ID: 1175739993

View in Genome Browser
Species Human (GRCh38)
Location 20:61413499-61413521
Sequence CTGTAAACTGGGGAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 306}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175739980_1175739993 2 Left 1175739980 20:61413474-61413496 CCCCCCTGAGCCTCAGTCTCCTC 0: 3
1: 103
2: 810
3: 2957
4: 7518
Right 1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 306
1175739983_1175739993 -1 Left 1175739983 20:61413477-61413499 CCCTGAGCCTCAGTCTCCTCATC 0: 5
1: 97
2: 584
3: 1590
4: 3257
Right 1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 306
1175739985_1175739993 -8 Left 1175739985 20:61413484-61413506 CCTCAGTCTCCTCATCTGTAAAC 0: 3
1: 122
2: 1743
3: 6731
4: 14380
Right 1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 306
1175739984_1175739993 -2 Left 1175739984 20:61413478-61413500 CCTGAGCCTCAGTCTCCTCATCT 0: 7
1: 124
2: 770
3: 1960
4: 3847
Right 1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 306
1175739982_1175739993 0 Left 1175739982 20:61413476-61413498 CCCCTGAGCCTCAGTCTCCTCAT 0: 5
1: 89
2: 487
3: 1378
4: 3044
Right 1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 306
1175739981_1175739993 1 Left 1175739981 20:61413475-61413497 CCCCCTGAGCCTCAGTCTCCTCA 0: 1
1: 24
2: 173
3: 752
4: 2149
Right 1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 306
1175739979_1175739993 19 Left 1175739979 20:61413457-61413479 CCTGAGTCTGTAACAAGCCCCCC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175739993 Original CRISPR CTGTAAACTGGGGAGGTGGT GGG Intronic
900205945 1:1431958-1431980 CTGTAAGCTGGGCAGGCTGTGGG + Intergenic
900839719 1:5038470-5038492 CTGATAAGTGGGGAGGAGGTGGG - Intergenic
901238175 1:7678633-7678655 CAGTACACTGGGGATGCGGTAGG + Intronic
903194645 1:21676126-21676148 CTGTACTCTGGGGTGGGGGTGGG + Intergenic
903524091 1:23979943-23979965 CTGCAAACTGCGGAGGGGGAGGG + Intronic
903878233 1:26490856-26490878 CTGGAGACTGGGGTGGAGGTTGG + Intergenic
904697338 1:32337689-32337711 CTGTGAAATGGGGCGGGGGTGGG - Intergenic
904903757 1:33878453-33878475 CTGTAAGCTAGGGAGGTGAGGGG - Intronic
904963566 1:34354346-34354368 TTGTAAACTGAAGATGTGGTGGG + Intergenic
905037370 1:34926915-34926937 CTGGAAACTGGGGAGGATGAAGG + Intronic
905399865 1:37693207-37693229 ATGAAAAATGGGGGGGTGGTTGG + Intronic
906279630 1:44544163-44544185 CTGTGAACTGGAGCGGGGGTGGG + Intronic
907335214 1:53695125-53695147 CTGTCAGCTGGGGTGGGGGTGGG + Intronic
907344465 1:53763151-53763173 TTGTAAACTCGGGAGCTGGATGG + Intergenic
907430226 1:54406924-54406946 CTGGAGTCTGGGGAGGGGGTCGG - Intronic
908494943 1:64685430-64685452 TTGTACACTGTGGAGGTGGAGGG + Intronic
910108259 1:83654429-83654451 CTGTAAAGTGAGGAGGTCATAGG + Intergenic
911240112 1:95455811-95455833 CTGAGCTCTGGGGAGGTGGTCGG + Intergenic
911332417 1:96540767-96540789 GTGTACACTGCGCAGGTGGTGGG - Intergenic
911952501 1:104193100-104193122 CTGTAAAGTGGTGAGGAAGTAGG + Intergenic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
