ID: 1175748510

View in Genome Browser
Species Human (GRCh38)
Location 20:61478304-61478326
Sequence CACCCATTGCTGCTAGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175748510_1175748515 17 Left 1175748510 20:61478304-61478326 CCCGTCTCTAGCAGCAATGGGTG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1175748515 20:61478344-61478366 CTCCGAAGTAGCACCTGGCTAGG 0: 1
1: 0
2: 2
3: 10
4: 72
1175748510_1175748518 19 Left 1175748510 20:61478304-61478326 CCCGTCTCTAGCAGCAATGGGTG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1175748518 20:61478346-61478368 CCGAAGTAGCACCTGGCTAGGGG 0: 1
1: 0
2: 1
3: 2
4: 46
1175748510_1175748514 12 Left 1175748510 20:61478304-61478326 CCCGTCTCTAGCAGCAATGGGTG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1175748514 20:61478339-61478361 ACTGGCTCCGAAGTAGCACCTGG 0: 1
1: 0
2: 0
3: 5
4: 57
1175748510_1175748516 18 Left 1175748510 20:61478304-61478326 CCCGTCTCTAGCAGCAATGGGTG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1175748516 20:61478345-61478367 TCCGAAGTAGCACCTGGCTAGGG 0: 1
1: 0
2: 2
3: 5
4: 49
1175748510_1175748512 -6 Left 1175748510 20:61478304-61478326 CCCGTCTCTAGCAGCAATGGGTG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1175748512 20:61478321-61478343 TGGGTGTGTATCCTCATAACTGG 0: 1
1: 0
2: 0
3: 18
4: 102
1175748510_1175748519 26 Left 1175748510 20:61478304-61478326 CCCGTCTCTAGCAGCAATGGGTG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1175748519 20:61478353-61478375 AGCACCTGGCTAGGGGACAGTGG 0: 1
1: 1
2: 0
3: 20
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175748510 Original CRISPR CACCCATTGCTGCTAGAGAC GGG (reversed) Intronic
904501169 1:30913593-30913615 GACACATGGCTGCTAGACACAGG + Intergenic
904558750 1:31382819-31382841 CACCCACTGCAACTAGAGAGAGG + Intergenic
910590523 1:88924744-88924766 CACCCATTGCTGCTCCCGATTGG + Intergenic
911085648 1:93975164-93975186 CACCCATGACACCTAGAGACAGG - Intergenic
912463387 1:109852498-109852520 CACCCATTGCTGCTCCTGATCGG - Intergenic
923016000 1:230127108-230127130 CTCCCATTGCTGCCTGAGGCAGG + Intronic
923034990 1:230279482-230279504 CACCCAATGGTGCAGGAGACAGG - Exonic
924501743 1:244644676-244644698 GACCCAGTGCTGGTAGACACAGG + Intergenic
1065231752 10:23605703-23605725 CACCCTTTGCTGGTGGAGATGGG - Intergenic
1066101265 10:32120828-32120850 ATCCCATTGCTCCTACAGACGGG + Intergenic
1069412037 10:68163663-68163685 TCCCCATTGTTGCTATAGACAGG - Intronic
1070851233 10:79562880-79562902 CACCCAGTGCAGCTGGAGAAAGG - Intergenic
1071008468 10:80910752-80910774 CATTCATAGCTTCTAGAGACTGG - Intergenic
1075581276 10:123620314-123620336 CAGCCATTTTTGCTAGAGATGGG + Intergenic
1083971309 11:66077553-66077575 CACCCATTTTTGTTTGAGACAGG - Intronic
