ID: 1175746254

View in Genome Browser
Species Human (GRCh38)
Location 20:61459394-61459416
Sequence GTGTGATCAGGTGGGAACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175746254_1175746260 15 Left 1175746254 20:61459394-61459416 CCGGGGTTCCCACCTGATCACAC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1175746260 20:61459432-61459454 GTCACGTATTGGTATTGTGTAGG No data
1175746254_1175746264 25 Left 1175746254 20:61459394-61459416 CCGGGGTTCCCACCTGATCACAC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1175746264 20:61459442-61459464 GGTATTGTGTAGGGAGCCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 147
1175746254_1175746263 24 Left 1175746254 20:61459394-61459416 CCGGGGTTCCCACCTGATCACAC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1175746263 20:61459441-61459463 TGGTATTGTGTAGGGAGCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 117
1175746254_1175746259 4 Left 1175746254 20:61459394-61459416 CCGGGGTTCCCACCTGATCACAC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1175746259 20:61459421-61459443 GTTCTTCACTGGTCACGTATTGG 0: 1
1: 0
2: 0
3: 3
4: 40
1175746254_1175746261 16 Left 1175746254 20:61459394-61459416 CCGGGGTTCCCACCTGATCACAC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1175746261 20:61459433-61459455 TCACGTATTGGTATTGTGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 54
1175746254_1175746262 23 Left 1175746254 20:61459394-61459416 CCGGGGTTCCCACCTGATCACAC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1175746262 20:61459440-61459462 TTGGTATTGTGTAGGGAGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 97
1175746254_1175746258 -7 Left 1175746254 20:61459394-61459416 CCGGGGTTCCCACCTGATCACAC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1175746258 20:61459410-61459432 ATCACACTGCAGTTCTTCACTGG 0: 1
1: 0
2: 1
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175746254 Original CRISPR GTGTGATCAGGTGGGAACCC CGG (reversed) Intronic
900789848 1:4672685-4672707 GAGTGAGAAGGTGGGATCCCAGG + Intronic
900921145 1:5671374-5671396 CTGTGTTCAGAAGGGAACCCAGG + Intergenic
900990201 1:6095182-6095204 GTGTGAGCAGTGGGGAGCCCGGG + Intronic
902330868 1:15730713-15730735 TGGTGCTCAGGTGGGAGCCCTGG + Exonic
903174815 1:21574659-21574681 CTGTGCTCGAGTGGGAACCCCGG - Intronic
903437478 1:23362076-23362098 GTGTGATGAGGTTGGAGCTCTGG + Exonic
903736011 1:25530277-25530299 CCGTGATCAGGTTGGATCCCGGG + Intergenic
904533652 1:31184994-31185016 TTGTGATCAACTGGGACCCCTGG + Intronic
905304002 1:37005193-37005215 CTGGCATCAGGTGGGGACCCAGG - Intronic
906706869 1:47901390-47901412 GTCTGCTCAGGTGGGACCACAGG + Intronic
907372004 1:54009828-54009850 GGGAGCTCAGGTGTGAACCCAGG - Intronic
907593145 1:55694831-55694853 CTGTGATCAGGTCTGACCCCTGG - Intergenic
907813803 1:57898638-57898660 GTGTGCTGGGGTTGGAACCCAGG - Intronic
907947257 1:59147071-59147093 GTGTGAGCACGTAGGAGCCCTGG + Intergenic