914395977 1:147268868-147268890 CTGTATTCTGGGTAGGTGGTAGG + Exonic
915673668 1:157511235-157511257 CTGTAAAATAGGGATGTGGCAGG + Intergenic
915839178 1:159201596-159201618 CTGTAACCTGGGGAGGACGCGGG + Exonic
917632025 1:176899682-176899704 CAGTAGACTGGGGTGGGGGTTGG - Intronic
917735976 1:177920882-177920904 CTGGAAAGGGGAGAGGTGGTGGG - Intergenic
918543814 1:185660033-185660055 TTGGAAACTGGGGAGTGGGTGGG - Intergenic
919546001 1:198919599-198919621 CTGTTAACTGGTGAGGTGGGTGG - Intergenic
920789810 1:209079155-209079177 CTGTAAAATGGAGATGTGTTTGG + Intergenic
923080002 1:230644166-230644188 GTGCAAACTGGGGTGGTGGCTGG + Intronic
923547275 1:234932019-234932041 GTGTAGACTGGGGAGGGGGCGGG - Intergenic
924410147 1:243795964-243795986 CTGAAAACAGGGGAGCTGGTCGG - Intronic
1063549296 10:7014562-7014584 CTGTAAACTGGGATGGTAATAGG - Intergenic
1064090031 10:12375459-12375481 CTGTAAACAGGTGAGGGGGGAGG - Intronic
1065152943 10:22840743-22840765 CTGGTCACTGGGGATGTGGTAGG + Intergenic
1065332026 10:24612230-24612252 CTGTAATTTGGGGAGGGGTTAGG - Intronic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1071299758 10:84247751-84247773 CTGTGGACTGGGGAGGGGGCTGG - Intronic
1071300560 10:84253192-84253214 CTGAAAACTGGCCAGGTGATGGG + Intronic
1071602667 10:86966443-86966465 CAGCAAACTGGGGCGGGGGTGGG + Intronic
1072561598 10:96580841-96580863 CTGTAAAATGGGGAAGTAATAGG - Intronic
1072858596 10:98977402-98977424 ATGTACACTGGGGAGGTACTAGG + Intronic
1072903494 10:99430277-99430299 CTGTAAAATGGGCAGGTTTTAGG + Intronic
1073011007 10:100359577-100359599 GTGTGAACTGGGGAGGAGGGGGG - Intronic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1073206089 10:101770215-101770237 CTGCAGGCTGGGGAGGTGCTGGG - Intronic
1073546599 10:104354453-104354475 CTGTAATATGGGGGAGTGGTGGG - Intronic
1074294490 10:112171201-112171223 TAGGAAACTGGGTAGGTGGTAGG - Intronic
1076361770 10:129894632-129894654 CTGCAACCTGGGGAGCTGGAGGG - Intronic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1077274547 11:1697840-1697862 CTGGGAACTGGGAAGGTGTTGGG - Intergenic
1077881501 11:6354148-6354170 CTGAAAACTGGGGTGAGGGTAGG - Intergenic
1079069873 11:17334908-17334930 ATGTAAACTTGTGAGGTGCTAGG - Intronic
1081527260 11:43935512-43935534 CTGTAAAGTGGGGTGATGCTTGG + Intronic
1081632439 11:44699090-44699112 CACTAAACTGAGCAGGTGGTGGG - Intergenic
1081644227 11:44778586-44778608 CTGTAAAATGGGGAGAGGGATGG + Intronic
1081851894 11:46279612-46279634 CTGTAAAATGGGGGAGAGGTTGG + Intronic
1082787090 11:57323297-57323319 ATGGGAACTGAGGAGGTGGTTGG - Intronic
1083636283 11:64122660-64122682 CTGTAAAGTGGGGGTGTGCTAGG + Intronic
1084194462 11:67516557-67516579 CTGAGGCCTGGGGAGGTGGTGGG + Intergenic
1084947582 11:72646969-72646991 TTATAGACTGGGGAGATGGTGGG - Intronic
1085311576 11:75520089-75520111 CTGTTCACAGGGAAGGTGGTGGG + Intronic
1085755560 11:79198584-79198606 CAGGAAACTGGTGAGTTGGTGGG + Intronic
1086811133 11:91311711-91311733 CTGCAGTCTGGGGTGGTGGTGGG + Intergenic
1086833220 11:91592207-91592229 CTTTAAACTGGGGGTGGGGTTGG + Intergenic
