ID: 1175744080

View in Genome Browser
Species Human (GRCh38)
Location 20:61441656-61441678
Sequence ATGTGTGCTCACATGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2307
Summary {0: 1, 1: 4, 2: 55, 3: 571, 4: 1676}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175744080_1175744082 -6 Left 1175744080 20:61441656-61441678 CCGTCTTCCATGTGAGCACACAT 0: 1
1: 4
2: 55
3: 571
4: 1676
Right 1175744082 20:61441673-61441695 ACACATAGAAAGTACCATTTAGG 0: 1
1: 0
2: 3
3: 39
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175744080 Original CRISPR ATGTGTGCTCACATGGAAGA CGG (reversed) Intronic
Too many off-targets to display for this crispr