ID: 1175746216

View in Genome Browser
Species Human (GRCh38)
Location 20:61459200-61459222
Sequence TCTCCAGAAGGTTGGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175746206_1175746216 23 Left 1175746206 20:61459154-61459176 CCTGGTGGCTGCTTTAGCTTCTT 0: 1
1: 0
2: 4
3: 24
4: 254
Right 1175746216 20:61459200-61459222 TCTCCAGAAGGTTGGTCCTGTGG 0: 1
1: 0
2: 1
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175746216 Original CRISPR TCTCCAGAAGGTTGGTCCTG TGG Intronic
900795915 1:4708346-4708368 CCTCCTGATGGTTGGTGCTGTGG + Intronic
901797078 1:11686054-11686076 TGTCCAGAGGGTTTGTTCTGGGG - Intronic
903958632 1:27042259-27042281 CCTTCAAGAGGTTGGTCCTGGGG - Intergenic
904597893 1:31658243-31658265 TCTGCAGAAGGTTGATGCTGAGG + Intronic
904997082 1:34639658-34639680 TCTGCCCAGGGTTGGTCCTGGGG + Intergenic
906252418 1:44320947-44320969 TCTCCAGAATGAAGGACCTGGGG - Intronic
907743468 1:57189678-57189700 TCTCCAGATGGTTGGTCCATAGG - Intronic
909102051 1:71359925-71359947 TCACCACAAGCTTGGTCCTATGG - Intergenic
909189840 1:72538379-72538401 TCCCCAGTGGGTAGGTCCTGTGG + Intergenic
909836624 1:80262629-80262651 TCTCTATAAGGCTGGTCCAGTGG - Intergenic
911070110 1:93825650-93825672 ACTCCAGAGGTTTGGCCCTGGGG - Intronic
911516523 1:98874572-98874594 TCTCCTTAAGCCTGGTCCTGAGG + Intergenic
912985635 1:114426765-114426787 TGTCCAGTAGTTAGGTCCTGAGG - Intronic
917330024 1:173870991-173871013 TCTCCAGAAGGCTGATTCTCAGG - Exonic
918927626 1:190808997-190809019 ACTTCAGAAGGATGGTACTGAGG + Intergenic
920051250 1:203166323-203166345 TCTCCTTAAGCTTGGTCCTGGGG - Exonic
1065874127 10:29982550-29982572 TCTCCAGTAGGTTGTTTCTTTGG - Intergenic
1071003380 10:80855862-80855884 TCCCCAGAGGGATGGTCATGGGG - Intergenic
1071194322 10:83139969-83139991 TCTCCAAAATGTTGGACCTCAGG + Intergenic
1075080573 10:119380938-119380960 GCTCCTGAGGGATGGTCCTGTGG + Intronic
1077115065 11:880419-880441 TGTCCACACGGCTGGTCCTGGGG - Intronic
1077468107 11:2743276-2743298 CCTCCAGAAGGTGGGGTCTGAGG + Intronic
1077487674 11:2846541-2846563 TCCCTAGGAGGTTGGACCTGGGG - Intronic
1083540398 11:63508194-63508216 TCCCCAGAAGCCTGGTACTGGGG - Intronic
1085522510 11:77146736-77146758 CCCCCAGAAGGCAGGTCCTGGGG + Intronic
1086610429 11:88748713-88748735 TTTCTGGAAGCTTGGTCCTGGGG - Intronic
1087091280 11:94275900-94275922 TCTGCAGAGGCTTGGGCCTGAGG - Intergenic
1090344643 11:126059831-126059853 TCTCCTGAATAATGGTCCTGAGG - Intronic
1091908927 12:4213053-4213075 TCTCCAGAAGGCAGATGCTGCGG - Intergenic