1087539570 11:99498572-99498594 CTGAATACTGTGGAGGTGGGTGG - Intronic
1089648209 11:119894123-119894145 CTGTAAAATGGGGAGTTGGGGGG + Intergenic
1090081102 11:123613354-123613376 CTGTATTCTGGGAAGTTGGTTGG - Intronic
1090352180 11:126114682-126114704 CAGCCAGCTGGGGAGGTGGTGGG - Intergenic
1090534950 11:127630837-127630859 CTGTATTCTGTGGAAGTGGTGGG - Intergenic
1090964117 11:131583300-131583322 CAGTATATTGGGGAGGTGGATGG - Intronic
1091045184 11:132318837-132318859 CTGTAGACTTTGGAGGTGGAGGG + Intronic
1091263133 11:134249699-134249721 CTGTAAAAGGGGGATGGGGTGGG + Intronic
1091786944 12:3248888-3248910 CTGGGAGCTGGGCAGGTGGTGGG - Intronic
1092584185 12:9879344-9879366 CACTCAACTGGGGAGGAGGTAGG + Intergenic
1096547454 12:52350441-52350463 CTGCAAAATGGGGACATGGTTGG - Intergenic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1098339549 12:69437729-69437751 ATGTTAATTGGGGCGGTGGTGGG + Intergenic
1098382238 12:69881408-69881430 CTAGAATCTGGGGAAGTGGTGGG - Intronic
1100317053 12:93454159-93454181 TGGAAAACTGGGGAGGTGGCTGG - Intergenic
1101587907 12:106101144-106101166 CTGCAACCTGGGGGCGTGGTGGG - Intronic
1101658065 12:106741787-106741809 CTATAGACTGGGGAAGAGGTGGG + Intronic
1101716293 12:107315980-107316002 CAGTAAACCTGGGTGGTGGTGGG - Intergenic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102843946 12:116157608-116157630 CTGTAAAACGGAGAGGTAGTAGG - Intronic
1102894204 12:116585590-116585612 CTGTAAACTGGGAAGCTGTTAGG + Intergenic
1103822338 12:123709124-123709146 TTGTAAACTGGGGTCTTGGTTGG - Intergenic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG + Intergenic
1105313825 13:19237893-19237915 CTGGGAAGTGGGGAGGGGGTTGG + Intergenic
1108653261 13:52502980-52503002 GTGAAAACTGAGGAGGTGATTGG + Intergenic
1110474032 13:75892217-75892239 ATGTAAAATGGGGGCGTGGTGGG - Intergenic
1113866412 13:113528568-113528590 CTGTGAATTGGGGAGGACGTGGG + Intronic
1115331315 14:32201621-32201643 CTGAGAGCTGGGGAGGCGGTTGG - Intergenic
1116616509 14:47147502-47147524 CTGTTGATAGGGGAGGTGGTCGG - Intronic
1118731707 14:68671369-68671391 CAGCAAACTGGAGATGTGGTAGG - Intronic
1118997349 14:70848719-70848741 TTTTAAACTGGGGAGGAGGCCGG + Intergenic
1119529500 14:75349765-75349787 CTGTACACTGAGGATGTAGTGGG + Intergenic
1119853627 14:77883688-77883710 AGGGACACTGGGGAGGTGGTGGG + Intronic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121168773 14:91836124-91836146 CTTTAAAATGGGGCCGTGGTGGG - Intronic
1121245918 14:92460770-92460792 CTGATAAGTGGGGAGGTGGGAGG + Intronic
1122107893 14:99473072-99473094 CTGTTAGATGGGGAGGTTGTTGG - Intronic
1122330239 14:100907023-100907045 CTGCAAAATGGAGAGGTGGAAGG + Intergenic
1122393213 14:101404795-101404817 CAGAATAGTGGGGAGGTGGTGGG + Intergenic
1123762503 15:23443748-23443770 CAGGAGACTGGGGAGGTGATTGG + Intronic
1126557338 15:50004038-50004060 CTGGTAACTGGGGAGATGGGCGG - Intronic
1127202723 15:56673910-56673932 CTAAAGATTGGGGAGGTGGTAGG - Intronic