1084443464 11:69189697-69189719 CAAATATTGGTGCTAGAGACAGG - Intergenic
1086238060 11:84656128-84656150 AACCCAGTCCTGCTAGAGAGAGG + Intronic
1090023580 11:123148974-123148996 CACTCATTGCTTCTCAAGACAGG + Intronic
1090384934 11:126352372-126352394 CACCCACTCCTGCCAGAGAGGGG + Intergenic
1091061481 11:132467105-132467127 CACCCATTGTTGCTAGTGGCTGG + Intronic
1092469907 12:8768229-8768251 CACCCATTGCTGCTCCTGATCGG - Intronic
1094240555 12:28218276-28218298 CTCCCATTCCTGCTAGAGGAAGG + Intronic
1094261626 12:28507358-28507380 CACCAAATGCTGCTACAGATGGG - Intronic
1096262965 12:50104363-50104385 CACCCTTTGCTACTAGAGAAGGG - Intronic
1096351217 12:50902763-50902785 CACCCATTGCTGCTCCGGATCGG - Intergenic
1096840017 12:54374409-54374431 CACCTAGTCCTGGTAGAGACAGG + Intronic
1097376728 12:58852130-58852152 CACCCATTGCTGCTCCGGATTGG - Intergenic
1097819354 12:64112538-64112560 CTCCCATTGCTGCAAATGACAGG + Intronic
1101245005 12:102876811-102876833 CCCCCATGGCTGCAAGACACAGG + Intronic
1103872323 12:124100744-124100766 CACCCATTGCTGCTCCCGATGGG - Intronic
1104418443 12:128615112-128615134 AACCCCTTGCTGCTAGATGCAGG - Intronic
1104781695 12:131425576-131425598 CACCCAGTGAGGGTAGAGACAGG + Intergenic
1110380010 13:74839535-74839557 CAAACATTACTGCCAGAGACTGG + Intergenic
1111077529 13:83257355-83257377 CCCCCATTGCTGCTTTTGACTGG - Intergenic
1111090500 13:83439682-83439704 CACCCATTGCTGCTCCTGATTGG + Intergenic
1117746689 14:58876793-58876815 CTCCCATAGCTGCAAGAAACTGG - Intergenic
1119990966 14:79196915-79196937 CAGCTATTGCAGCTTGAGACTGG + Intronic
1124421217 15:29524657-29524679 CGCCCATTGCTGCTTCCGACTGG - Intronic
1124995550 15:34720020-34720042 CACCTAGTGCTGCTGGAGAAGGG - Intergenic
1125507592 15:40276011-40276033 CACCCCTTCCTGCTGCAGACAGG + Exonic
1128889287 15:71316582-71316604 GGCCCATTGCTGCTAGGGAGGGG + Intronic
1135915228 16:26599596-26599618 TACCCATTGTTCCTATAGACAGG - Intergenic
1136886476 16:33933276-33933298 CACCCATTGCTCTGAGAGCCTGG - Intergenic
1137826776 16:51504525-51504547 CACCCATTGCAGTAAGAGAAAGG - Intergenic
1139072286 16:63397376-63397398 CCCCCTTGGCTGCTAGAGATGGG + Intergenic
1145264547 17:21373512-21373534 CACCCAAAGCTGGGAGAGACTGG + Intergenic
1147143574 17:38472757-38472779 CACCCATTGCTCTGAGAGCCTGG + Intronic
1147430299 17:40366769-40366791 CACCCATGGCTGATAGGGAGAGG - Intergenic
1148188716 17:45663824-45663846 TCCCCATTGCTCCTACAGACAGG - Intergenic
1149360484 17:55889807-55889829 AACCAAATACTGCTAGAGACTGG - Intergenic
1155227754 18:23744494-23744516 CATCAATTGCTGCTAGAGTTGGG + Intronic
1156479022 18:37424628-37424650 CAGGCATTGCTGCTAGCAACTGG - Intronic
1157782187 18:50449416-50449438 CACCCATTGCTGCTCCTGATCGG - Intergenic
1159831042 18:73278705-73278727 CCCCCATAGCTGCTAGAAAGTGG - Intergenic
