ID: 1175738969

View in Genome Browser
Species Human (GRCh38)
Location 20:61407054-61407076
Sequence CTGTATCCAGGCAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175738969 Original CRISPR CTGTATCCAGGCAGAGCAGA TGG (reversed) Intronic
900975376 1:6013068-6013090 CTGAAGCCAAGCAGAGCAGTGGG - Intronic
900992214 1:6103306-6103328 GTCTAACCAGGCAGAGGAGAAGG + Exonic
902814228 1:18907051-18907073 CTGCCTCCAGGCAAGGCAGAGGG + Exonic
903183122 1:21615028-21615050 CTGTGCCCAGGCAGAGCTGGGGG - Intronic
903536077 1:24067148-24067170 CTGTGTCCAGGCAGTGCTGGGGG + Intronic
904079242 1:27861730-27861752 CTGCATTTAGGAAGAGCAGAGGG + Intergenic
904479107 1:30783048-30783070 CTGGCTCCAGGGAGAGCAGAGGG - Intergenic
905560816 1:38925851-38925873 AGATATCCAGGCAGAGCAGTAGG + Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907157145 1:52345045-52345067 CTATATCCAGTCAGGCCAGAAGG - Intronic
912413072 1:109491120-109491142 CTGTAGCCAGGCAGAGTGCATGG + Exonic
914394563 1:147252693-147252715 CTGTATCCTGGGAGATGAGATGG + Exonic
915091045 1:153426576-153426598 CAGGATCCAGGCAGATCAGCTGG + Intergenic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
918095449 1:181330336-181330358 CTGGAGGCAGGCAGAGAAGAAGG - Intergenic
919329704 1:196155640-196155662 CTGTTTTCAGGCAGAGAAAAAGG - Intergenic
920044072 1:203122273-203122295 CTGGATCCAGGCTGGGCAGCAGG - Intronic
920076946 1:203344152-203344174 CTGTGTACAAGCAGAGCAGTGGG + Intronic
920199588 1:204251410-204251432 CTGTCTCCAGGCAGATGAGCGGG + Intronic
920701130 1:208218851-208218873 CTCTCTGCAGGCAGAGCACATGG + Intronic
922986796 1:229872346-229872368 CTGGATCCAGGCATAGAAGTGGG + Intergenic
924737103 1:246768241-246768263 CTTCTTACAGGCAGAGCAGAAGG - Intergenic
1062971064 10:1649806-1649828 ATCTATTCAGGCAGAGGAGATGG + Intronic
1063856200 10:10256934-10256956 CTGTCTTCAGGCTGGGCAGAGGG + Intergenic
1065854663 10:29820716-29820738 CTGAAACCAGGCAAAGCAAAAGG - Intergenic
1066458360 10:35591467-35591489 AAGTATCCAGGTAGGGCAGAGGG + Intergenic
1067668254 10:48296817-48296839 GTGTCTTCAGGCAGAGCAGAAGG - Intergenic
1067762868 10:49062495-49062517 CTGAATCCATGAAGGGCAGAAGG - Intronic
1068231834 10:54177673-54177695 ATGTATGCAGGTAAAGCAGAGGG + Intronic
1070699475 10:78589809-78589831 CTGTCTCCATGCAGAACAAAGGG + Intergenic
1070969162 10:80549416-80549438 CTGTATGGAGGCAGAACAGGAGG - Intronic
1071432599 10:85618080-85618102 CTGAATGGAGTCAGAGCAGAGGG - Intronic
1072456334 10:95579671-95579693 CTGAATCCAGCCATTGCAGATGG + Intergenic
1074031133 10:109689620-109689642 GTGTATCAAGAGAGAGCAGAAGG - Intergenic
1074944745 10:118270562-118270584 CTGTCTCCAGGCATATCCGAGGG + Intergenic