1127315873 15:57793078-57793100 CTGAGAACTGGGGAGGTCTTAGG + Intergenic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1128382600 15:67124354-67124376 GTGTAAACTGCAGAGGTGGATGG - Intronic
1128742243 15:70091968-70091990 CTTTAAGCTGGGGTGGGGGTGGG - Intronic
1129078130 15:73015159-73015181 ATGTAAACTTGGGAGTTGCTGGG - Intergenic
1129093780 15:73181721-73181743 GTGGAACCTGGGGAGGTGTTTGG - Intronic
1129254556 15:74326780-74326802 CTGGAAAGTGGGGAGGGGGCTGG + Intronic
1130097524 15:80867084-80867106 CTGTAAAATGGGGAGGGTGGGGG + Intronic
1131636284 15:94236218-94236240 CTGTGGCCTGGGGAGGTGCTTGG - Intronic
1132000359 15:98173145-98173167 CTGAAGACTGGGGGGGTGGGGGG + Intergenic
1136287558 16:29253391-29253413 CTGCAGCCTGGGGAGGTGGGGGG - Intergenic
1138453363 16:57106682-57106704 CTGTGAAGTGAGGAGGGGGTAGG + Intronic
1139576657 16:67846602-67846624 CTGTGCACTGGGGTGGGGGTTGG - Intronic
1139652683 16:68370557-68370579 CTGTAAAGTGGAGAGAGGGTGGG - Intronic
1139661255 16:68422395-68422417 CTGTGATCTGGGCAGGTGCTTGG + Intronic
1142093177 16:88226020-88226042 CTGCAGCCTGGGGAGGTGGGGGG - Intergenic
1144574008 17:16417678-16417700 CTGAAAACTGGAGAGCTGGAGGG - Exonic
1144805430 17:17963144-17963166 CTGTAAACTGTGGTGGTGAAGGG - Intronic
1145973424 17:28970291-28970313 CTGTAAAGTAGGGATGGGGTAGG + Intronic
1149183611 17:53971292-53971314 CAGAAAACTGGAGAGCTGGTAGG + Intergenic
1150286041 17:63954682-63954704 CTGAAGCCTGGGGAGGTGGTGGG + Intronic
1150299981 17:64039805-64039827 CAGTACACAGGGGAGGTGGGGGG + Exonic
1150422875 17:65055038-65055060 CTGGAAGCTCGGGAGGCGGTTGG + Intronic
1151438680 17:74114456-74114478 ATCTGAACTGGGGAGGGGGTGGG + Intergenic
1151486613 17:74404822-74404844 CCCTGAACTGGGGAGGAGGTGGG - Intergenic
1151527481 17:74680939-74680961 ATGTGAACAGGGGTGGTGGTGGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151979430 17:77499782-77499804 CTCTGAGCTGGGGAGGTGGGAGG + Exonic
1152205278 17:78971365-78971387 CTGGAAACTGGTGAGGTGGTGGG + Exonic
1152617433 17:81344444-81344466 TTCTAAACTGGGGAGGGGGGAGG + Intergenic
1153738461 18:8097708-8097730 CTGAAACCTGAGGAGGAGGTAGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154226549 18:12510194-12510216 CTAGAAACTGGGGAGGAGGGAGG + Intronic
1155492249 18:26410664-26410686 CTTGAGCCTGGGGAGGTGGTAGG + Intergenic
1156465140 18:37343964-37343986 CTGAAAAATGGGGAGGAGTTTGG - Intronic
1156844237 18:41645430-41645452 CTATATAATTGGGAGGTGGTTGG + Intergenic
1158187158 18:54783818-54783840 CTGTAAACTTGGGACATGTTTGG - Intronic
1160141386 18:76326721-76326743 TTGTAATCTAGGGAGATGGTTGG + Intergenic
1160921064 19:1520804-1520826 CTGTAAACTGGGGCATTAGTAGG + Intergenic
1161635613 19:5387030-5387052 CTGTAAAATGGGGATGTGTGTGG - Intergenic
1162087985 19:8260012-8260034 CTGTGAGATGGGGAGATGGTGGG + Intronic
1162760892 19:12887559-12887581 CTGTTTACTGGGGAGGGGGAGGG - Intergenic
1164933718 19:32195234-32195256 CTGCACACTGTGCAGGTGGTTGG + Intergenic
1166523036 19:43494338-43494360 CTTAAAACTGCGGGGGTGGTGGG - Intronic
1166777030 19:45319389-45319411 CTGTAAAATGGGGCTGTTGTGGG - Intronic