1091933740 12:4417906-4417928 TCTCCGGATGGTTTCTCCTGGGG - Intergenic
1097003248 12:55896336-55896358 TCTCCTGAAGGATCTTCCTGAGG + Intergenic
1098217575 12:68236397-68236419 TCTTCAGAAGGTTGTTCCAATGG - Intergenic
1102624665 12:114225375-114225397 TCTCCAGAAGGTCTGACATGGGG + Intergenic
1102814164 12:115849432-115849454 TTGGCAGAAGGTTGCTCCTGGGG + Intergenic
1103912286 12:124359182-124359204 TCTCCATAGGATTGGTCCTCAGG - Intronic
1104805384 12:131586375-131586397 GCTCCCGAAGGATGGGCCTGGGG + Intergenic
1106543119 13:30707581-30707603 TCGTCAGAAGGTCGGTACTGTGG - Intergenic
1106897062 13:34314891-34314913 TCTCCAGCATGGTGGTCATGAGG - Intergenic
1107771797 13:43794643-43794665 TCTGCAGAAGCTTGGCCCAGAGG + Intergenic
1110358427 13:74595933-74595955 TCTCCAGAAGTGTATTCCTGAGG + Intergenic
1112762675 13:102709067-102709089 TCTGCAGGAGCTGGGTCCTGGGG - Intergenic
1113737393 13:112688784-112688806 TCTGCAGCAGGTTGTCCCTGTGG + Intergenic
1114535428 14:23419353-23419375 TCTCCAGAAAATGGGGCCTGAGG - Intronic
1117816771 14:59606818-59606840 CCACCAGAAGGTTGGCCCTTTGG + Intronic
1119387613 14:74267629-74267651 TCCCCAGAGGGTAGGTCTTGGGG - Intergenic
1121790585 14:96696745-96696767 TCCCCAGCAGGCTGTTCCTGGGG - Intergenic
1122718543 14:103709246-103709268 TCCCCAGATGGCAGGTCCTGGGG - Intronic
1122784605 14:104157933-104157955 TCTTCATAAGGTATGTCCTGGGG + Exonic
1122944272 14:104998806-104998828 ACTCCAGTAGGGTGCTCCTGGGG - Intronic
1123500569 15:20877851-20877873 TCTTCAGAGGGCTGTTCCTGCGG + Intergenic
1123557814 15:21451544-21451566 TCTTCAGAGGGCTGTTCCTGCGG + Intergenic
1123594041 15:21888825-21888847 TCTTCAGAGGGCTGTTCCTGCGG + Intergenic
1125001045 15:34770221-34770243 TCTGCAGAAGGCTGTGCCTGAGG - Intergenic
1128067249 15:64773165-64773187 TCTCCAGATGGTTGCTCTTAGGG + Intronic
1128580673 15:68807547-68807569 TCTCCAGAAGGTGCTTGCTGGGG - Intronic
1132325341 15:100964186-100964208 TCTCCAGATGGTGGGTGCTCAGG - Intronic
1202966164 15_KI270727v1_random:178716-178738 TCTTCAGAGGGCTGTTCCTGCGG + Intergenic
1132959182 16:2612725-2612747 TCACCAGATGGTGGCTCCTGTGG - Intergenic
1132972242 16:2694700-2694722 TCACCAGATGGTGGCTCCTGTGG - Intronic
1135967085 16:27044731-27044753 TCTCCAGTAGGCTGGCCCAGGGG - Intergenic
1136470369 16:30475484-30475506 GCACCAGAAGGTTGGTCTGGAGG - Intronic
1137716496 16:50601508-50601530 TCTGGAGAAGGCTGGGCCTGAGG + Intronic
1138542664 16:57697942-57697964 GCTCCAGAATGGAGGTCCTGAGG + Exonic
1139636734 16:68262733-68262755 TATCCTGCAGGGTGGTCCTGAGG + Intergenic