1075841814 10:125511275-125511297 CTCCATCCATGCAGAGGAGAGGG - Intergenic
1076736255 10:132460470-132460492 CTGCAGCCAGGCACTGCAGAGGG + Intergenic
1076758542 10:132588385-132588407 CTGTGTCCAGGCGGTGCAGGAGG - Intronic
1078910013 11:15722428-15722450 CTGCATCCTGGCAGTTCAGAAGG + Intergenic
1079750521 11:24190993-24191015 CTCTATCTGGGCAGTGCAGAAGG - Intergenic
1081508139 11:43739540-43739562 CTGTGTCCTCACAGAGCAGAAGG + Intronic
1081774352 11:45667179-45667201 CTCTCTCCACCCAGAGCAGATGG + Intergenic
1082669249 11:56014173-56014195 CTGTTTCCTGACATAGCAGAAGG + Intergenic
1083696070 11:64443542-64443564 CTGCATTCTGGCAGATCAGATGG - Intergenic
1084425906 11:69084521-69084543 CGGCCACCAGGCAGAGCAGATGG - Intronic
1084534131 11:69746814-69746836 CTGGATGCATGCAGAACAGAGGG + Intergenic
1086020954 11:82228747-82228769 GTTTATCCAGGCAGAGAAGACGG - Intergenic
1086129088 11:83382643-83382665 TTGTATAGAGGCAGTGCAGAGGG - Intergenic
1087917767 11:103830750-103830772 CTGTATCATGTCACAGCAGAAGG - Intergenic
1089740466 11:120578703-120578725 CTGGAGTCAGGCAGAGCTGAGGG + Intronic
1089873494 11:121697353-121697375 GTCTATACTGGCAGAGCAGAGGG - Intergenic
1090374848 11:126281472-126281494 CAGGCTCCAGCCAGAGCAGAAGG - Intergenic
1090418724 11:126558686-126558708 CTATTCCCAGGCAGAGTAGAAGG - Intronic
1091690058 12:2589764-2589786 CAGTATCCAGGCAGAGAGGATGG + Intronic
1095851411 12:46811421-46811443 CAGACTGCAGGCAGAGCAGATGG + Intronic
1096199943 12:49674321-49674343 CTCTATCGAGGCAGGGCAGGGGG - Intronic
1096918934 12:55063337-55063359 CTATTTCAATGCAGAGCAGAGGG + Intergenic
1098228243 12:68346792-68346814 CTGTACTGAGGCATAGCAGAGGG - Intergenic
1100788346 12:98102662-98102684 TGGTATCCAGGCCAAGCAGATGG + Intergenic
1101567265 12:105919989-105920011 CTATATGCAGGCAGTGCTGATGG + Intergenic
1103536205 12:121635224-121635246 CTGTCTCCAGTCTGAGCTGAGGG + Intronic
1104055793 12:125228958-125228980 CTGCATCCAGGCAGGAAAGATGG - Intronic
1106314000 13:28577807-28577829 CTCAGTCCAGGCAGAGCAGAGGG - Intergenic
1107887128 13:44882881-44882903 CTGTATCCAGCCAGTGGATAAGG - Intergenic
1112727311 13:102319352-102319374 CTGTATCTAAGCAGAGCAGGGGG - Intronic
1113388676 13:109874638-109874660 CTTTATCCAGGCAGCACAGAGGG - Intergenic
1113468662 13:110529784-110529806 CTGTCTCCAGGCCAAGCAGACGG + Intronic
1114219543 14:20684327-20684349 CTGCCTCCACGGAGAGCAGATGG - Exonic
1115366256 14:32560466-32560488 CTGTATCCAGTCACTGCATATGG + Intronic
1115941856 14:38618671-38618693 CTGGATGCAGGCAATGCAGATGG - Intergenic
1117841812 14:59869406-59869428 CTGTTTCCAGGGAGAGGAAAGGG - Intronic
1117930681 14:60838054-60838076 CTCTAGCCAGGCTGATCAGAGGG - Intronic