910433500 1:87181723-87181745 CTGTGATCATCTGGGAACTCTGG - Intergenic
911097971 1:94070775-94070797 GTGGTACCAGGTGGGAAGCCTGG + Intronic
913700393 1:121368626-121368648 GTTTTATCAGGTGGGAAGCTGGG + Intronic
914040944 1:144049084-144049106 GTTTTATCAGGTGGGAAGCTGGG + Intergenic
914137145 1:144911392-144911414 GTTTTATCAGGTGGGAAGCTGGG - Intronic
915317466 1:155037207-155037229 CTGTGCTCTGGTGGGAGCCCTGG + Intronic
916522856 1:165580787-165580809 GGGTGATCAGGTAGGAACCATGG + Intergenic
919051106 1:192512554-192512576 GTGGGATCAGCTGGAAATCCAGG - Intergenic
919901220 1:202045764-202045786 CAATTATCAGGTGGGAACCCAGG - Intergenic
920180079 1:204127150-204127172 GTGGGATCAGGTTGGGACCAGGG - Exonic
920487809 1:206387353-206387375 GTTTTATCAGGTGGGAAGCTGGG + Intronic
922189965 1:223309680-223309702 GTGTGAACAGGTATGAATCCTGG + Intronic
1064997147 10:21306169-21306191 GTGTGATCAGCTATGACCCCTGG - Intergenic
1069601321 10:69709988-69710010 GCGGGATAAGGTGGGAACCAAGG + Intergenic
1072803662 10:98410600-98410622 ATGAGAGCAGGTGGGAACCAGGG - Intronic
1076409148 10:130233581-130233603 CTGTGCTCAGGTGGGGACCTTGG + Intergenic
1076466076 10:130682483-130682505 GTGGAAGCAGGTAGGAACCCAGG - Intergenic
1078068588 11:8093971-8093993 CTGTGTTCAGGTGGGAGCTCTGG + Intronic
1079839868 11:25383039-25383061 GTGTGGCCAGGTTTGAACCCTGG + Intergenic
1083227823 11:61295535-61295557 TTGTGACGAGGTGGGAACCGTGG + Intergenic
1083998415 11:66283500-66283522 GTGTGACCAGGTGGGCATCTGGG + Intronic
1084501106 11:69536022-69536044 GTCTGGGCAGGCGGGAACCCTGG - Intergenic
1092161087 12:6315926-6315948 GGGTGCTCAGGAGGGGACCCTGG + Intronic
1102571009 12:113827019-113827041 GTGTCATTCGGTGGGAACTCGGG - Intronic
1102679591 12:114682576-114682598 GTCTGTTCGGGAGGGAACCCAGG + Intronic
1104809763 12:131613070-131613092 GTGTCAGGAGGTGGGAACTCTGG - Intergenic
1105626840 13:22121010-22121032 GAGTGATCAGCTGGGAAACATGG + Intergenic
1106368371 13:29106314-29106336 CTGTGATCACCTGGCAACCCAGG + Intronic
1107518294 13:41153525-41153547 GGGTGATCACATGGGCACCCGGG - Intergenic
1116246337 14:42418283-42418305 CTGTGGTCAGGTTGGAAACCAGG + Intergenic
1117508383 14:56424762-56424784 GTGTGATGAGGTGGGAAAGAAGG - Intergenic
1119031238 14:71194302-71194324 TTGGGAACAGGTGGGAATCCAGG + Intergenic
1119598144 14:75955561-75955583 GAGTTATCAGGGGAGAACCCAGG + Intronic
1121351097 14:93173606-93173628 GTGAGATCAGGAGGGAATCGGGG + Intergenic
1122036029 14:98949995-98950017 GTGTGCTCACTGGGGAACCCGGG + Intergenic
1122760418 14:104020789-104020811 CTGTGATGATGTGGGGACCCAGG + Intronic
1122869260 14:104628173-104628195 GTGTGACCAGCTGGAATCCCTGG - Intergenic
1122910402 14:104825112-104825134 GTTTGCTCAGGTAGCAACCCTGG - Intergenic
1125181008 15:36880742-36880764 GAGGGAACAGGTGGGAACCGCGG + Intergenic
1125790241 15:42360037-42360059 GTCTCATCCGGTGGGAACTCAGG - Exonic
1127284046 15:57517186-57517208 GTGAGGTCAGGCGGGAACACAGG + Intronic
