1:9890286-9890308 CCCAGAACACTGAAGATCCTGGG + Intronic
902447546 1:16476603-16476625 GCCACAGCGCAGAGGGTCCTTGG - Intergenic
902467446 1:16626818-16626840 GCCACAGCGCAGAGGGTCCTTGG - Intergenic
902507138 1:16945917-16945939 GCCACAGCGCAGAGGGTCCTTGG + Intronic
902549828 1:17212599-17212621 CCCAGTGGGCCGAGGCTTCTGGG + Intronic
904598987 1:31663564-31663586 CTCAGAGCACTGGGGCTTCTGGG + Intronic
905010650 1:34744932-34744954 ACCAGAGCCCTCAGGCTTCTTGG + Intronic
905296450 1:36957420-36957442 CACAGAGCACAGAGGCTCATGGG - Intronic
905694230 1:39963035-39963057 CCCCGTGCGCAGAGGCTACTGGG + Intronic
906308997 1:44739667-44739689 CCCCGAGCGCTGTGCCTTCTGGG - Intergenic
906523554 1:46480969-46480991 CCCAGAGGGCTAAGGCTCCTAGG + Intergenic
906746138 1:48223377-48223399 CCTCTAGCACTGAGGCTCCTGGG - Intronic
907040019 1:51250969-51250991 CCCCGTGCGCAGAGGCTACTGGG - Intronic
907053793 1:51346366-51346388 CCCAGAGGGCAGAGGCTCTAAGG + Intergenic
907241124 1:53081642-53081664 CCCCAAGGCCTGAGGCTCCTGGG - Intronic
912494769 1:110084368-110084390 CCCAGATCGCTGGGGGGCCTCGG + Intergenic
915529614 1:156495871-156495893 CCTAGAGCCCAGAGCCTCCTGGG + Intronic
916102734 1:161406694-161406716 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
916421280 1:164640058-164640080 CCTAGAACGCTCAGACTCCTTGG - Intronic
919370883 1:196724281-196724303 GACAGAGGGCTGAGGTTCCTGGG + Intronic
919548147 1:198949413-198949435 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
920034792 1:203058939-203058961 CCCCCAAGGCTGAGGCTCCTGGG + Intronic
920387673 1:205580132-205580154 TCCCAAGCGCTTAGGCTCCTGGG - Intronic
921168690 1:212526352-212526374 CCCATGGCTCTGAGGCTGCTGGG - Intergenic
923034910 1:230279012-230279034 CCCAGAGCTCTGGGGCTCAGAGG + Intronic
1063142116 10:3264684-3264706 CCCAGTGCGCTGAGGCTTTCAGG - Intergenic
1067240919 10:44492480-44492502 CCTAAAGCACTGAGGGTCCTAGG + Intergenic
1067551026 10:47236647-47236669 CCCAGTGCCCTGAGGGTTCTGGG - Intergenic
1067831428 10:49613061-49613083 CTCAGAGCTCTGAGGTGCCTGGG + Intronic
1071455944 10:85851776-85851798 CCAAGAGAGCTGCGACTCCTTGG + Intronic
1073390865 10:103175561-103175583 GCCAGAGCTCCAAGGCTCCTCGG + Intronic
1073476366 10:103756512-103756534 CCCAGTGCCCAGAGGCTCCTGGG + Intronic
1073663592 10:105505433-105505455 CCCAGAGGGTTTAGGCTTCTCGG + Intergenic
1074120208 10:110488439-110488461 CCCAGAGAACAGAGGCTTCTGGG + Intergenic
1075661536 10:124200339-124200361 CCCATAGCTCTGAGGCTTCCTGG + Intergenic
1075832572 10:125423864-125423886 CCCAGAAGGGTGAGGTTCCTGGG + Intergenic
1075901129 10:126043532-126043554 CCCAGAGCCCTGGGGCACCGCGG + Intronic