1118502854 14:66379407-66379429 CTGTATCCAGCCAGCAGAGATGG - Intergenic
1120819110 14:88895516-88895538 ATGTTACCAGGCACAGCAGAAGG + Intergenic
1121732117 14:96194271-96194293 CTGCATGCAGGGAGGGCAGAAGG + Intergenic
1122125497 14:99576435-99576457 GAGTCTCCAGGCAGAGCTGAGGG - Intronic
1124851686 15:33345651-33345673 CTGGGTCCCAGCAGAGCAGAAGG + Intronic
1125788450 15:42343703-42343725 CTGAACCCAGGCAGGGCACAGGG + Intronic
1127968417 15:63941144-63941166 GGCTTTCCAGGCAGAGCAGATGG - Intronic
1128450577 15:67803856-67803878 CTCTATCCAGGAAGAGCCCAGGG + Intronic
1129737626 15:77974941-77974963 CTCTAGCCAGGCAGGGGAGATGG - Intergenic
1129742593 15:77997002-77997024 CTGCATCCTGGCAGAGAACAAGG + Exonic
1129842880 15:78754448-78754470 CTGCATCCTGGCAGAGAACAAGG - Intergenic
1129848448 15:78778678-78778700 CTCTAGCCAGGCAGAGGAGATGG + Intronic
1130253474 15:82315269-82315291 CTCTAGCCAGGCAGGGGAGATGG - Intergenic
1130512998 15:84604449-84604471 CTGCCTGCAGACAGAGCAGAGGG - Intronic
1131527896 15:93167172-93167194 CTGAGCCCAGGCTGAGCAGAGGG - Intergenic
1131830250 15:96350049-96350071 CTGAATCCAGGCAGAGCTCAGGG - Intergenic
1131985836 15:98042191-98042213 CAGTATCCAGGAAGGACAGATGG - Intergenic
1133507741 16:6429030-6429052 CTGTTTCCTGGAAGAGGAGAAGG + Intronic
1135403137 16:22180037-22180059 CAGTGTCCAGGAAGAGCAAAGGG + Intronic
1135540646 16:23327665-23327687 CTGTATCCATACAGAGAAGCTGG + Intronic
1136108295 16:28046811-28046833 CCGTGTCCAGGCAGAGGACATGG - Intronic
1136497719 16:30654297-30654319 GGGTCTGCAGGCAGAGCAGATGG - Exonic
1137014450 16:35361138-35361160 GTGTATGCAGGCAGATGAGATGG + Intergenic
1141855691 16:86679879-86679901 CTGCTTCCAGTCATAGCAGAAGG - Intergenic
1143158641 17:4854468-4854490 CAGAAACCAGTCAGAGCAGAGGG - Intronic
1143437484 17:6940000-6940022 CTGTTTCCTGGCAGGGCAAATGG - Intronic
1144357246 17:14458058-14458080 CAGGATCCAGGCAGAGTACAGGG - Intergenic
1144581354 17:16461224-16461246 CTGTATCCAGGCCGAGCGACAGG + Intronic
1145101503 17:20081274-20081296 CTGTATCTAGGCACTGCAGTAGG - Intronic
1145784772 17:27586699-27586721 GTGTCTCCATGCAGATCAGATGG + Intronic
1146536101 17:33653565-33653587 CTGGAGCCAGGCAGACAAGAAGG - Intronic
1146590945 17:34127609-34127631 GTGTGTCCAGGCTGAGAAGAGGG - Intronic
1146930944 17:36777414-36777436 CTGAATCAAGGAAGAGGAGAGGG + Intergenic
1148744216 17:49909532-49909554 CTGTGTCCCTGCAGAGCTGAGGG + Intergenic
1151509136 17:74547556-74547578 CTGGAGCCAGGCAGAGGAGTGGG - Intergenic
1151561464 17:74872134-74872156 CTGGGGCCAGGCAGAGGAGAGGG + Intronic
1151585264 17:75004752-75004774 CTGTAGCCAGTCAGAGGAGGAGG + Exonic
1156590005 18:38476096-38476118 CTGTATGGAGGTAGAGAAGATGG + Intergenic