1162142285 19:8592088-8592110 CACCCAGTGGTGCTACAAACGGG - Exonic
1165145912 19:33729998-33730020 TCCCCATTGCTCCTATAGACAGG - Intronic
1165192576 19:34077634-34077656 ACCCCATTGCTCCTATAGACAGG - Intergenic
925134228 2:1515209-1515231 CCCCCATGGCTGCTAGAGGTGGG - Intronic
925601432 2:5612117-5612139 CAACAATTGCTGCTAGAAAGTGG - Intergenic
927778744 2:25922684-25922706 AACCCATTGCTGTAAGAGTCTGG + Intergenic
927871994 2:26629586-26629608 CACCCCTTGCAGCAGGAGACAGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
936133777 2:109871290-109871312 CACCCTCTGCTGCTTGAGCCAGG - Intergenic
936210920 2:110500195-110500217 CACCCTCTGCTGCTTGAGCCAGG + Intergenic
936435447 2:112501298-112501320 CACCCTCTGCTGCTTGAGCCAGG + Exonic
938166276 2:129029718-129029740 CACACATTTCTGGTAGTGACAGG + Intergenic
939134070 2:138273423-138273445 CGCCCATTGCTGCTCCTGACTGG - Intergenic
940294777 2:152111082-152111104 CACCCTTGGCTGCAAGAGTCTGG + Intergenic
941867952 2:170354315-170354337 CACCCATCTCTGCTCTAGACAGG - Intronic
941923030 2:170870646-170870668 ACCCCATTGCAGCTAGAGCCTGG + Intergenic
941927840 2:170914134-170914156 TCCCCATTGGTCCTAGAGACAGG + Intergenic
946642393 2:221798416-221798438 AACCCATTGCTTCTTTAGACTGG + Intergenic
1170874804 20:20240471-20240493 CACCCACTGCTGCTAGACCCTGG + Intronic
1173111294 20:40192951-40192973 AACTCCTTACTGCTAGAGACAGG + Intergenic
1174543399 20:51307007-51307029 CACCCCTGCCTGCTTGAGACCGG - Intergenic
1175748510 20:61478304-61478326 CACCCATTGCTGCTAGAGACGGG - Intronic
1175909283 20:62396960-62396982 CACCCAGCGCTGCCTGAGACTGG + Intronic
1178265337 21:31137766-31137788 CAGCCATTGCTGCTTCAGCCTGG + Intronic
1180033179 21:45226111-45226133 CAGACAGTGCTGCCAGAGACAGG - Exonic
1184032532 22:41903398-41903420 CACACTTTGCTGCCACAGACAGG + Intronic
1185380722 22:50506479-50506501 GACTCCCTGCTGCTAGAGACTGG - Exonic
950582315 3:13870679-13870701 CTCCAAGTGCTGCTAGAGAAAGG + Intronic
961107056 3:124250983-124251005 GAACCATTGCTCCTAGAGTCTGG - Intronic
961819682 3:129569654-129569676 TACCCATTGGTGCTGGAGCCAGG + Intronic
962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG + Intergenic
964848550 3:161069549-161069571 CACCCAGTGCTGCAGGAGACAGG + Exonic
964910836 3:161777640-161777662 GACACATTGATGCAAGAGACGGG - Intergenic
967292548 3:187935648-187935670 CACTCATTGCTGCTAGAGGTGGG - Intergenic
977251339 4:94692722-94692744 CACCCATTGCTGCTCCAATCGGG + Intergenic
981961246 4:150541802-150541824 CACCTATTGCTGCCTGAGGCAGG - Intronic
982754064 4:159197884-159197906 CATCCCTTCCTCCTAGAGACAGG - Intronic
985579802 5:690610-690632 CACCCATCGCAGATGGAGACTGG - Intronic
985594648 5:782669-782691 CACCCATCGCAGATGGAGACTGG - Intergenic
986204424 5:5610436-5610458 CACGCATTCCTGCCAGAGGCAGG + Intergenic
