ID: 1175744080 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:61441656-61441678 |
| Sequence | ATGTGTGCTCACATGGAAGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2307 | |||
| Summary | {0: 1, 1: 4, 2: 55, 3: 571, 4: 1676} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175744080_1175744082 | -6 | Left | 1175744080 | 20:61441656-61441678 | CCGTCTTCCATGTGAGCACACAT | 0: 1 1: 4 2: 55 3: 571 4: 1676 |
||
| Right | 1175744082 | 20:61441673-61441695 | ACACATAGAAAGTACCATTTAGG | 0: 1 1: 0 2: 3 3: 39 4: 399 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175744080 | Original CRISPR | ATGTGTGCTCACATGGAAGA CGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||