1141095450 16:81159769-81159791 TCTCCAAAACGCAGGTCCTGTGG + Intergenic
1141613557 16:85197551-85197573 GTTCCAGAAGATGGGTCCTGGGG + Intergenic
1142716299 17:1748753-1748775 TGTCCAGCAGGCTGGGCCTGAGG + Intronic
1142938749 17:3362856-3362878 TCTCCATAGTGTTGGGCCTGTGG - Intergenic
1143601308 17:7947992-7948014 TCTGAAGAAGGTTGGGGCTGGGG + Intronic
1143976839 17:10836649-10836671 TCTCTAGATGGTGGGGCCTGAGG - Intronic
1144822985 17:18088398-18088420 TCTCCTGATGGCTGGGCCTGGGG + Intronic
1147511096 17:41069506-41069528 TCTCCAGTGGGTAGGTCCTATGG + Intergenic
1148115042 17:45170496-45170518 TCTGCAGGGGGTTGGGCCTGAGG + Intergenic
1148166165 17:45485374-45485396 TCTCTAGAAGGGTGGGCCTGAGG - Intronic
1150397389 17:64832098-64832120 TCTCTAGAAGGGTGGGCCTGAGG - Intergenic
1155930958 18:31708131-31708153 TCTACAGAAGGTTTGGCATGAGG + Intergenic
1157965365 18:52202814-52202836 TCTCCGGAAGGGTGGTCCTCAGG + Intergenic
1160402343 18:78620185-78620207 CCTCCAGCATCTTGGTCCTGTGG + Intergenic
1162088417 19:8262183-8262205 TCTCCAGAAAGGTGGCCCAGGGG - Exonic
1163388567 19:17015565-17015587 GGTCCAGAAGGCTGGTCCTGCGG - Intronic
1163845217 19:19634779-19634801 TCTTCAGGAGGTTGGTGCTCAGG - Exonic
1164434894 19:28220585-28220607 ACTCGAGACGGTTGGTGCTGAGG - Intergenic
1168105283 19:54162436-54162458 TGTCCAGAGGGCGGGTCCTGAGG + Intronic
926161696 2:10494389-10494411 TCTGCAGAAGGATGGGGCTGTGG + Intergenic
926918160 2:17913325-17913347 TCTCCACAAGGTTGGAACTTCGG + Intronic
927464844 2:23329233-23329255 TCTCCAGAGGGTTGCTTGTGGGG - Intergenic
928314463 2:30234926-30234948 TCTGCAGAAGGGTGGTCTGGTGG + Intronic
929575409 2:43048908-43048930 TATCCAGATGTTTGGCCCTGGGG + Intergenic
934051298 2:88213461-88213483 TCTCCAGAAGTTGGGGACTGGGG - Intergenic
935339004 2:102043113-102043135 TCTCCTGGAGGTAGATCCTGAGG + Intergenic
935538168 2:104318542-104318564 GCTCCAGAAAGTTGGATCTGAGG + Intergenic
936869603 2:117119454-117119476 TCTCCAGGACGTTGGTCTGGGGG - Intergenic
937034469 2:118769453-118769475 TGTCAAGAAGGTTCTTCCTGAGG - Intergenic
937088386 2:119187273-119187295 TCTCCAGAAAATGGGTCATGGGG + Intergenic
937264386 2:120606884-120606906 TCTGCAGTGGGTGGGTCCTGGGG - Intergenic
939710377 2:145509695-145509717 TCTCCAGAACCTTTATCCTGTGG + Intergenic
941650344 2:168085593-168085615 TCTCCAAAAGTTTCATCCTGTGG - Intronic
944924435 2:204449786-204449808 TTCCCAGTAGGTGGGTCCTGAGG + Intergenic
946046539 2:216826161-216826183 TTCCCAGAAGGTTCCTCCTGCGG + Intergenic