1157509684 18:48261945-48261967 GTGGGTGCAGGCAGAGCAGAAGG + Intronic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1159707562 18:71710626-71710648 CTTTATACAGGCAGAGCATGTGG + Intergenic
1159998018 18:74985844-74985866 CTTTTTCCAGGCAGAGCGTATGG + Intronic
1161381298 19:3966478-3966500 CTGGATCCAAGCCCAGCAGAGGG - Intronic
1161859450 19:6787078-6787100 CTGGATCCAGCCAGACCTGAAGG - Intronic
1162236268 19:9312212-9312234 CTCTGTCCAGGCATAACAGAGGG - Intergenic
1164860681 19:31559975-31559997 CTGAATCCAGTCAGAGCTGAGGG - Intergenic
1165411592 19:35665712-35665734 CTGGACCGAGGCAGAGCAGTGGG - Intergenic
1167983681 19:53297615-53297637 CTGAATCCAGAAAGATCAGAAGG - Intergenic
1168483034 19:56737306-56737328 CTGTGTCCATGCAGAGCTGAGGG + Intergenic
926975293 2:18510462-18510484 CTGTATCCTTACATAGCAGAAGG - Intergenic
927194218 2:20536813-20536835 CTTTTTCCAGGCAGAGCCCAAGG - Intergenic
929803332 2:45123048-45123070 TTGTATTCAGGCATGGCAGAGGG + Intergenic
930743410 2:54856963-54856985 CAGTTTCAAGGCAGAGCTGAGGG + Intronic
931286285 2:60834688-60834710 CTCCATCCAGAGAGAGCAGAGGG + Intergenic
931386071 2:61798573-61798595 CTGTATTCTTGCATAGCAGAAGG - Intergenic
931587692 2:63846116-63846138 CTGGAGCAAGGAAGAGCAGAAGG - Intronic
932591833 2:73072030-73072052 CTGGGGCCAGGCAGCGCAGAAGG + Intronic
932679607 2:73813600-73813622 CTGTAGCCATGCTGAGCTGATGG - Exonic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933613872 2:84463858-84463880 TGGAATCCAGTCAGAGCAGAAGG + Intergenic
933656645 2:84894143-84894165 CAGTATACAGGGAGAGCAGAAGG + Intronic
934018809 2:87921911-87921933 CTGTTTCTAGGCATAGCAAAAGG + Intergenic
934607414 2:95707338-95707360 CTGTGTCGGGGCAGAGCAGATGG - Intergenic
936468389 2:112775544-112775566 CTGTATCCAGGCAGGTAGGAGGG + Intronic
937989794 2:127655824-127655846 CTGTTTCAAGGTAGAGCTGATGG - Intronic
938069719 2:128301993-128302015 CTTTATCCAGGGAGAGGAGCTGG - Intronic
938561221 2:132473845-132473867 ATTTATCCAGGCAGAAAAGAGGG + Intronic
941512074 2:166424438-166424460 CTGTATCAACAAAGAGCAGATGG + Intronic
942575838 2:177362660-177362682 CTAGATCCTGGCATAGCAGATGG + Intronic
944355163 2:198778891-198778913 CTGCATCCAGGGAGAGCTGATGG - Intergenic
948510253 2:238459128-238459150 CTGGATCCCGGCAGAGCACTGGG + Intergenic
948737085 2:240016256-240016278 CCGCAGCCAGGCAGAGCACACGG + Intronic
948830404 2:240595820-240595842 TTGTTTCCAGGAAGAACAGATGG + Intronic
1168731603 20:87374-87396 CTGCATACAGACAGAGGAGAAGG + Intronic
1173514681 20:43657143-43657165 CTGTGTCCAGGCAGAGGGCAAGG + Intergenic
1173562846 20:44018596-44018618 TATTATCCAGGCAGAGCAGGGGG - Intronic
1173663477 20:44750108-44750130 CTCTATGCAGGGAGAGCGGAGGG - Exonic