1166822028 19:45586461-45586483 CTGTAAAATGGGAAGGGGGCTGG - Intronic
1167608548 19:50494763-50494785 AAGTACACTGGTGAGGTGGTGGG + Intergenic
926073435 2:9920566-9920588 CTGTAGACTGGGGCGGGGGGCGG + Intronic
926748981 2:16183421-16183443 TTGGACACTGGGGAGATGGTGGG + Intergenic
927345780 2:22037583-22037605 CAGAAAACAGGGGACGTGGTGGG + Intergenic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928401644 2:30983192-30983214 CTGTAAGGTGGGGAGGTACTAGG + Intronic
929152717 2:38761813-38761835 CTGGAAACTGGGGAGGGAGTGGG - Intronic
929236493 2:39610564-39610586 TGGGAAACTGGGGAGGGGGTGGG + Intergenic
929314832 2:40464670-40464692 CTGAGAAGTGGGGATGTGGTGGG + Intronic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
931206773 2:60154526-60154548 CTGTAAAATGGGGAGAAGATTGG + Intergenic
931237489 2:60423778-60423800 CTGTAAAAAAGGGATGTGGTAGG + Intergenic
931258350 2:60595031-60595053 CAGCAAACTGGGCAGATGGTTGG + Intergenic
931752971 2:65347090-65347112 CTGCAAACTTACGAGGTGGTCGG - Intronic
931847658 2:66221453-66221475 CAGCAAACTGGGGATGTGTTGGG + Intergenic
931905373 2:66836916-66836938 CTGTAAAATGGGGTGATAGTAGG + Intergenic
932288386 2:70554779-70554801 CTGGAATTTGGGGAGGTGGAGGG + Intergenic
932811420 2:74829594-74829616 CAGTAATCCTGGGAGGTGGTTGG - Intergenic
933395722 2:81728506-81728528 ATGTGAACTTGGGAGGTGGGTGG + Intergenic
934085534 2:88506093-88506115 CTTTACACTGGGGAGGTGGGAGG + Intergenic
935126075 2:100223991-100224013 CTGTGAAGTGGGCAGTTGGTGGG - Intergenic
935329381 2:101965360-101965382 CTGGAAACTCTGGAGGTGGGTGG + Intergenic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
938140940 2:128794164-128794186 ATGAGGACTGGGGAGGTGGTTGG - Intergenic
938592442 2:132752529-132752551 CTACAAACTGGGCAGGGGGTGGG - Intronic
943932050 2:193867681-193867703 CTGTCAACTCGGTAGGGGGTAGG - Intergenic
946307965 2:218866604-218866626 CTGTAATCTGGGAGGGAGGTGGG + Intronic
947469276 2:230385763-230385785 CTTTAAACTGGGGAGGACATTGG - Intronic
1170728257 20:18948761-18948783 GTGTAGAATGGGGAGGGGGTGGG + Intergenic
1171147159 20:22794949-22794971 CAGGAAGCTGGGAAGGTGGTAGG + Intergenic
1171275358 20:23852188-23852210 GTGAAAACTGAGGGGGTGGTAGG - Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1173199720 20:40945592-40945614 CTAGGCACTGGGGAGGTGGTTGG - Intergenic
1173727336 20:45307006-45307028 TTGTATAGTGGGGAGGGGGTGGG - Intronic
1174442432 20:50566794-50566816 TTCTAAACTGGGGTGGTGCTGGG + Intronic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG + Intronic
1175839660 20:62018964-62018986 CTGTGAGCTGGGGAGGTTGCGGG - Intronic
1176672157 21:9744959-9744981 CTGTAAGCTAGGGAGGTGGGGGG - Intergenic
1176973407 21:15290685-15290707 CTGTCAACTGAGAAGGGGGTGGG + Intergenic
1179593575 21:42427563-42427585 CTGTAAAATGGGTAGGGGGCAGG - Intronic
1179650319 21:42804254-42804276 CTGTAAACTCCCGAGGTGATCGG + Intergenic
1181478783 22:23184558-23184580 ATGTTAACTGGGGAGGCTGTGGG - Intronic
1181573135 22:23778663-23778685 CTCCACACTGGGGAGGAGGTGGG + Intronic
1182060661 22:27394849-27394871 CTGGATACTGGGTAGGTGGATGG + Intergenic