1077241258 11:1511614-1511636 CTCAGGAGGCTGAGGCTCCTGGG + Intergenic
1077392147 11:2305050-2305072 CCCTGAGGGCAGAGCCTCCTGGG + Intronic
1077921431 11:6644807-6644829 CCCAGGACCCTGAGGCCCCTCGG + Intronic
1078586908 11:12599626-12599648 CCACGAGCGCGGAGGCTCCCTGG + Intergenic
1078773137 11:14369539-14369561 CCCAGAGCACTCAGGATCCCTGG + Intergenic
1078900037 11:15633368-15633390 CCAAGAATGCTGAGGCTCATCGG + Intergenic
1079058650 11:17228758-17228780 CCCCGTGCGCAGAGGCTACTGGG + Intronic
1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG + Intronic
1082821994 11:57550306-57550328 CCCAGAGTGCAGAGGTTCCTGGG - Intergenic
1083184265 11:61008277-61008299 CCCTAAGCGCTGTGGCTCCCAGG + Intronic
1083618987 11:64039729-64039751 CCCAGAGCACTGCCGCTCCCCGG + Intronic
1083811858 11:65110853-65110875 CACAGAGTCCTGGGGCTCCTTGG - Intronic
1084149610 11:67282028-67282050 CCCAGAGGAGTGGGGCTCCTGGG + Intronic
1084392968 11:68890673-68890695 CCCAGAGGGCTTGGGCTGCTGGG - Intergenic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1084770528 11:71340244-71340266 CACTGTGCGCTGAGGCTTCTGGG + Intergenic
1085152764 11:74265391-74265413 CCCAGAGCTCTGTGGCCCCAAGG - Intronic
1085736992 11:79047589-79047611 CTCAGAGCTCTTAGGCTCCTTGG + Intronic
1086651309 11:89294497-89294519 CCCAGAGTGCGGACGCTCCAGGG + Intronic
1086908875 11:92449372-92449394 CCCAGAGCTCAGATGCTGCTTGG - Intronic
1088840159 11:113620230-113620252 CCCAAAGAACTGAGGCTCCAGGG - Intergenic
1089036052 11:115392932-115392954 CTCAGAAGGCTGAGGCTCCTGGG + Intronic
1089518665 11:119049416-119049438 CTCAGAGCCCAGAGGATCCTGGG + Intronic
1091296239 11:134475783-134475805 TCCTGAGCACTGAGGGTCCTAGG - Intergenic
1091680518 12:2523555-2523577 CCCATAGTGCTGAGGTTCCTGGG - Intronic
1095716382 12:45350882-45350904 CCCAGAGTGCTGAGCTTCGTTGG + Intronic
1096019120 12:48307495-48307517 CCCACCGCGCTGAGACTCCTGGG + Intergenic
1101574001 12:105980802-105980824 CACAGAGAGCTGGGGCTCTTTGG + Intergenic
1102298439 12:111754738-111754760 CCCAGAGCCCTGAGTGGCCTTGG + Intronic
1102372489 12:112393793-112393815 CCCAGAAAGCTGAGGCTGCAGGG + Intergenic
1103107926 12:118246572-118246594 CCCCGTGCGCAGAGGCTACTGGG + Intronic
1103229753 12:119319465-119319487 CCCAGAGGGCTGAGTGTTCTAGG - Intergenic
1104591199 12:130085770-130085792 CAGAGAGCAATGAGGCTCCTGGG - Intergenic
1107818008 13:44261621-44261643 CCCAGATTGCTGAATCTCCTTGG + Intergenic
1113932467 13:113975597-113975619 CCCAGAGAGCTGAGGCCTCCTGG - Intergenic
1117467834 14:56011583-56011605 CCTAAAGACCTGAGGCTCCTGGG - Intergenic
1119650706 14:76381042-76381064 CCCAGAGGTCTAAGGCTGCTGGG - Intronic
1120491094 14:85179731-85179753 CCCATAGAGCTGAGGTTCCAGGG - Intergenic