1129452909 15:75660791-75660813 CTCTGATGAGGTGGGGACCCTGG - Exonic
1129674397 15:77624716-77624738 GTGTGATCTCGGGGGAATCCTGG + Intronic
1130191394 15:81739590-81739612 GTTTCATCAGGTGGCAACCCAGG + Intergenic
1130413143 15:83664064-83664086 GGGTTATCAGGTGGAGACCCAGG + Intronic
1130515168 15:84620891-84620913 GTGTGATGAGGTGGGATTTCCGG - Exonic
1131308215 15:91264591-91264613 GCTTGATGATGTGGGAACCCAGG + Intronic
1131988222 15:98066255-98066277 GTTTGCTCATGTAGGAACCCAGG - Intergenic
1133023055 16:2975306-2975328 ATGTGTTCAGGTGGGGACCGGGG - Exonic
1133774269 16:8885314-8885336 GTGTGCCCAGGTGGCACCCCTGG - Intergenic
1137434992 16:48447672-48447694 GTGAGGACAGGTGGGACCCCAGG + Intronic
1139782586 16:69364235-69364257 GTGGGATCAGGAGGGAAGGCAGG - Intronic
1141307876 16:82883455-82883477 GTATGATCAGGCTGGAACACAGG + Intronic
1143210310 17:5181672-5181694 GTGTGACAAGGTGGGACCTCTGG + Exonic
1144202739 17:12956007-12956029 GGGTGATCAGGTGGGACTGCAGG + Intronic
1147916244 17:43888698-43888720 GTGTGATCAAGGGGGAAGCCAGG + Intronic
1148768082 17:50051101-50051123 CTGTGCTCAGGTGGGAAATCTGG - Intergenic
1151026287 17:70681016-70681038 GTGTCATTAGGTGGAAACCGTGG + Intergenic
1152865873 17:82722649-82722671 GTGTGAGCTGGTGGAGACCCAGG + Intronic
1152924780 17:83081754-83081776 GTGTGATCTGGAGGGGACACGGG + Intronic
1153934500 18:9909153-9909175 GAGTGTTCTGGTGGGAACTCAGG - Intergenic
1155253964 18:23978566-23978588 GTGTGTTCAGGTGGCATCCAGGG - Intergenic
1155726987 18:29099096-29099118 ATGAGATCTGGTGGGAACACAGG - Intergenic
1157273501 18:46294260-46294282 GCATGAACAGGTGGGAAGCCTGG + Intergenic
1158334587 18:56402041-56402063 GTGGGAAAACGTGGGAACCCTGG + Intergenic
1158483318 18:57842112-57842134 GTGGGGTAAGGTGGGAAGCCAGG + Intergenic
1158597050 18:58825795-58825817 GTGTGTGCACGTGGGAATCCAGG + Intergenic
1159102616 18:63972145-63972167 GTGTGATCAGTAGGGAAACACGG - Intronic
1160150529 18:76393425-76393447 AGGTGGTCAGGTGGGAAGCCGGG + Intronic
1160150789 18:76394071-76394093 AGGTGGTCAGGTGGGAAGCCGGG + Intronic
1160150939 18:76394449-76394471 AGGTGGTCAGGTGGGAAGCCGGG + Intronic
1161126766 19:2562215-2562237 GGCTGAGCAGGTGGGGACCCCGG - Intronic
1161166468 19:2790545-2790567 GTATGACCAGGTTGGCACCCAGG + Exonic
1161264506 19:3358286-3358308 GTGAGAGCAGGTGGCACCCCGGG - Intergenic
1161963738 19:7536288-7536310 GTGTGGTCAGGGCGGACCCCAGG - Intronic
1163477777 19:17537002-17537024 GTTTGGTCAGGTTGGAACCCGGG + Intronic
1165917433 19:39269353-39269375 GTGTGGTCAGGTGGGAGCGGAGG - Intronic
1166617815 19:44266952-44266974 GGGTGTTCAGGTGAGAACCATGG + Exonic
1167490865 19:49792170-49792192 GTGGGCTGAGGTGGGAGCCCTGG - Intronic
1168667187 19:58212984-58213006 GTCTGATGAGGTGGGAGCTCTGG - Exonic
925809344 2:7683615-7683637 GTGTAATCAGGTGACAACTCTGG + Intergenic
926027345 2:9556248-9556270 GTGTGCTCAGGTGGGAGGGCGGG + Intergenic
926238916 2:11069970-11069992 GTGTCCTCAGGTAGGAAGCCAGG - Intergenic