1175151510 20:56938746-56938768 CTGGATGCAGGCAGAATAGAGGG + Intergenic
1175698604 20:61121344-61121366 GTGATTCCAGGCAGAGCAGCCGG + Intergenic
1175738969 20:61407054-61407076 CTGTATCCAGGCAGAGCAGATGG - Intronic
1175870698 20:62208216-62208238 CTGTACCCAGGCAGGGCGAAGGG - Intergenic
1176064004 20:63184855-63184877 TTGCACCCAGACAGAGCAGAAGG + Intergenic
1177844480 21:26272456-26272478 CTGAAACAAGCCAGAGCAGAAGG - Intergenic
1178631609 21:34265849-34265871 CTGTTTCCACTCATAGCAGAAGG - Intergenic
1178644336 21:34373028-34373050 CTGTCTGGATGCAGAGCAGAGGG - Intergenic
1179230876 21:39502771-39502793 CTGTGTCCAGCCAGAACAGAGGG - Intronic
1179828873 21:43983557-43983579 GAGAGTCCAGGCAGAGCAGAGGG + Exonic
1180131573 21:45830163-45830185 CAGTCTCCAGGCAGGGCAAATGG + Intronic
1180971365 22:19817719-19817741 CTATCTCCAGGGAGAGCAGGTGG + Intronic
1182684982 22:32115324-32115346 CTGAAGCGAGGCAGAGGAGAGGG - Intergenic
1183492334 22:38123230-38123252 CTCCATCCAGGCACAGCAGGTGG + Exonic
1183680638 22:39327021-39327043 CTGCCTCCAGGCAGAGCACATGG - Intergenic
1184982754 22:48105832-48105854 CTGAAAGCAGGGAGAGCAGAGGG - Intergenic
1185185892 22:49400104-49400126 CGATATCCAAGCAGAGAAGAAGG + Intergenic
950440448 3:13007284-13007306 CGGGATCCAGACAGAGCAGGTGG + Intronic
950565093 3:13764623-13764645 CTGTTTCAAGGCAGTGTAGAGGG + Intergenic
952880965 3:37986200-37986222 CTGTAGCCAGTCAGAGCAGGGGG - Intergenic
953792322 3:45957740-45957762 CTGCATCCAGGCAGAGGCCAAGG + Intronic
954063290 3:48087366-48087388 CTGAATCCAAGCTGAGCACATGG - Intronic
954322349 3:49840727-49840749 CAGGAGCCAGGAAGAGCAGAGGG + Intronic
955076156 3:55615473-55615495 ATGAATCCAGGGAGAGCAAATGG + Intronic
956283806 3:67587301-67587323 TTGTCTCCAGGTAGATCAGACGG - Intronic
956391416 3:68777046-68777068 ATTTCTTCAGGCAGAGCAGAAGG + Intronic
956700630 3:71955822-71955844 TTGAAGCCAGGCAGGGCAGAGGG + Intergenic
957140055 3:76342564-76342586 GTGTATCCATCCAGAGCAAAAGG - Intronic
957689277 3:83546327-83546349 CTGTGTCCACACATAGCAGAGGG - Intergenic
958259865 3:91367872-91367894 TTGTAGCCAGGCAGGGTAGATGG - Intergenic
960470997 3:118065126-118065148 CTGCATCCTCACAGAGCAGAAGG + Intergenic
961569711 3:127789009-127789031 CTCTAGCCAGGCAAAGCAAAGGG - Intronic
963467644 3:145702769-145702791 ATTTATCCAGGTAGAGCGGAAGG - Intergenic
963599689 3:147367835-147367857 CTGTATTCAGGTGGAGAAGAGGG - Intergenic
964485853 3:157184675-157184697 CTGCTTCCACTCAGAGCAGAAGG - Intergenic
964707898 3:159640217-159640239 CCGTATGCTGGAAGAGCAGACGG - Intronic
967903025 3:194476599-194476621 CTGAATCAAGGCAAAGCTGATGG - Intronic