1122055741 14:99097131-99097153 CCCAGAGCGCGGAGGTGTCTGGG - Intergenic
1123067527 14:105626114-105626136 CCCAGGGCGCAGAGGCCCCTCGG + Intergenic
1123071544 14:105644838-105644860 CCCAGGGCGCAGAGGCCCCTCGG + Intergenic
1123076505 14:105669893-105669915 CCCAGGGTGCAGAGGCCCCTCGG + Intergenic
1123091208 14:105743119-105743141 CCCAGGGCGCAGAGGCCCCTGGG + Intergenic
1123096975 14:105771454-105771476 CCCAGGGCGCAGAGGCCCCTCGG + Intergenic
1126574516 15:50183809-50183831 TCTAGAAAGCTGAGGCTCCTCGG - Intronic
1127769279 15:62218033-62218055 CTCAGAAGGCTGAGGCTCCTAGG - Intergenic
1128112488 15:65085493-65085515 CCCAGAGAGCTGAGGGTCAGAGG - Intergenic
1128250300 15:66159358-66159380 CCCTGACCTCTGTGGCTCCTGGG - Intronic
1128338316 15:66802697-66802719 CCCAGACCACAGAGGCTCGTGGG - Intergenic
1128342438 15:66831845-66831867 CCCACGGCGCTGAGGATTCTGGG - Intergenic
1128977654 15:72165288-72165310 CCTGGAGCTCTGAGGCTTCTGGG - Intronic
1130987432 15:88853945-88853967 CCCTGAGCACTGAGGGTGCTGGG - Intronic
1131371217 15:91883364-91883386 GCCAGAGACCTGAGGCTTCTTGG + Intronic
1132837718 16:1962774-1962796 CCCCGTGCGCAGAGGCTACTGGG - Exonic
1132863124 16:2081260-2081282 CCCAGAGCCCAGGGGCGCCTGGG + Intronic
1133125051 16:3641285-3641307 CCCAGAGCCCTGCGATTCCTGGG + Intronic
1133223767 16:4330487-4330509 CCCAGCGCCCTGGGGCTCCCTGG + Intronic
1139297101 16:65910510-65910532 CCCAGAGAACAGAGGCACCTGGG + Intergenic
1139331069 16:66190640-66190662 ACCACAGCTCTGAGGCTTCTGGG - Intergenic
1139436164 16:66937828-66937850 CCCACCAGGCTGAGGCTCCTTGG - Intronic
1142205216 16:88779718-88779740 CCAGGAGCACAGAGGCTCCTTGG - Intronic
1143266887 17:5644702-5644724 CCCAAAGCTCTGAGCCTCCAGGG + Intergenic
1144033415 17:11342249-11342271 CCCAGAGGGCTTTGGCTCTTGGG - Intronic
1145022933 17:19446341-19446363 CCCCGTGCGCAGAGGCTACTGGG - Intergenic
1145783276 17:27577799-27577821 TCCAGAGCCCTGAGGACCCTGGG - Intronic
1148377235 17:47159561-47159583 CCCCGTGCGCAGAGGCTACTGGG - Intronic
1149983652 17:61331167-61331189 CCCTGTGTGCTGAGGCTTCTAGG - Intronic
1150575824 17:66430235-66430257 CCCAGAGCCTAGAGGCTCCAGGG - Intronic
1151479708 17:74362707-74362729 CCCAGAGACCTGAGGCCACTTGG - Intergenic
1153999537 18:10472057-10472079 CACAGAGCTCTGAGGTACCTTGG - Exonic
1155524267 18:26700531-26700553 GACAGAGCCCTGAGGCTCTTTGG + Intergenic
1157503205 18:48205050-48205072 CCCAGGGCCCTGAGGATCCCTGG - Intronic
1159601270 18:70430728-70430750 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
1160054303 18:75464819-75464841 CCCAGACCCTTGAGGCTCTTCGG + Intergenic
1160957823 19:1701748-1701770 ACGAGAGCCCTGAGGCTCCAGGG - Intergenic