1182062015 22:27405157-27405179 CTGCAAACTGTGGAGGTGGAAGG - Intergenic
1182521473 22:30887111-30887133 CTGTGAACTGTGGCGCTGGTGGG + Intronic
1183062910 22:35346681-35346703 CTGTAAAATGGGGGCGGGGTGGG - Intronic
1183751556 22:39723815-39723837 GTGGAGACTTGGGAGGTGGTGGG + Intergenic
1184396436 22:44244567-44244589 CTAGAAACTGGGGTGGTGGGGGG + Exonic
1184458793 22:44625739-44625761 CTGTAAAATGGGGATGAGGCTGG + Intergenic
1185406848 22:50657091-50657113 TTGAGAACTGGGGAGGTGGCCGG - Intergenic
949541759 3:5038062-5038084 CTGGATACAGAGGAGGTGGTGGG + Intergenic
950873787 3:16251740-16251762 CTGTAAAATGGGGTGGCGGTAGG - Intergenic
950924705 3:16728998-16729020 GTCTAAACTGGGGTGGAGGTGGG - Intergenic
952844270 3:37673831-37673853 TTGCAAAATGGGGAGGAGGTTGG + Intronic
954882156 3:53843818-53843840 CTGTAAAATGGGGTGGTGATAGG - Intronic
955101572 3:55854831-55854853 CTGTAAACTGGGGATGGGGAAGG + Intronic
956273331 3:67470972-67470994 CTGTTAACTGGGAGGGTGATGGG + Intronic
959082098 3:101812931-101812953 CTGTAAACTGCAGAGGTTTTAGG + Intronic
960189370 3:114684794-114684816 CTCACAAATGGGGAGGTGGTAGG + Intronic
960531684 3:118772579-118772601 CTCTAGATTGGGGAGGTGCTGGG - Intergenic
960939417 3:122923617-122923639 CTGGAAATTGGGGATGGGGTTGG + Exonic
960976192 3:123176882-123176904 AAGTAAAATGGGGGGGTGGTGGG + Intronic
961747065 3:129070954-129070976 CTGTAAAATGGAGAGGAGGAAGG - Intergenic
962886353 3:139631643-139631665 CAGTAAGCTGGGGAGGGGGCGGG - Intronic
964266281 3:154899346-154899368 ATTTAAACTGGGTAGGAGGTTGG + Intergenic
964683724 3:159370810-159370832 CTGAAAACTGGGGAGGTGGGAGG - Intronic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
967385465 3:188906595-188906617 CTGTGAACTACGGATGTGGTGGG - Intergenic
968474182 4:795424-795446 CTGGAAACGGGGGCGGGGGTGGG - Intronic
969343699 4:6558271-6558293 CTGTGACCTGGGGTGCTGGTGGG + Intronic
969497375 4:7533820-7533842 CTGTAAAGCGGGCAGGTGGAAGG + Intronic
969652292 4:8474941-8474963 CTCCAAACTGGGGAGCTGGAGGG - Intronic
971876954 4:32319382-32319404 CTGCCAACTTGGAAGGTGGTAGG + Intergenic
971957222 4:33436753-33436775 CTGTAAACTGAGGAGAGGGCTGG - Intergenic
974389325 4:61245034-61245056 CTGCAAACTGGTGAGTGGGTTGG + Intronic
974610915 4:64214295-64214317 CTCAAAACTGGGGAGAGGGTAGG + Intergenic
974622878 4:64384416-64384438 CTGTTAACTGTGGTGGTGGCAGG + Intronic
975109793 4:70610660-70610682 GAGTTAAATGGGGAGGTGGTAGG + Intergenic
977600302 4:98928570-98928592 CGGTGGACTGGGGAGCTGGTGGG - Intronic
979595074 4:122525723-122525745 CAGTAGACTGGGGTGGCGGTGGG - Intergenic
980823063 4:138041145-138041167 CAGTCAACTGGTGATGTGGTGGG + Intergenic
980845882 4:138324618-138324640 ATATAAACTGGGGATGTGGGAGG - Intergenic
981080419 4:140634384-140634406 ATGTAAACTGCAGAAGTGGTTGG - Intronic
981548192 4:145916019-145916041 CTGTACACTGGGGTGGGGGTTGG + Intronic
982067667 4:151668797-151668819 CTGTTGCCTGGGGAGGAGGTTGG - Intergenic
982421558 4:155204855-155204877 CTGTATACTGGGGCGGGGGGCGG + Intergenic
982979581 4:162115712-162115734 CTTTAAAATGGTGAGGGGGTGGG + Intronic