926546966 2:14254253-14254275 GTGTTATCAGTTGGAAACCTGGG - Intergenic
927331141 2:21865921-21865943 TTGAGATCAGGTGGGATCCTGGG + Intergenic
927617016 2:24608750-24608772 ATGTGATACTGTGGGAACCCTGG - Intronic
928035200 2:27816181-27816203 GTGTGATCAGTTGAATACCCAGG - Intronic
931258786 2:60598766-60598788 CTGTGCTCAGAAGGGAACCCCGG + Intergenic
935492062 2:103733662-103733684 GTGTGACCAGGTAGGGACCCTGG + Intergenic
936040469 2:109145747-109145769 GTGTGAAAGGGCGGGAACCCAGG + Intronic
937286955 2:120759990-120760012 GTGTCCTCAGGTGAGAGCCCTGG + Intronic
937361664 2:121233962-121233984 GTGTGGGCATGTGGGAGCCCAGG + Intronic
937685097 2:124687103-124687125 GTGTGATTAGTTGGGTACCTGGG + Intronic
938769675 2:134490405-134490427 TTGTGTTCAGGAGGGACCCCTGG - Intronic
947606223 2:231487560-231487582 GTGTGGTCATCTGGGGACCCAGG - Intergenic
947625609 2:231616370-231616392 CTGTGAGCAGCAGGGAACCCAGG - Intergenic
1169016642 20:2298103-2298125 GTGTGAGCAGGTGTGACCCAGGG + Intronic
1172427625 20:34865801-34865823 GTGTTATTAGCTGTGAACCCAGG + Intronic
1175746254 20:61459394-61459416 GTGTGATCAGGTGGGAACCCCGG - Intronic
1179295127 21:40054790-40054812 GTGTGGCCAGGTGGGGAACCTGG + Intronic
1181164086 22:20974185-20974207 GTGCGATGGGGTGGGAACCTGGG + Intronic
1182619643 22:31611831-31611853 GAGACAACAGGTGGGAACCCAGG + Exonic
1182821552 22:33221038-33221060 GTGTGCTGAGGGGGAAACCCAGG - Intronic
1183585324 22:38749999-38750021 GTGTGGGCAGGTGGGATCCAAGG - Intronic
1184189806 22:42887125-42887147 GTGGGATCAGGTGAGGAGCCTGG - Intronic
1184717637 22:46290961-46290983 GTGAGAGCAGGTGGCAGCCCGGG + Intronic
1185250695 22:49800107-49800129 AGGTGGGCAGGTGGGAACCCGGG - Intronic
949341331 3:3034052-3034074 GTGTGCTCACGTGGGAAGCAGGG + Intronic
953183755 3:40619815-40619837 GTGTGATTTGGTGGGGATCCAGG + Intergenic
956141773 3:66153604-66153626 GTGCTTTCAGGTGTGAACCCAGG + Intronic
956672122 3:71700883-71700905 GTGTTAGCAGGTGGGGCCCCTGG + Intronic
962993877 3:140605635-140605657 GTGTGACCAGGCAGGGACCCTGG - Intergenic
963049604 3:141129661-141129683 GTGTGATCAAGGGGGCAGCCTGG - Intronic
963483227 3:145903750-145903772 CTGGGAGCAGGTGGGAACCCAGG + Intergenic
963723921 3:148897634-148897656 GTGTGATCAAGTGGCAACAGTGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969566645 4:7982629-7982651 GTGTGGTCGGGTGGGAAGCTGGG + Intronic
986219917 5:5758884-5758906 GTGTGATCACCTGGGATCACAGG + Intergenic
986909097 5:12532450-12532472 GTGTGGCCAGGCAGGAACCCTGG - Intergenic
988163500 5:27551931-27551953 GTGTGGTCAGGCAGGAACCCTGG + Intergenic
991304062 5:65158069-65158091 GTCTGGTCTGGAGGGAACCCTGG - Intronic
992716422 5:79514697-79514719 GTGAGAGCAGGTGGGCACACAGG - Intergenic
996900868 5:128539260-128539282 GTGTGCTCTGGTGTGAAACCTGG + Intronic
998150026 5:139751483-139751505 GTGTGACCAACTGGGAACCCTGG + Intergenic
998932834 5:147200072-147200094 GTGGGATTAGGAGGGAACCAGGG + Intergenic