968522805 4:1041725-1041747 CTGCAGCCAGGCAGCGCAGAGGG - Intergenic
968969872 4:3788199-3788221 CTGTGTCCAGAAACAGCAGAGGG - Intergenic
969097595 4:4745398-4745420 CTGCATTCTAGCAGAGCAGAAGG - Intergenic
969457734 4:7309773-7309795 CTGTGTCCAGGCTGGGGAGAGGG + Intronic
971751211 4:30650717-30650739 CTGCATGCAGACAGAACAGAAGG - Intergenic
972879530 4:43406850-43406872 CTGTGCTCAGGCAGTGCAGAAGG + Intergenic
976317589 4:83675332-83675354 CAGCAATCAGGCAGAGCAGAGGG - Intergenic
978751840 4:112258620-112258642 AACTATCCAGGCAGAGCAGGAGG + Intronic
980705267 4:136484925-136484947 CTGTATGCCAGCAGAGCATAAGG + Intergenic
985149816 4:186935303-186935325 CTGTAACCAGCCAGAGCCCACGG - Intergenic
985844712 5:2335616-2335638 CTGGATCCAGGCTGAACACACGG + Intergenic
986001606 5:3634931-3634953 CTTTATCCATGCTGTGCAGATGG - Intergenic
986131871 5:4939602-4939624 TTGTCTCCCTGCAGAGCAGAGGG + Intergenic
986330641 5:6714001-6714023 CTGGATCCAGCCCGAGCAGAAGG + Intergenic
986434718 5:7717860-7717882 CTGAACCCATGCAGAGCAGAAGG + Intronic
989327313 5:40213698-40213720 CTGTATTTAGCCAGAGCATAGGG + Intergenic
990980775 5:61600884-61600906 CCTTATTCAGGCAGAGCAGAGGG + Intergenic
993851136 5:93010780-93010802 AGGAGTCCAGGCAGAGCAGAAGG - Intergenic
994309586 5:98252871-98252893 CTGTTTCCACTCACAGCAGAAGG + Intergenic
994606157 5:101969324-101969346 CTCGACCCAGGCAGAGTAGAGGG + Intergenic
995655880 5:114425574-114425596 TTGGGTCCAGGCAGAGCAGGTGG - Intronic
996402403 5:123076586-123076608 CTGTTTCCACTCAGGGCAGAAGG + Intergenic
997423371 5:133786546-133786568 CTGTTTCCAGGCAGGGCTGGAGG + Intergenic
997904918 5:137807083-137807105 CTGTATACTCGCACAGCAGAAGG + Intergenic
1000577196 5:162988922-162988944 CTGTGTCCTCGCAGAGTAGAAGG + Intergenic
1000731660 5:164842495-164842517 GAGTATCCAGCAAGAGCAGAAGG - Intergenic
1001671429 5:173477436-173477458 CTTTATCAAGGCCGAGCTGAGGG + Intergenic
1001701939 5:173713012-173713034 CTGCAGCGAGGCAGAGCATAGGG + Intergenic
1002436349 5:179234250-179234272 GTGAATTCAGGCAGAGCAGCAGG - Intronic
1002865940 6:1122351-1122373 CCAGATCCAAGCAGAGCAGAAGG + Intergenic
1002993880 6:2264666-2264688 CTATATGCAGGCAGAACAAAGGG + Intergenic
1003299299 6:4862389-4862411 CTGTCACCAGGCAGAGCTGATGG - Intronic
1003972299 6:11311140-11311162 CTTCATCCAGGCAGGGCAGGAGG + Intronic
1004607116 6:17205252-17205274 CTGTAGCCAGGTAGAACATACGG - Intergenic
1006195394 6:32238119-32238141 CTGAATCCAGGGAGGGCACATGG - Intergenic
1006447969 6:34090564-34090586 CTGCAGCCTGGCAGAGCAAAAGG - Intronic
1007865605 6:44966145-44966167 CTGAATAGAGGCAGAGGAGAAGG - Intronic
1008023157 6:46603106-46603128 CTGTATGCAGCCATAGCATAGGG + Intronic
1008995373 6:57652503-57652525 TTGTAGCCAGGCAGGGTAGATGG + Intergenic