983442834 4:167809510-167809532 CTGACAACTCTGGAGGTGGTGGG - Intergenic
983450015 4:167897240-167897262 CTGTATACTGGGGAGGAGCCTGG - Intergenic
983715868 4:170780616-170780638 CGATAAAGAGGGGAGGTGGTTGG + Intergenic
983920019 4:173334696-173334718 CTGTAAACGGTGGGAGTGGTTGG + Exonic
984559699 4:181253907-181253929 CAGTAAGCTGGGCAGGTGGGAGG - Intergenic
985402579 4:189606889-189606911 CTGTAAGCTAGGGAGGTGGGGGG + Intergenic
985904789 5:2825085-2825107 GTGTACACAGGGGAGGTGTTTGG + Intergenic
985929354 5:3044536-3044558 TTGTGACCTGTGGAGGTGGTGGG + Intergenic
986023244 5:3824682-3824704 CTGTTAACTGAGGATGTGGATGG + Intergenic
986759712 5:10868771-10868793 CTGCTACCTGGGGAGGTGGGTGG + Intergenic
988082092 5:26427543-26427565 ATGTTAAATGGGGATGTGGTGGG + Intergenic
988636338 5:32988640-32988662 CTGTCTACTAGGGAGGTGGGGGG - Intergenic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
993957706 5:94256129-94256151 CTGTAAAATGAGGAGCTGTTTGG + Intronic
994051494 5:95367173-95367195 CTGGAGACTAGGAAGGTGGTGGG - Intergenic
995995172 5:118289642-118289664 CTGTAATCTCAGGGGGTGGTTGG + Intergenic
997257346 5:132439189-132439211 CTTTATGCTGGGGAGGTGGATGG + Intronic
997305631 5:132833875-132833897 CTGATAGGTGGGGAGGTGGTGGG + Intergenic
997816426 5:137023356-137023378 CTCTCTACTGGGGAGCTGGTTGG - Intronic
999775456 5:154809346-154809368 TTGAAAATTGGGGAGGGGGTGGG - Intronic
1001161654 5:169322399-169322421 CGGTAAATTGGAGAGGTGGAAGG + Intergenic
1001910985 5:175517590-175517612 CTGTGAACTTGGGGAGTGGTAGG - Intronic
1003115567 6:3281647-3281669 CTGTGAAGTGGGGGGATGGTAGG + Intronic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1004436550 6:15600701-15600723 CTGAGAACTGAGCAGGTGGTAGG + Intronic
1005675932 6:28154855-28154877 GTGTACAGTGGGGAGGTGGAAGG - Exonic
1007002057 6:38323221-38323243 CTGTAAATTTGGCAGGTGATGGG - Intronic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1009159554 6:60264764-60264786 AGGGAAACTGGGGTGGTGGTGGG + Intergenic
1015676360 6:135754445-135754467 CTGTACACAGGTGAGGTGCTCGG - Intergenic
1017104637 6:150875938-150875960 GTGTACACTGTGGAGGGGGTAGG - Intronic
1017158365 6:151342081-151342103 CGGTCAGCTGGGGAGGTGGGCGG + Intronic
1022474080 7:30699158-30699180 CTGTAAAATGGGGAGAAGGCTGG + Intronic
1023529408 7:41136986-41137008 CTGTCAACTCGGAAGGGGGTGGG + Intergenic
1024578099 7:50781357-50781379 GTGGGAACAGGGGAGGTGGTGGG - Intronic
1026367045 7:69659120-69659142 ATGTAAACAGGGGAGTTGGAGGG + Intronic
1026437112 7:70408649-70408671 CTGCTGACTGGGGAGGTGGTGGG - Intronic
1027172373 7:75881813-75881835 CTGTAAACTGCAGAGGGAGTCGG - Exonic
1028872490 7:95784558-95784580 CTGTAAACTGGTGAAGGGGTGGG + Intronic
1032480595 7:132243670-132243692 CTGTGAATTGGGGTGGGGGTGGG - Intronic
1032785951 7:135199512-135199534 CTAAGATCTGGGGAGGTGGTAGG + Intronic
1032925664 7:136602154-136602176 ATGTAAACTTGGAAAGTGGTTGG + Intergenic
1034453301 7:151149467-151149489 GAGAAAGCTGGGGAGGTGGTGGG - Intronic
1035133310 7:156675680-156675702 CTGTGAACTGAGGAGGAGGCGGG - Exonic
