ID: 1175749039

View in Genome Browser
Species Human (GRCh38)
Location 20:61482511-61482533
Sequence TGGCCCTCTTTTACTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175749033_1175749039 1 Left 1175749033 20:61482487-61482509 CCTGGACGCGCCTGTGCAGCAGG 0: 1
1: 0
2: 2
3: 21
4: 143
Right 1175749039 20:61482511-61482533 TGGCCCTCTTTTACTGTGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 157
1175749028_1175749039 28 Left 1175749028 20:61482460-61482482 CCAAGTCCTGTTAAACTTGAGCG 0: 1
1: 0
2: 0
3: 10
4: 56
Right 1175749039 20:61482511-61482533 TGGCCCTCTTTTACTGTGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 157
1175749027_1175749039 29 Left 1175749027 20:61482459-61482481 CCCAAGTCCTGTTAAACTTGAGC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1175749039 20:61482511-61482533 TGGCCCTCTTTTACTGTGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 157
1175749036_1175749039 -9 Left 1175749036 20:61482497-61482519 CCTGTGCAGCAGGTTGGCCCTCT 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1175749039 20:61482511-61482533 TGGCCCTCTTTTACTGTGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 157
1175749031_1175749039 22 Left 1175749031 20:61482466-61482488 CCTGTTAAACTTGAGCGGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1175749039 20:61482511-61482533 TGGCCCTCTTTTACTGTGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175749039 Original CRISPR TGGCCCTCTTTTACTGTGGG TGG Intronic
900550471 1:3252059-3252081 TTGCCCTCTTTTACACTGGAGGG - Intronic
900985033 1:6068392-6068414 TGGCACTCTCTGACTGAGGGCGG + Intronic
901763415 1:11485175-11485197 GGTCCCTCTTCTACTGTGGTGGG - Intronic
904355047 1:29933480-29933502 TGGCCCTGTTTTACAGGGGAGGG + Intergenic
905821749 1:40998059-40998081 TGGCCCTGCTTGTCTGTGGGTGG + Intronic
908766548 1:67559607-67559629 TGGCTCTCTCTGACCGTGGGTGG + Intergenic
909345423 1:74579694-74579716 CAGTCCTCTTTTACTATGGGTGG - Intronic
910344696 1:86223073-86223095 TGACCCTCTGATACTGTAGGTGG + Intergenic
911840662 1:102677078-102677100 TAGCATTCTTTTACTGTGGGAGG - Intergenic
911943280 1:104073761-104073783 TGGACTTCTGTTACTATGGGAGG - Intergenic
913650254 1:120906846-120906868 TGGCTCTCTTTTTCTGAGTGAGG + Intergenic
914076423 1:144356649-144356671 TGGCTCTCTTTTTCTGAGTGAGG - Intergenic
914102755 1:144609848-144609870 TGGCTCTCTTTTTCTGAGTGAGG + Intergenic
914170866 1:145222229-145222251 TGGCTCTCTTTTTCTGAGTGAGG - Intergenic
914525981 1:148466197-148466219 TGGCTCTCTTTTTCTGAGTGAGG - Intergenic
914640421 1:149600926-149600948 TGGCTCTCTTTTTCTGAGTGAGG + Intergenic
917267935 1:173241767-173241789 TGACCCTTGTTTCCTGTGGGAGG + Intergenic
918594728 1:186279756-186279778 TGGCAACCTTTTCCTGTGGGAGG + Intergenic
923547508 1:234933410-234933432 TGACCCTCATTGACCGTGGGCGG - Intergenic
1065404852 10:25352090-25352112 AGGCCATCTTTTAGTTTGGGAGG - Intronic
1067069540 10:43121707-43121729 TGGCCCTGTGTGCCTGTGGGTGG + Intronic
1067069702 10:43122601-43122623 TGCCTCTCTTTTTTTGTGGGGGG + Intronic
1067987012 10:51160729-51160751 TCTCCCTTTTTTACTGTTGGGGG + Intronic
1069100924 10:64319386-64319408 TGTCCCTTTCTGACTGTGGGTGG - Intergenic
1069876250 10:71565045-71565067 TGGCCCTCCTTTCTTGTGGCAGG + Intronic
1070752116 10:78970121-78970143 AGGACCTCTTTTAGTCTGGGTGG - Intergenic
1072613095 10:97031892-97031914 TGTCCCTATTTTACAGTCGGGGG - Intronic
1073931440 10:108581298-108581320 TCCCCTTCTTTTACTGTAGGTGG + Intergenic