1009183899 6:60551259-60551281 TTGTAGCCAGGCAGGGTAGATGG + Intergenic
1009783252 6:68297310-68297332 CTGTACCCACCCAGAGCATAGGG + Intergenic
1011765905 6:90619372-90619394 GTGTAACCAGGAAGAGAAGAGGG - Intergenic
1013225808 6:108118693-108118715 TTGTATCCAGGCACAGCTGGGGG + Intronic
1014457253 6:121650193-121650215 CTGCAAGGAGGCAGAGCAGAGGG + Intergenic
1017905785 6:158756936-158756958 CTGTCCCCAGGCAGAGCACTGGG + Intronic
1018141055 6:160837669-160837691 CTGTCTCCAGCCAGAGCACTGGG - Intergenic
1018818041 6:167350628-167350650 CTGTCTCCAGCCAGAGCACTGGG + Intronic
1019462660 7:1169264-1169286 CTGTGTCCAAGCAGAAGAGAGGG + Intergenic
1020346088 7:7165140-7165162 CAGTAGCCAGGAAGAGAAGATGG + Intronic
1022647104 7:32241821-32241843 CTGTATCCACAGAGAGGAGATGG + Intronic
1023045901 7:36209956-36209978 CTGAGTCCAGCCAGTGCAGAGGG + Intronic
1024256528 7:47543947-47543969 CTGTGACGAGTCAGAGCAGAGGG - Intronic
1028721242 7:94034377-94034399 CTGTAACTGGGCTGAGCAGATGG - Intergenic
1029151697 7:98484777-98484799 CTGTATCCAGGCAGACCACCAGG - Intergenic
1031018155 7:116597764-116597786 CTCTGTCAAGGAAGAGCAGAAGG + Intergenic
1032188352 7:129747091-129747113 CTTGAGCCAGGCAGAGCACAGGG - Intronic
1032784115 7:135187075-135187097 CTGTATCCAGACAGCACAAAGGG + Exonic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1033276039 7:139972156-139972178 CTGAGTCCCTGCAGAGCAGAGGG + Intronic
1033881377 7:145887606-145887628 CTGTATACAGGCTGAGCGCAGGG + Intergenic
1034086218 7:148324944-148324966 TTCTAATCAGGCAGAGCAGAAGG + Intronic
1035239158 7:157518900-157518922 CTGTGTCCAGGCAGGGCAGTTGG - Intergenic
1038011723 8:23481393-23481415 CTGTGTGCAGGCACAACAGAGGG + Intergenic
1038677643 8:29637902-29637924 CAGTAGACAGGCAGAGCAGGGGG - Intergenic
1038684938 8:29707884-29707906 CTGTATCAAGGGAGACCACATGG - Intergenic
1041171478 8:55146841-55146863 CTGTATCAAGGGACAGCAGAAGG - Intronic
1042557709 8:70047401-70047423 TTGTACCCAGGCAAAGCACAGGG - Intergenic
1043170703 8:76962366-76962388 CTGTATCCACCCATAGAAGAAGG - Intergenic
1046508287 8:115164627-115164649 CTGTTTCCAGGAAAAGCAGGAGG + Intergenic
1047174125 8:122524370-122524392 CTGTGTCCATGTAGAGCAGTGGG - Intergenic
1047773975 8:128053905-128053927 TTGTATGCAGGAAGATCAGAGGG - Intergenic
1047954552 8:129963589-129963611 CTCTATTCAGGCAGTGAAGATGG + Intronic
1048230155 8:132631263-132631285 CTGTGTCCAGGCTGACCAGCTGG + Intronic
1048438087 8:134436268-134436290 CTGTATCATAGCACAGCAGAAGG + Intergenic
1048577873 8:135707066-135707088 CTGTGTCCTCACAGAGCAGAAGG - Intergenic
1049683981 8:143931957-143931979 CTGTATCGAGGCACACCTGAAGG - Exonic