946277768 2:218643854-218643876 TCTTCAGCAGGTGGGTGCTGAGG + Exonic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1168893488 20:1308803-1308825 GCTCCAGAAGGTGGTTCCTGGGG - Exonic
1171448641 20:25221558-25221580 TCACCAGAAGCTTCCTCCTGAGG + Intronic
1172762417 20:37332009-37332031 TATCCAGATGGTTGGATCTGGGG - Intergenic
1173537807 20:43829347-43829369 TCTCCAGAAGCTTGGTGATATGG - Intergenic
1175746216 20:61459200-61459222 TCTCCAGAAGGTTGGTCCTGTGG + Intronic
1178198085 21:30371698-30371720 TCTGCAGAAGGTTGATCCATAGG + Exonic
1178425980 21:32478707-32478729 TTTCCCGAAGGCTGGGCCTGAGG + Intronic
1179658157 21:42858393-42858415 TCTCCAGCTGGTTGCTCCTGTGG - Intronic
1179991852 21:44952478-44952500 TCACCAGAAGGTTGGCCCCAGGG + Intronic
1180243723 21:46531196-46531218 TCTCCTGATGGTGGGTGCTGAGG - Intronic
1181455222 22:23055669-23055691 CCTCCACAAGGGTGGTTCTGTGG - Intergenic
1181512447 22:23394937-23394959 TGTCCTGAGGGTTGGGCCTGTGG + Intergenic
1182774265 22:32819264-32819286 TTTCCAGACCTTTGGTCCTGGGG - Intronic
1183273038 22:36873828-36873850 TCTCCAGATATTTGCTCCTGAGG + Intronic
1183988772 22:41584238-41584260 TCTCCAGAACCTGGGGCCTGAGG - Intronic
1184448706 22:44570123-44570145 TCTCCAAAATGTTGGTGCTTGGG + Intergenic
952743844 3:36760053-36760075 CCTCCAGGAGGCTGGTCCTAGGG + Intergenic
954422295 3:50425088-50425110 TATCCACAAGCTTGGCCCTGTGG - Intronic
954603426 3:51890603-51890625 TCTGCAGAAAGTTGGGGCTGTGG + Intergenic
954742884 3:52768690-52768712 GCTCCACAAGGTTGGTTTTGAGG - Intronic
954753153 3:52824829-52824851 AATCCAGCAGGTAGGTCCTGTGG - Exonic
958168050 3:89902548-89902570 TCTCCAGAAGGACTGGCCTGAGG + Intergenic
961585983 3:127925253-127925275 TCTGAAGAAGGCTGCTCCTGTGG - Intronic
964634430 3:158844245-158844267 TCTCCATGAGGTTGGTGCAGGGG + Intergenic
965911213 3:173779327-173779349 TATTCAAAATGTTGGTCCTGAGG - Intronic
966863353 3:184242661-184242683 TCTCCAGGTTGTTGGTGCTGGGG - Exonic
968570855 4:1339884-1339906 TCTGCAGAAATTTGGTCCCGTGG - Exonic
968600032 4:1504358-1504380 GCTCCAGAAGGTGGGATCTGGGG + Intergenic
968732996 4:2280155-2280177 TCTCCAGAAGGATGGTCCACTGG + Intronic
969090713 4:4692063-4692085 TCGCCAGAAGGCTGGCCCAGGGG + Intergenic
975753711 4:77551295-77551317 TCTCTTGAAGGTTGGTCTAGTGG + Intronic
977482959 4:97601756-97601778 TCTCCAGAATGTTCTTCCTTAGG + Intronic
978301614 4:107275119-107275141 TTTCCAGAAGAATGATCCTGAGG + Intronic
978485168 4:109245286-109245308 TCTCCAGGAACTTGGTCCTCTGG + Intronic
979635332 4:122949969-122949991 TCCCCAGTAGGTTGGTCCTGTGG + Intronic
980915465 4:139029431-139029453 TCTCCAGGAAGTTCGGCCTGCGG - Intronic