1161350620 19:3789436-3789458 CCCGGAGCCCTGGGGCTCCTCGG - Intronic
1161420639 19:4174508-4174530 CTCAGAGCCCTGAGGCTCCCGGG + Exonic
1161564898 19:4996448-4996470 CCCAGGGGGCTGAGGCTGCAAGG - Intronic
1163253971 19:16143783-16143805 CCTCGAGGGCTGAGGCTCTTGGG - Intronic
1163435288 19:17291949-17291971 CTCAGAAGGCTGAGGCTCCTTGG - Intergenic
1165365805 19:35363910-35363932 CCCAGAGAGGAGGGGCTCCTGGG - Intergenic
1165675525 19:37719428-37719450 CTCAGAGCGCGGAGGCCCCCAGG - Exonic
1166108948 19:40611284-40611306 CCCACAGGGCGGCGGCTCCTGGG - Exonic
1167356963 19:49010293-49010315 TCCAGAGCGCTGAGGGTCACGGG - Intronic
925263450 2:2547688-2547710 CCCAGAGTGCTGAGGGTGCCAGG - Intergenic
926006700 2:9378415-9378437 CCCAGAGTCCCCAGGCTCCTCGG - Intronic
926214124 2:10893215-10893237 CCCACAGAGCTGGGGGTCCTAGG - Intergenic
926323385 2:11764603-11764625 CCCAGAGCGCTGGTGTTCCCTGG + Intronic
927430771 2:23024712-23024734 GCCAGAGGGCTGAGGGGCCTTGG + Intergenic
928462349 2:31486232-31486254 CCCAGGTCTCTAAGGCTCCTAGG + Intergenic
930028252 2:47042963-47042985 ACCAGAACGCTGTGACTCCTGGG - Intronic
931620418 2:64204516-64204538 CCCAGAGAGCAGAGACTCTTGGG - Intergenic
931692305 2:64845621-64845643 CCCAGAGAGCAGAAGCTTCTTGG - Intergenic
933659565 2:84916272-84916294 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
935281704 2:101523340-101523362 CTCAGAGAACTGAGGGTCCTGGG + Intergenic
936228230 2:110677918-110677940 CCCAGGGGGCTGGGGCGCCTGGG - Intronic
936484538 2:112914895-112914917 CTCAGGGCGCTGAGGCTCTAGGG + Intronic
936954815 2:118013573-118013595 CCCCGAGGGCCGAGGCTGCTGGG - Intronic
944894598 2:204151108-204151130 CCCAGAGCGCTTAGGTTAATGGG + Intergenic
947857416 2:233333539-233333561 CCCAGAGCCCTGTGGCTTCTGGG + Intronic
948463091 2:238139523-238139545 CCCAGAGCGGGGAAGCACCTGGG - Intronic
948465896 2:238151468-238151490 CCCAGAAAGCTGAGGCTGCTGGG + Exonic
1170042285 20:12051483-12051505 CCCAGACAGCTGAGGGTCTTGGG + Intergenic
1170745997 20:19099401-19099423 CCCTGAAGGCTGAGGCTCCAGGG + Intergenic
1173040058 20:39453847-39453869 CACACAGGGCTGAGCCTCCTGGG + Intergenic
1174285971 20:49473844-49473866 CTCAGAGAGGTGAGGCGCCTTGG + Intronic
1174646186 20:52087742-52087764 CCCAGAGCCCTCAGGGCCCTTGG + Intronic
1175515464 20:59567223-59567245 CCCAGGGCAGTGTGGCTCCTTGG + Intergenic
1175733641 20:61370952-61370974 CCCAGAGCGCTGAGGCTCCTCGG - Intronic
1175914363 20:62418896-62418918 CCCAGAGAGGTGGGGCTGCTGGG - Intronic
1176084762 20:63290885-63290907 CCCAGAGCACTGAGGCTTCTCGG + Intergenic
1176294216 21:5062149-5062171 CCGATAGCCCTGAGGTTCCTGGG - Intergenic