989031729 5:37126376-37126398 GGCCCATTGCTGCAAGACACAGG + Intronic
990342783 5:54840369-54840391 CTCCCATTCCTGCTGCAGACTGG + Intergenic
991518759 5:67470220-67470242 CATCCATTGCTGATACATACTGG - Intergenic
999458945 5:151741118-151741140 GACCCAGGGCTGCTGGAGACTGG - Intergenic
1003172940 6:3734211-3734233 TACACATCGCTGATAGAGACGGG + Intronic
1003915093 6:10779215-10779237 CACCCCCTGCTCCTAGAGCCGGG - Intronic
1004433020 6:15563523-15563545 TACCCATTGTTCCTATAGACAGG + Intronic
1006346971 6:33490550-33490572 CACTCATTGCTGTTAGACAATGG - Intergenic
1008065172 6:47040125-47040147 CACCCATAGCTTGTAGAGAAGGG - Intronic
1011651086 6:89506786-89506808 CACACCTTGCAGCTAGAGATCGG - Intronic
1012029873 6:94045477-94045499 CTCTCATTGCTGCTAGAGTATGG + Intergenic
1012398293 6:98824576-98824598 CACCCAGTCCTGCGAGAGCCAGG - Intergenic
1017642480 6:156507771-156507793 CACCCACTGCTCGTCGAGACTGG - Intergenic
1022301317 7:29105292-29105314 CACCCATGGCTGCCACAGTCTGG - Intronic
1023438986 7:40167724-40167746 CACCCATTGCCGCTCTCGACTGG - Intronic
1026428060 7:70316371-70316393 CAGCCATTGCTGATGGAGCCAGG + Intronic
1027360155 7:77400091-77400113 CAGCCTTTGCTGGTAGAGATGGG - Intronic
1027868349 7:83674978-83675000 CACCCATTGCTGCTCCAGATTGG - Intergenic
1030208378 7:106972681-106972703 CGCCCATTGCTGCTCCAGATCGG - Intergenic
1031472014 7:122177287-122177309 CACCCATTGCTGCTCCTGATCGG + Intergenic
1032794819 7:135269029-135269051 CACCCATTGCTGCTTGGCATTGG - Intergenic
1037648136 8:20812446-20812468 CACCCAATGCCTCTAGAAACTGG + Intergenic
1039755382 8:40517042-40517064 CACCCATAGCTGCTTGTGATAGG - Intergenic
1039891271 8:41687343-41687365 CCCCCATTGTTCCTAAAGACAGG + Intronic
1039941195 8:42092721-42092743 ACCACATTGCTGCTAGAGAGAGG - Intergenic
1048100242 8:131343134-131343156 CACCCATTGCTGCTCCTGATCGG - Intergenic
1050080155 9:1907377-1907399 CAGCCATTGCTCCTAGAATCTGG + Intergenic
1051122505 9:13766557-13766579 CACCCATCCCTCCCAGAGACTGG + Intergenic
1052970918 9:34376790-34376812 CACCCATTGCAGTTACAGCCCGG + Exonic
1059405536 9:114096637-114096659 CACCCATCTCTGCTAGAGCAGGG - Intronic
1061359435 9:130131710-130131732 CAGCCATGGCTGCAGGAGACTGG - Intronic
1062542458 9:137047681-137047703 CAGTCAGTGCTGGTAGAGACTGG - Intergenic
1186058573 X:5678928-5678950 CACCCATCTCTTCTAGAGACTGG - Intergenic
1186628025 X:11316023-11316045 GACCCATTGGTGATAGAGAGTGG - Intronic
1188067176 X:25677263-25677285 CACCCATTGCTGGTCAAGAGAGG - Intergenic
1190303230 X:49068077-49068099 CCCCCATACCTGCCAGAGACAGG - Exonic
1190545816 X:51525176-51525198 CACCCAAAGCTACTAGAGTCAGG - Intergenic
1193500791 X:82271727-82271749 AACCTTTTGCTTCTAGAGACAGG - Intergenic
1194103263 X:89734491-89734513 CACCCATTGCTGTTCCCGACTGG - Intergenic