1001164237 5:169349072-169349094 GTGTAATCAGGTGCCAAACCAGG - Intergenic
1001519060 5:172377864-172377886 GTGTGAACATGTGGGTACACAGG - Intronic
1002102901 5:176866129-176866151 GTGTGAGCAGGTGCCAGCCCTGG - Intronic
1002552158 5:180002570-180002592 GTGAGGACTGGTGGGAACCCTGG + Intronic
1004866554 6:19858525-19858547 GTGTGGGCAGATGGGGACCCTGG + Intergenic
1004966448 6:20857264-20857286 GTGTGAACAAGAGGGAAACCTGG + Intronic
1005008944 6:21317534-21317556 ATGTGATCATCTGGGTACCCAGG - Intergenic
1006948517 6:37801775-37801797 GTGCTATCAGCTGGGAACCCTGG - Intergenic
1007938462 6:45754729-45754751 GAGTGGTGAGGTGGGGACCCTGG + Intergenic
1008097243 6:47351479-47351501 ATGTGGTCAGTGGGGAACCCAGG - Intergenic
1009311438 6:62157536-62157558 GTGTCTTCAGATGGGAACACAGG + Intronic
1010295082 6:74185969-74185991 GTGTGATATGGCTGGAACCCAGG + Intergenic
1010506950 6:76672347-76672369 GGGTGATAAGGTGGAAACCTTGG - Intergenic
1013615013 6:111834755-111834777 TTGTGAACAGGAGGCAACCCTGG - Intronic
1015923969 6:138291736-138291758 GTGTGAATACGTGGGCACCCTGG + Exonic
1019373345 7:675310-675332 GTGAGTGCAGGTGGGGACCCTGG - Intronic
1021418830 7:20421960-20421982 CAGTGATCAGGTGGGCACCAAGG + Intergenic
1022019240 7:26382393-26382415 GTGGGAGCAGGTGGGCACACTGG + Intergenic
1022920643 7:35010682-35010704 GTGTTTTCATGTGGGAACCAAGG - Intronic
1023254486 7:38299615-38299637 CTGGGATCAGGTGGGAACGAAGG + Intergenic
1024760947 7:52595310-52595332 GAGTGATCATGTGGCCACCCAGG + Intergenic
1024991789 7:55240493-55240515 GTGTGATCCAGTGAGAACACTGG + Intronic
1027262978 7:76478236-76478258 TTGTGATAAGATGGGGACCCTGG + Intronic
1027314362 7:76976337-76976359 TTGTGATAAGATGGGGACCCTGG + Intergenic
1027695802 7:81408763-81408785 GTTTGCTTAGGTAGGAACCCAGG - Intergenic
1033648154 7:143320918-143320940 GAGGGATCAGGTGGGACTCCAGG + Intronic
1035353020 7:158259599-158259621 GTGGGAGCAGGTGGGATCCCCGG - Intronic
1036683096 8:10890284-10890306 GTGAGGGCAGGTGGGAGCCCAGG - Intergenic
1044002595 8:86902492-86902514 GTGTCATAAGGTGGGAACTGTGG - Intronic
1047245299 8:123137715-123137737 ATGGGATCTGGTGGGAACCATGG - Intronic
1047499402 8:125430228-125430250 GTGTAAACAGTTGGGAAGCCGGG - Intergenic
1048970201 8:139641190-139641212 GTGTGCTGTGGTGAGAACCCTGG + Intronic
1049032971 8:140050752-140050774 GTGTTTCCAGGTGGGACCCCAGG - Intronic
1051747409 9:20308159-20308181 TTGTGATCAGGTGGTCATCCTGG + Intergenic
1054819109 9:69504548-69504570 GGGTGATCAGGTGGAAAGCCAGG + Intronic
1062600704 9:137317520-137317542 GGGCCATCTGGTGGGAACCCAGG + Intronic
1186510110 X:10124396-10124418 GTGTGTGCAGGTGGGAGCCACGG - Intronic
1186633643 X:11378408-11378430 GTGTGATCAGGAGAGAAACATGG + Intronic
1187608272 X:20910528-20910550 GTGGGCTCAGGTAGGAATCCAGG - Intergenic
1189194927 X:39144858-39144880 GTGGGATGAGGTGGAAACCCTGG + Intergenic
1190335088 X:49257420-49257442 GTGTTACCAGGTGGGAGGCCAGG + Exonic
1201898105 Y:19015753-19015775 CTGTGTTCAGGTTGGAACACTGG - Intergenic