1036377482 8:8213390-8213412 GTGTCAGCTGGGGAAGTGGTGGG - Intergenic
1036852076 8:12209758-12209780 GTGTCAGCTGGGGAAGTGGTGGG + Intergenic
1036873443 8:12452280-12452302 GTGTCAGCTGGGGAAGTGGTGGG + Intergenic
1038699302 8:29835244-29835266 ATGTAAACTGGGCAGGAGTTGGG + Intergenic
1039195964 8:35031918-35031940 CAGTAAACTGGGGAAATGATGGG + Intergenic
1041187556 8:55316666-55316688 CTGCAATCTAGGGATGTGGTGGG - Intronic
1041620628 8:59963973-59963995 CTGGAAGCTGGGGTAGTGGTGGG + Intergenic
1042490582 8:69393290-69393312 CTGTAAATAAGGCAGGTGGTAGG + Intergenic
1042664382 8:71190084-71190106 TTACAAAATGGGGAGGTGGTTGG - Intergenic
1047409369 8:124611581-124611603 CTGTAAAGTGTTGAGGTGGGTGG - Intronic
1048474259 8:134729265-134729287 CTGTAAAATTGGGAGATGGCTGG + Intergenic
1048511134 8:135063898-135063920 CAGAAAACTGGGGCGGGGGTTGG - Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1050113455 9:2240351-2240373 TTGTAAATTGGGGAAGTGGGTGG + Intergenic
1050321877 9:4460556-4460578 ATTTAAACTCGGGGGGTGGTGGG - Intergenic
1050709919 9:8449919-8449941 CTGAAAACTTGGGAGGTGGGGGG - Intronic
1055668408 9:78575147-78575169 CTGTGAACTGGGGTGTTGGGGGG + Intergenic
1057717778 9:97508523-97508545 CTATAAACTGGGGTTGTTGTGGG + Intronic
1057930044 9:99185255-99185277 CTGTACAGCGGGCAGGTGGTGGG + Intergenic
1058763512 9:108159758-108159780 CTGTGACCTGGGGTGGTGGCGGG + Intergenic
1059621833 9:116014152-116014174 CTTTGTACTGGGGAGATGGTTGG + Intergenic
1059791679 9:117647525-117647547 CTTGAACCTGGGGAGGTGGAGGG - Intergenic
1060286469 9:122257837-122257859 CTGTTGAATGGGGAAGTGGTAGG + Intronic
1061201463 9:129140772-129140794 CTGCAGACTGGGGAAGGGGTGGG + Intronic
1062339822 9:136089092-136089114 CTGAAAGCTGGTCAGGTGGTTGG - Intronic
1186812893 X:13207628-13207650 CTGGAAAGTGGGGGGGTGGATGG - Intergenic
1188770273 X:34145753-34145775 CTTGAACCTGGGGAGGTGGAGGG + Intergenic
1189002240 X:36958765-36958787 CTTTGAACTGGGGAGATGGGAGG - Intergenic
1189312874 X:40032494-40032516 CTGGAAACGGGGGCGGGGGTGGG - Intergenic
1189537670 X:41953376-41953398 CTGTAAAATGGGATAGTGGTGGG + Intergenic
1190030083 X:46963667-46963689 CTGTCAACTGGGGCAGTGGTAGG + Intronic
1190534417 X:51411520-51411542 CTGTGAACTGGGAAAGAGGTGGG + Intergenic
1192175815 X:68884754-68884776 CTGTAAAATGGGGTTGTTGTGGG - Intergenic
1192808332 X:74529099-74529121 CTATAAAATGGGGTGGTGGGAGG - Intronic
1194412928 X:93578375-93578397 CTGAATGCTGGGGACGTGGTAGG + Intergenic
1195485248 X:105397277-105397299 CTATGGACTGGGGAGGTGGCAGG - Intronic
1195661796 X:107386002-107386024 TTGGAAACTGGGGAAGAGGTTGG - Intergenic
1195766606 X:108302996-108303018 CTGCAAATTGGGGGGGTGGAGGG - Intronic
1195970397 X:110466907-110466929 CAGGAGGCTGGGGAGGTGGTGGG - Intergenic
1196090070 X:111731316-111731338 CTGTAAACTGGGGAGGGAGGGGG - Intronic
1196717413 X:118824485-118824507 CTGGCAACAGCGGAGGTGGTGGG + Intronic
1196844327 X:119886670-119886692 CTGTAAAGTGCGCAGGTGGCAGG - Intergenic
1198200034 X:134407153-134407175 CTGTAAAACAGGGTGGTGGTGGG + Intronic