1177298032 21:19202438-19202460 CCCAGGGAGCTGGGGCTCTTGGG - Intergenic
1179013538 21:37574946-37574968 ACCAGAGCGCTAAGGGTCCTCGG + Intergenic
1179863043 21:44201499-44201521 CCGATAGCCCTGAGGTTCCTGGG + Intergenic
1180856921 22:19053223-19053245 CCCAGTGCCCTGAGGATCCAGGG - Intronic
1184279561 22:43429248-43429270 CCCAGTGCTGTGTGGCTCCTTGG + Intronic
1184856586 22:47149727-47149749 CCGAGATGGCTGAGGCTCTTGGG + Intronic
1185239720 22:49736003-49736025 CCCAGGGGGCTGAGTCTCCCAGG - Intergenic
1185424506 22:50758347-50758369 CCCAGAGTGCTGAGGATTATAGG + Intergenic
949507115 3:4738591-4738613 CCGCCAGCACTGAGGCTCCTGGG + Intronic
950162490 3:10771020-10771042 CCCAGAACCCTGGGGCCCCTGGG - Intergenic
951522382 3:23621716-23621738 CCCACAGCACTGGGACTCCTAGG - Intergenic
953228248 3:41040624-41040646 CTCAGAAGGCTGAGGCTCTTAGG + Intergenic
953837398 3:46358714-46358736 CACACAGCCCTGAGGTTCCTGGG - Intronic
955239978 3:57169751-57169773 CCCAGAGGGCTGAGGGTGCAAGG + Intronic
955364277 3:58298299-58298321 CCCAGAGCCCTGCGGCAGCTGGG - Intergenic
967919242 3:194602251-194602273 CCCAGGCCGCTGTGGCTCCTGGG + Intronic
968019866 3:195375702-195375724 CTCAGAAGGCTGAGGCTCCTAGG + Intronic
969174815 4:5390408-5390430 CCCAGAGGGTTGAGGACCCTGGG + Intronic
969485236 4:7468519-7468541 CCCAGAACCATGAGGCTTCTTGG - Intronic
969619397 4:8271442-8271464 CCCAGCACGCTGGGGTTCCTGGG + Intronic
975666476 4:76739606-76739628 CACAGAAGGCTGAGGCACCTGGG - Exonic
976836325 4:89378692-89378714 CCTATAGAGCTGAGGGTCCTGGG - Intergenic
976897304 4:90127842-90127864 CGCTGAGCGCTGAGGCACCAGGG - Intronic
982090588 4:151876767-151876789 CTCAGAGGCCTGAGGCACCTGGG + Intergenic
985882629 5:2651296-2651318 CCCTGAGAGGTGTGGCTCCTTGG - Intergenic
986014892 5:3749023-3749045 GCCACAGCTCTGAGGCTCCTGGG + Intergenic
986139756 5:5018409-5018431 CCCAAAGGGCTGAGTCGCCTGGG - Intergenic
987127382 5:14827077-14827099 CCCAGGTCGGTGAGGTTCCTTGG - Intronic
988501045 5:31784009-31784031 CCCAGAGCCCTGAGGCCCTGTGG - Intronic
993504229 5:88691988-88692010 CCCTGAGCGCTGAGGCTGTGGGG - Intergenic
997467615 5:134098792-134098814 CCCAGAGGGTTGAGTCACCTGGG + Intergenic
997830380 5:137144646-137144668 CCCTGAGCCTTGAGGCTGCTAGG - Intronic
1002329599 5:178432519-178432541 CCCTGAGCCCTGTAGCTCCTGGG - Intronic
1003407034 6:5834286-5834308 CCCAGGCCACCGAGGCTCCTCGG - Intergenic
1005952930 6:30644776-30644798 TCAGGAGCTCTGAGGCTCCTGGG - Intronic
1006085198 6:31590109-31590131 CCCAGAGAGCACAGGATCCTGGG + Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007589469 6:43012695-43012717 CCCAGAGCCCTTGGGCTGCTAGG + Intronic
1010185491 6:73139015-73139037 GCCAGAGCCCTGAGGCTCTGTGG - Intronic