1050179862 9:2909857-2909879 CTGTATAGAGACAGAGCAGGTGG + Intergenic
1050875068 9:10623687-10623709 CTCTATTAAGGCAGTGCAGAGGG - Intergenic
1053200245 9:36147320-36147342 CTGGACCTAGGGAGAGCAGAGGG - Intronic
1057014860 9:91642621-91642643 CTGCAGGCAGGCAGAGCAGGGGG - Intronic
1057743924 9:97736518-97736540 CTGCATCCAGGCACAGATGACGG - Intergenic
1059471805 9:114510754-114510776 ATGTAGTCTGGCAGAGCAGAGGG - Intergenic
1060135285 9:121147656-121147678 CTGTATTCATCCAAAGCAGAGGG + Intronic
1062409091 9:136413139-136413161 CTGTTCCCAGATAGAGCAGAGGG + Intronic
1186449017 X:9656541-9656563 CTGTAACCAGGCAGCTGAGAGGG + Intronic
1189297637 X:39930067-39930089 GCGTCTCCAGGCAGAGCAGGAGG + Intergenic
1189963634 X:46349834-46349856 CTGTATCCTCACAGAGCAGAAGG + Intergenic
1190170888 X:48110747-48110769 CTGTATCCTGTCAGGGCTGAGGG + Intergenic
1190177019 X:48158712-48158734 CTGTATCCTGCCAGGGCTGAGGG + Intergenic
1190188758 X:48258010-48258032 CTGTATCCTGTCAGAGCTGAGGG + Intronic
1190194276 X:48304055-48304077 CTGTATCCTGTCAGGGCTGAGGG - Intergenic
1190203723 X:48384825-48384847 CTGTATCCTGTCAGGGCTGAGGG + Intronic
1190206813 X:48410578-48410600 CTGTATCCTGTCAGGGCTGAGGG - Intronic
1190218869 X:48498035-48498057 CTGTCTCCATTCAGAGCAGATGG + Intergenic
1190655748 X:52610968-52610990 CTGTATCCTGTCAGGGCTGAGGG - Intergenic
1190657646 X:52625766-52625788 CTGTATCCTGTCAGAGCTGAGGG + Intergenic
1190660792 X:52652698-52652720 CTGTATCCTGTCAGGGCTGAGGG - Intronic
1190666964 X:52704956-52704978 CTGTATCCTGTCAGGGCTGAGGG - Intronic
1190672454 X:52753452-52753474 CTGTATCCTGTCAGGGCTGAGGG + Intronic
1191056327 X:56245161-56245183 CTGTATCCTGTCAAAGCACAAGG + Intronic
1192226708 X:69233565-69233587 CTGGATGCAGGCAGAGAACATGG - Intergenic
1192245533 X:69368847-69368869 CTGAAACTGGGCAGAGCAGACGG - Intergenic
1195866720 X:109440243-109440265 CTGTGTCCTCCCAGAGCAGAAGG + Intronic
1196738199 X:118999392-118999414 CTGCTTCCAGGCAGAGCAATGGG + Intronic
1196972807 X:121127998-121128020 CTGTATCCTCACATAGCAGAAGG + Intergenic
1197075033 X:122343469-122343491 CTCTACTCAGGCAGTGCAGAGGG - Intergenic
1197095706 X:122592096-122592118 TTGTAGCCAGGGAGAGAAGAAGG + Intergenic
1198365105 X:135932088-135932110 CCCTATCCAGGCATAACAGAGGG + Intergenic
1199125719 X:144117225-144117247 CTGTTTCTAGGCATAGCAAAAGG - Intergenic
1199505555 X:148557485-148557507 CTGTGTCCTGCCATAGCAGAAGG + Intronic
1199585932 X:149415664-149415686 CTGTCTCCAACCAGAGCACATGG - Intergenic
1200759719 Y:7026734-7026756 CTGTAACCAGGCAGTTGAGATGG + Intronic
1201644072 Y:16208240-16208262 CTCTACCCAGGAAGACCAGATGG + Intergenic
1201658743 Y:16377081-16377103 CTCTACCCAGGAAGACCAGATGG - Intergenic