ID: 1175746871

View in Genome Browser
Species Human (GRCh38)
Location 20:61463180-61463202
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175746871_1175746876 16 Left 1175746871 20:61463180-61463202 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 1175746876 20:61463219-61463241 TTTATAAATTGCCCAGTTTCTGG 0: 18
1: 922
2: 9768
3: 16211
4: 14061

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175746871 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr