ID: 1175748888

View in Genome Browser
Species Human (GRCh38)
Location 20:61481202-61481224
Sequence TTATTGCCACAGCTGGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175748881_1175748888 10 Left 1175748881 20:61481169-61481191 CCCAGGGAACACGTGGTAGGGTC 0: 1
1: 0
2: 2
3: 6
4: 113
Right 1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG 0: 1
1: 0
2: 1
3: 17
4: 178
1175748878_1175748888 12 Left 1175748878 20:61481167-61481189 CCCCCAGGGAACACGTGGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG 0: 1
1: 0
2: 1
3: 17
4: 178
1175748882_1175748888 9 Left 1175748882 20:61481170-61481192 CCAGGGAACACGTGGTAGGGTCT 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG 0: 1
1: 0
2: 1
3: 17
4: 178
1175748876_1175748888 13 Left 1175748876 20:61481166-61481188 CCCCCCAGGGAACACGTGGTAGG 0: 1
1: 0
2: 1
3: 2
4: 97
Right 1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG 0: 1
1: 0
2: 1
3: 17
4: 178
1175748880_1175748888 11 Left 1175748880 20:61481168-61481190 CCCCAGGGAACACGTGGTAGGGT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG 0: 1
1: 0
2: 1
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175748888 Original CRISPR TTATTGCCACAGCTGGGGCG TGG Intronic
902249578 1:15145348-15145370 TGATTGTCACAGCTGGGGAAAGG + Intergenic
904052367 1:27647384-27647406 TGAGTGAAACAGCTGGGGCGTGG + Intergenic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
905974992 1:42168308-42168330 TTCCTGCCACAGCTTGGGAGGGG - Intergenic
906199913 1:43953328-43953350 TTATGACCACAGCTGAGGCTGGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
911689713 1:100819374-100819396 TTGTTGCCACAGTTGGGAGGTGG - Intergenic
913383892 1:118239083-118239105 TTTTAGCCACAGCTGGGATGTGG - Intergenic
915892532 1:159784818-159784840 TTGTTGTCACAACTGGGGGGAGG - Intergenic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
917286569 1:173427323-173427345 TGATTGTCACAACTGGGGAGTGG + Intergenic
919126075 1:193395449-193395471 TTATTGCCACAGTTGTGGTTTGG - Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
924585225 1:245355857-245355879 TGAAGGCCACAGCTGGGGTGAGG + Intronic
1066415030 10:35213890-35213912 TGATTGACAGTGCTGGGGCGTGG + Intergenic
1067917247 10:50413641-50413663 TGATTGTCACAGCTGGGGTTGGG - Intronic
1070025412 10:72627033-72627055 CTATTTCCACAGCAGGGGTGAGG - Intergenic
1074973584 10:118563667-118563689 TGATTCAAACAGCTGGGGCGGGG - Intergenic
1075234523 10:120714763-120714785 TCATGGCCACAGCTTGGGGGTGG + Intergenic
1078347011 11:10559035-10559057 TGATTTCCCCAGCTGGGGCAGGG + Exonic
1078847129 11:15128524-15128546 TTACTGGCAGAGCTGGGGCTAGG + Intronic
1079207551 11:18429767-18429789 TTATTGTCACAGCAGGTGCAAGG + Exonic
1081757303 11:45553936-45553958 TCCTTGTCACAGCTGGGGCAAGG - Intergenic
1082866101 11:57901563-57901585 TGGTTGCCACAGCTGGTGGGAGG + Intergenic
1082895198 11:58182831-58182853 TGATTGCCTCAGCTGGGGAGAGG + Intergenic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1085215546 11:74827276-74827298 TTTTAGCCACGGCTGGGGTGTGG + Intronic
1086072649 11:82816151-82816173 TAGTTGTCACAGCTGGGGTGGGG - Intergenic
1088270628 11:108030598-108030620 TTGTTGCCCAAGCTGGAGCGCGG - Intronic
1090044320 11:123317434-123317456 CTAATGCCTCAGCTGGGGCTAGG + Intergenic
1091264457 11:134259713-134259735 TTCTTGCCAAAGCTGAGGCCAGG - Exonic
1094821707 12:34231321-34231343 ATATTGCCCCAGATTGGGCGTGG + Intergenic
1095560007 12:43552697-43552719 TGAGTGCCATAGGTGGGGCGAGG + Intergenic
1096193987 12:49637156-49637178 TTATTCCCTCAGCTTGGGGGTGG + Exonic
1097279803 12:57837897-57837919 TTAATGCCACCTGTGGGGCGAGG + Intronic
1099148416 12:79077077-79077099 TTAATGCAACAGCTGGGACAAGG - Intronic
1100546458 12:95607743-95607765 TTATTGTCACAGCTGTCTCGGGG - Intergenic
1106443233 13:29799220-29799242 TTATTGCCACAACTTTGCCGGGG - Intronic
1107464804 13:40639706-40639728 TTGTTGTCACAGCTTGGGTGGGG - Intronic
1110786237 13:79530410-79530432 AAATTGCCACAGCTGGAGCTGGG - Intronic
1111051210 13:82884675-82884697 TTTGTGCCACAGCTGGAGCTGGG + Intergenic
1113571463 13:111361203-111361225 ATATGGCCACAGCTGGGAGGTGG + Intergenic
1113722981 13:112574834-112574856 TTACTGCACCAGCTGGGGCTGGG + Intronic
1115053297 14:29091388-29091410 ATATTTCCACAGCTGGTGTGGGG - Intergenic
1117076877 14:52114011-52114033 TTAAGGCCACAGCTGGGCAGAGG - Intergenic
1119346915 14:73933264-73933286 TGGTTGTCACAGCTGGGGAGAGG + Exonic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119703809 14:76771876-76771898 TGAATGCCACAGCTGGGTCTAGG + Intronic
1120564036 14:86032450-86032472 TTATTGCCACCTCTGTGGCCTGG - Intergenic
1121484849 14:94306610-94306632 TTAGTGGCACAGCTGGAGCCAGG - Intronic
1128979183 15:72174468-72174490 TGAATTCCACAGCTGGGGCATGG - Intronic
1132027757 15:98417449-98417471 TTATTTCCATATCTGGGGCATGG + Intergenic
1132256996 15:100384525-100384547 TTGCTGTCACAGCTGGGGCCTGG - Intergenic
1133191060 16:4133987-4134009 TAATTGCCACTGCTGAGGCCAGG + Intergenic
1133422957 16:5663046-5663068 TGATTGTCACATCTGGGGCAGGG + Intergenic
1134628820 16:15742032-15742054 TGATTGTCACAGCTGGGGTGGGG + Intronic
1137547046 16:49411573-49411595 TTGTTTCTACAGCTGGGGCCAGG - Intergenic
1139367660 16:66443515-66443537 TCATTGCCACAGCAGGGGTGAGG + Intronic
1140275387 16:73504178-73504200 TTCTTTCCAAAGCTGGGGAGTGG - Intergenic
1140693822 16:77511905-77511927 TGATTGTCACAACTGGGGAGTGG + Intergenic
1142510416 17:389387-389409 TTATTGTCACAGCTGGGGGTTGG - Intergenic
1144078185 17:11737607-11737629 TTATTGTCACACCTGGTGCTTGG - Intronic
1145179078 17:20729214-20729236 TGATTGTCACAGCTTGGGGGAGG + Intergenic
1146868554 17:36360432-36360454 TGATTGTCACAGCTTGGGAGAGG - Intronic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1147071429 17:37961056-37961078 TGATTGTCACAGCTTGGGAGAGG - Intergenic
1147082956 17:38040582-38040604 TGATTGTCACAGCTTGGGAGAGG - Intronic
1147098899 17:38164553-38164575 TGATTGTCACAGCTTGGGAGAGG - Intergenic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1150467142 17:65403263-65403285 TCATGGCAACAGCTGGGGGGTGG - Intergenic
1151451855 17:74202958-74202980 TTATTGCTAGAGATGGGGGGGGG + Intergenic
1151550243 17:74818505-74818527 TTATGGCCAGAGGTGGGGGGCGG + Intronic
1151688843 17:75667349-75667371 TTATTCCCACAGCCCGGGCGTGG - Exonic
1152422718 17:80202785-80202807 TGGTTGTCACAGCTGGGGCATGG - Intronic
1152532913 17:80930823-80930845 TTCCTCCCACAGCTGGGGCAGGG + Intronic
1152901759 17:82945727-82945749 TTTTTGTCACAGCTGGGTAGGGG - Intronic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1153232855 18:2956492-2956514 TTAATGCCAGAGCTGAGGCAGGG + Intronic
1156220114 18:35042320-35042342 TTATGGCCACCGCTTGGGTGGGG + Intronic
1157352101 18:46897906-46897928 TTATTGCCCAAGCTGGAGTGTGG + Intronic
1157686082 18:49643961-49643983 TCATTGCCAGAGCTGGGGGAGGG - Intergenic
1158902096 18:61973475-61973497 ATATTGACAGAGCTGGGGTGGGG - Intergenic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1161744612 19:6048064-6048086 TGATTGCCACAGCTTGGGGAGGG - Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163456881 19:17412003-17412025 TTATTGTCACCGCGGGGGCTGGG + Intronic
1164162775 19:22639672-22639694 TTATTGCCCAGGCTGGGGTGCGG - Intronic
1168378550 19:55901084-55901106 TGATTGCCACAGCTGGTGGCTGG + Intronic
1168504898 19:56925352-56925374 TGATTGTCACAGCTGGGAAGAGG + Intergenic
925153787 2:1635096-1635118 TTCCTGCCACAGCTGGTGGGAGG + Intronic
925882596 2:8365471-8365493 TCACTCCCAGAGCTGGGGCGGGG - Intergenic
927935078 2:27071769-27071791 TTACGGCCGCGGCTGGGGCGGGG + Exonic
931353557 2:61514148-61514170 CTATTGCCCCAGCTGGAGTGTGG - Intronic
932236173 2:70123052-70123074 TTAGTGTCAGAGCTGGGACGTGG + Intergenic
936653517 2:114457344-114457366 TCATTGTCACAGCTGGGGAAGGG - Intronic
940785032 2:157971918-157971940 TTATTTTCACAGCTGGGAGGTGG - Intronic
940843161 2:158608459-158608481 TTATGGACACACCTGTGGCGAGG - Intronic
942146504 2:173032276-173032298 TTGTTGTCACAGCCGGGGTGGGG - Intronic
943756225 2:191559988-191560010 TTAGAGCCACAGCTAGGGAGGGG - Intergenic
945138629 2:206658996-206659018 TTTTTGCCACAGCAGAGGCAAGG + Intronic
1169475711 20:5929522-5929544 TTTTTGCCTCTGCTGGGGCTCGG - Intergenic
1173020822 20:39266678-39266700 TTATTGCCCCAGCAGAGGCCTGG - Intergenic
1174442993 20:50570808-50570830 TGACTGCCACATCTGGGGAGGGG - Intronic
1175124860 20:56743554-56743576 TGGTTGTCACAGCTGGGGCCTGG - Intergenic
1175216235 20:57392862-57392884 CGACTGCCACTGCTGGGGCGAGG - Intronic
1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG + Intronic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1176521826 21:7830053-7830075 GTGTGGCCACAGCTGGGGTGCGG - Intergenic
1177163143 21:17571028-17571050 TTATTGTCACAACTGTGGTGGGG - Intronic
1177273461 21:18877347-18877369 CTATAGCCCCAGCTGGGGAGTGG + Intergenic
1178655846 21:34460065-34460087 GTGTGGCCACAGCTGGGGTGCGG - Intergenic
1180109960 21:45643129-45643151 TTAGTGCCCTTGCTGGGGCGGGG - Intergenic
1180954762 22:19736727-19736749 TCAGGGCCACAGCTGGGGCCTGG + Intergenic
1181928656 22:26381148-26381170 TTATTACCACAGCTTGAGAGTGG - Intronic
1184251263 22:43261665-43261687 TCATTTCCACAGCTAGGGTGAGG + Intronic
950114806 3:10443948-10443970 TTAGTGACACAGCTGAGGCTGGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
951642782 3:24854761-24854783 TTATTGGTACAGCTGGGGTGGGG - Intergenic
952579192 3:34811033-34811055 TAATTGTCATAGCTGGGGTGAGG - Intergenic
955753489 3:62205506-62205528 TAATTGCTACAGTTGGGGAGCGG + Intronic
958867296 3:99516161-99516183 TTATTGCCAAAGGTAGGGCCTGG - Intergenic
958882523 3:99688942-99688964 TGATTGTCACAGCTGGGGAGGGG - Intronic
961185679 3:124913065-124913087 GTCTTGCCACAGCTGGAGCTAGG - Intronic
964501384 3:157351910-157351932 TCATTGTCACAGCTTGGGAGTGG - Intronic
964509642 3:157436893-157436915 TTCTTTCCACAGCTGGCGGGAGG - Exonic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973288604 4:48447198-48447220 TGATTGCCAGAGCTGGGGGGAGG - Intergenic
973638997 4:52885203-52885225 TAATTGCCACAGTTGGGAGGTGG + Intronic
974441918 4:61929796-61929818 TTATTAGCACAACTGGGGGGCGG - Intronic
976556137 4:86453318-86453340 TTATTTTCACAGCTGGGAGGCGG + Intronic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
980116282 4:128682451-128682473 TTATTGCCCATGCTGGGGGGTGG + Intergenic
981319576 4:143375868-143375890 TTGTTGTCACAGCTGGGGATGGG - Intronic
981542522 4:145860568-145860590 TTATCTCCACAGCTGGAGAGAGG - Intronic
982067912 4:151671035-151671057 TTAATGCCATAGCTGTGGCTTGG + Exonic
982635946 4:157896819-157896841 TCATTGAGACAGCTGGGGGGAGG + Intergenic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983736671 4:171070471-171070493 TTTTAGCTACAGCTGGGGCTGGG + Intergenic
984131288 4:175878555-175878577 TTTTAGCCACAGCTGGGACAGGG + Intronic
984581422 4:181514792-181514814 TTATTGCAAAACCTGAGGCGTGG + Intergenic
984705532 4:182844811-182844833 TTAGTGCCACATCTGAGGTGGGG - Intergenic
987271488 5:16314227-16314249 TGGTTGTCACAGCTGGGGAGGGG - Intergenic
989480927 5:41929289-41929311 TTATTGTCACAACTGGGGAGGGG - Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
994597704 5:101860457-101860479 TTCCTGCCACAGCTGTGGCAGGG - Intergenic
998546683 5:143034564-143034586 TTCTTCCCACAGCTGGGGGAAGG + Intronic
999038872 5:148384623-148384645 TGATTTCCACAGCTAGGGCACGG - Intronic
999209467 5:149875203-149875225 TGATTGTCACAGCTGGGGAGGGG + Intronic
999761823 5:154707619-154707641 ATTTTTCCACAGCTGGGGTGGGG + Intergenic
1000383127 5:160646983-160647005 TTCTTGCCACAACTGGGGAGGGG - Intronic
1002362507 5:178684011-178684033 TAATCGCCACAGCTGGCTCGTGG - Intergenic
1002874964 6:1202566-1202588 TGATTGCCATGGCTGGGGTGAGG - Intergenic
1003092358 6:3114828-3114850 CTATTGTCACAACTGGGGCGGGG - Exonic
1003279532 6:4679416-4679438 TGGTTGCCACAGCTGGGCAGGGG + Intergenic
1005091161 6:22058216-22058238 TGGTTGCCACAGCTGGGGAGAGG - Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1012900705 6:105002968-105002990 TTAGTGCCAAAGCTGGGACAAGG - Intronic
1014640987 6:123910134-123910156 TTATTTGCACAGCTGGGAAGTGG - Intronic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1018533972 6:164798965-164798987 TTATTCCCACAGCCAGGGCAAGG - Intergenic
1019883645 7:3885037-3885059 CTATTGGCAGAGATGGGGCGGGG - Intronic
1021861063 7:24906371-24906393 TCATTGCCCCTGCTGGGGAGAGG + Intronic
1029887469 7:103888377-103888399 CTCTTCCCACAGCTGGGGCTTGG + Intronic
1030014608 7:105206157-105206179 TGATGGCCACAGCTGGGTGGTGG - Intronic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1032847349 7:135762879-135762901 TGATTGACACAGCTGGGGTGAGG - Intergenic
1034300112 7:150007999-150008021 TTATTGCCAATGCTAGGGAGGGG - Intergenic
1035225232 7:157428894-157428916 AAGTGGCCACAGCTGGGGCGGGG + Intergenic
1037919394 8:22794000-22794022 TAATGGCCACAGTTGGGGAGGGG + Intronic
1039739774 8:40372110-40372132 TTATAGCCACAGATGGTGTGGGG - Intergenic
1044256038 8:90062887-90062909 TTATTGCCAGGGCTGGGGGAAGG + Intronic
1044619629 8:94176228-94176250 TTATTGCCACAACTTGGCAGGGG + Intronic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1046074415 8:109299577-109299599 TTCTTGCCACAGCTGCTGTGGGG - Intronic
1048015588 8:130493697-130493719 TTATTTTCACAGCTGGCACGGGG - Intergenic
1050002966 9:1098261-1098283 TTATTGTAACAGCTGAGGGGTGG + Intergenic
1051351813 9:16204610-16204632 TTATTTCCACAACTGGTGCATGG + Intronic
1053421234 9:37980099-37980121 AAATTCCCACAGCTGGGGGGAGG - Intronic
1060190231 9:121588066-121588088 TTATTGCCACAGCAGTGGTAAGG - Intronic
1060230603 9:121822618-121822640 TTATTGGCACAGCTGGTGCGGGG + Exonic
1060822951 9:126671982-126672004 TCACGGCCACAGCTGGGGCTCGG - Intronic
1061793017 9:133068436-133068458 TGATTGTCACAGCTGGGGAGGGG + Intronic
1061795622 9:133084220-133084242 TGATTGTCACAGCTGGGGAGGGG + Intronic
1188638307 X:32464428-32464450 TGATTGTCACAGCTGGGTTGGGG - Intronic
1189130283 X:38491139-38491161 TGGTTGTCACAGCTGGGGAGAGG + Intronic
1194590375 X:95793086-95793108 TTATTGCAACAGCTGGTTCTAGG + Intergenic
1196047111 X:111267911-111267933 TTATCCCCACACCTGGGGGGTGG + Intronic
1197175055 X:123476855-123476877 TTGTTGTCACACCTGGGTCGGGG - Intronic
1199793352 X:151175139-151175161 TTCTTGCCACAGTAGGGGAGAGG - Intergenic