985772983 5:1824708-1824730 TCTGCAGAAGCGTGGTCCTGCGG + Intergenic
991577710 5:68122323-68122345 TCTCCAGAAGGGTGGCCCTATGG + Intergenic
998370612 5:141658566-141658588 CACCCTGAAGGTTGGTCCTGAGG - Exonic
998389910 5:141780623-141780645 GCTCCAGCAGGTGGGTGCTGCGG + Intergenic
999311549 5:150554941-150554963 TCTCCAGAAAGTATTTCCTGGGG - Exonic
999412937 5:151368087-151368109 TCTCCAGGAGGTTGGTGATCAGG - Intergenic
1001495531 5:172185614-172185636 TCTGGAGAAAGTGGGTCCTGTGG + Intronic
1006299125 6:33184524-33184546 TGTCCAGAAAGTGGGTCCAGTGG + Intronic
1007026410 6:38580080-38580102 TCTCTTGAAGGTTGGTTTTGGGG - Intronic
1007787194 6:44287448-44287470 ACTGCAGAAGCTGGGTCCTGGGG - Intronic
1013570472 6:111419201-111419223 TCTTCAGGAGGTTGTTCTTGAGG - Intronic
1019025913 6:168962834-168962856 TCTTCTGAAGCTTGGTCCTCGGG + Intergenic
1019493432 7:1325490-1325512 TCTCCAGCAGGCCGGGCCTGGGG + Intergenic
1022923054 7:35036018-35036040 GCTCAAGAAGGTTGTTCCTAGGG - Intronic
1023495904 7:40796841-40796863 GCTCCAGAAATTTGGCCCTGAGG + Intronic
1023862012 7:44222330-44222352 TCACCAGAAGGCAGGCCCTGTGG + Intronic
1024840539 7:53581540-53581562 TATCCATTAGGATGGTCCTGTGG - Intergenic
1027004835 7:74684383-74684405 TCTCTAGGCGTTTGGTCCTGTGG + Intronic
1030005396 7:105113079-105113101 GTTCCAGAAGGCTGGTGCTGGGG - Exonic
1033159224 7:138981648-138981670 CCTCCGGAAGGCGGGTCCTGGGG - Intergenic
1033485071 7:141780619-141780641 TCTCCAGAATGTTGTTTCTGTGG + Exonic
1034436862 7:151066628-151066650 TCTCCTGAAGGTTGTAGCTGCGG - Exonic
1038499064 8:28028452-28028474 TTTCAAGAAGGCTGGTTCTGAGG + Intronic
1039887738 8:41664820-41664842 TCTCCACCAGGGTGGTCCGGCGG - Intronic
1040638346 8:49302070-49302092 TTGGCAGAAGGCTGGTCCTGAGG - Intergenic
1043956001 8:86360460-86360482 TGTCCAGACTGTTAGTCCTGGGG + Intronic
1056148933 9:83765234-83765256 TCTACATGATGTTGGTCCTGTGG + Intronic
1058686169 9:107481927-107481949 TCTCAAGTAGGATGGTCATGAGG - Intergenic
1059567055 9:115393464-115393486 TTTCCAGAAGGTCAGTCCTCAGG + Intronic
1062104204 9:134743940-134743962 TCACCCCAAGGCTGGTCCTGGGG - Intronic
1062355182 9:136158519-136158541 TCTCCAGCAGCATTGTCCTGTGG + Intergenic
1186101713 X:6164503-6164525 TCTGCAGATGGTTGATCATGTGG + Intronic
1191063066 X:56319225-56319247 TATCCAGGAGGGTGGGCCTGGGG - Intergenic
1193575775 X:83193932-83193954 GCTACACAAGTTTGGTCCTGTGG + Intergenic
1197481858 X:126995986-126996008 TGTCCAGAAATTTGGTCCAGGGG - Intergenic
1199583010 X:149379247-149379269 TCTCCAGAAGGTAGGCTTTGCGG + Intergenic