1012550912 6:100464417-100464439 GCCAGAGCGCTGGGTCGCCTTGG - Intronic
1016864128 6:148748354-148748376 CACACAGCGCCGAGGATCCTCGG - Intronic
1017817509 6:158026531-158026553 CACAGAGCACTGGGGCTCCTGGG - Intronic
1019548038 7:1587783-1587805 CCTAGATGGCTGAGGCCCCTCGG - Intergenic
1019739677 7:2666338-2666360 GCCAGAGCTCTGAGGCTTCTGGG + Intergenic
1022089298 7:27097077-27097099 GCGGGAGCGCGGAGGCTCCTGGG - Intergenic
1022221891 7:28321816-28321838 CACAGAGCGCCGATGCTCCAAGG + Intronic
1022248779 7:28586323-28586345 CCCAGAGCTCTGAGCTTCTTTGG - Intronic
1022469705 7:30674735-30674757 CCCAGAACTCTGTGGCTTCTGGG - Intronic
1026392127 7:69912287-69912309 CCCTGAGCTCTCAGGCGCCTGGG - Intronic
1026491638 7:70868761-70868783 CCAGGAGGGGTGAGGCTCCTAGG - Intergenic
1026969766 7:74460878-74460900 CCCACAGCACGGAGGCTGCTGGG + Intronic
1030008868 7:105145880-105145902 ACTAAAGGGCTGAGGCTCCTGGG - Intronic
1031665813 7:124481005-124481027 CCCCGTGCGCAGAGGCTACTGGG + Intergenic
1037433067 8:18834500-18834522 CATAGAGAGCTGAGGCTCTTGGG - Intronic
1037661519 8:20931420-20931442 CCTAGAGAATTGAGGCTCCTGGG + Intergenic
1037894285 8:22641539-22641561 CCCAGAATGCTGAGGATTCTGGG - Intronic
1042533293 8:69835178-69835200 CCAAGAGCGCTGAAGCCCCGAGG + Intergenic
1044971479 8:97624573-97624595 CCCCGTGCGCAGAGGCTACTGGG - Intergenic
1048497352 8:134946334-134946356 CCCAGGGCCCTGTGGCTCCATGG - Intergenic
1048920903 8:139229148-139229170 CCATGAGCTCTGAGGCTCCTGGG - Intergenic
1049340861 8:142111982-142112004 CCTAGAGCGCAGAGGCTGCCTGG - Intergenic
1053294578 9:36903535-36903557 CTGAGAGCCCTGAGGCTGCTGGG + Intronic
1055327850 9:75150708-75150730 CCCACAGGGCTGAGCCTGCTGGG - Intergenic
1058137341 9:101321312-101321334 CCCAGAGCACTGTGGCTCTGAGG - Intronic
1059485565 9:114624131-114624153 GCCAGAGGGAGGAGGCTCCTAGG - Intronic
1060106408 9:120876225-120876247 CGCAGAGCGCACAGGCTCCCGGG + Intronic
1061904917 9:133691853-133691875 CCCAGGGCTCTGCGGGTCCTGGG - Intronic
1062062397 9:134503438-134503460 CCCAGGGTCCTGAAGCTCCTAGG + Intergenic
1062554782 9:137109013-137109035 TCCAGAGGCCTGAGGCTCCAGGG + Exonic
1185475422 X:412688-412710 CCCAGAGGGTTGAGGCTGCAAGG - Intergenic
1192546925 X:72022007-72022029 CCCAGAGAGCAGAGGCACCATGG - Intergenic
1196135502 X:112205229-112205251 CACAGAGCTCTGAGGCTCTTTGG + Intergenic
1196462134 X:115942497-115942519 CTCATTGCCCTGAGGCTCCTGGG + Intergenic
1198330904 X:135621610-135621632 CCCAAATACCTGAGGCTCCTGGG + Intergenic
1198336022 X:135667385-135667407 CCCAAATACCTGAGGCTCCTGGG - Intergenic
1200068158 X:153514809-153514831 CCCAGAGCCCTGAGGCTGAGAGG - Intergenic