1077333823 11:1994636-1994658 TGCTCCCCTTTTGCTGTGGGTGG - Intergenic
1084090938 11:66879077-66879099 TGGCCCTCTGTTCATCTGGGAGG - Intronic
1087356464 11:97100128-97100150 TGGTCCTTTTTTACTGTTGTTGG - Intergenic
1088370932 11:109088010-109088032 TGGCCCTTTTCTTCTGTGAGTGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090105718 11:123852075-123852097 TGGCCCTCAATTCCTGGGGGAGG - Intergenic
1090390377 11:126383854-126383876 TGGCCCACCTTTACTCTGAGGGG + Intronic
1091024122 11:132126822-132126844 TGCCCCTCCTTTGCTGTGAGAGG + Intronic
1202816806 11_KI270721v1_random:49818-49840 TGCTCCCCTTTTGCTGTGGGTGG - Intergenic
1091787839 12:3253714-3253736 TGGACCCCTTTTATTGAGGGTGG + Intronic
1092637464 12:10467129-10467151 TGGCTTCCTTTGACTGTGGGAGG + Intergenic
1094096472 12:26710760-26710782 GTGGCCTCTTTCACTGTGGGTGG - Intronic
1096576752 12:52557701-52557723 AGGCCCTCCCTTCCTGTGGGAGG - Intergenic
1102454446 12:113063140-113063162 TGGCAATCTTTGTCTGTGGGAGG - Intronic
1102813141 12:115841401-115841423 TGGCCTCCATTTACTTTGGGAGG + Intergenic
1106287981 13:28334872-28334894 TTGCCCCCCTTTACTCTGGGGGG + Intronic
1106763466 13:32890954-32890976 TGGCCCTCTTTTGTTTGGGGAGG - Intergenic
1110173527 13:72530717-72530739 TGGCTCTGCTTCACTGTGGGAGG + Intergenic
1113200537 13:107864357-107864379 AGGCCATATTTTACTTTGGGCGG - Intronic
1113241301 13:108340596-108340618 TGTCTCTCATTTGCTGTGGGAGG + Intergenic
1116085755 14:40236163-40236185 GTGCCCTATTTTACTGTGGCTGG + Intergenic
1117424734 14:55581319-55581341 TGGCCCTTCTTTCCTGTGGGAGG + Intronic
1118872378 14:69754132-69754154 TAGCCCTATTTTACTGGGGAAGG + Intronic
1118894966 14:69938290-69938312 TGGCAGTCTTTTATCGTGGGTGG + Intronic
1121125809 14:91406072-91406094 TGGCCATCTTTTACTTTGTGTGG + Intronic
1123880682 15:24675830-24675852 TGACCCTGTTTTACGGTAGGAGG + Intergenic
1131666344 15:94575122-94575144 TGACCATCTTTAACTCTGGGTGG - Intergenic
1133685679 16:8163193-8163215 TGGCCATCTTTTTCTGTAAGGGG + Intergenic
1134831728 16:17329330-17329352 TTTCCCTCTTTTACCATGGGGGG + Intronic
1140315727 16:73894937-73894959 TGGCACTGTGTTACTGTAGGTGG + Intergenic
1143485217 17:7250556-7250578 TGGGCCTCTTTAATTGTGGGAGG - Intronic
1144810168 17:17993901-17993923 TGGCCCTCTTTTAGGGAAGGAGG - Intronic
1147322165 17:39653080-39653102 GGGCCCTCTTCTCCTGGGGGTGG + Intronic
1149427056 17:56565354-56565376 TGGGCCTCTTTGAATGTTGGAGG + Intergenic
1156582704 18:38395736-38395758 AGACCCACTTTTAATGTGGGTGG + Intergenic
1157275523 18:46308551-46308573 TGAGCCACTTTTACTGGGGGAGG + Intergenic
1159980175 18:74768867-74768889 TGGCCCTCTTTTATCCTGGAAGG + Intronic
1165232813 19:34397802-34397824 TGGCCCTCTTTTACTTTTAAGGG + Intronic
1166075263 19:40410453-40410475 AAGCCCTCTTACACTGTGGGGGG - Intronic
1166366982 19:42282863-42282885 TGGCCCTTTTTTTCTGGGAGGGG + Intronic
1166747602 19:45148811-45148833 TGGGCCTTTCTTACTGTTGGGGG + Intronic
1167125432 19:47545490-47545512 TGGCCGGCTCTTTCTGTGGGAGG + Exonic
1168298684 19:55390675-55390697 TGGGCCTCTGTTCCTGCGGGTGG + Intronic
1168323054 19:55521734-55521756 GGGCCCTCTGTTACTTTTGGTGG - Intergenic
925349875 2:3193328-3193350 TGCCCCTCTTTGACTTGGGGAGG + Intronic
926113068 2:10194970-10194992 TGGCCCTGTGCTACTGTGTGTGG + Intronic
926791640 2:16577879-16577901 TGGCCATCTATGACTGCGGGAGG + Intronic
937938632 2:127267357-127267379 TTGTCCTTTTTTACTGTGGCTGG + Intronic
939125049 2:138167555-138167577 TTGTCCTTTTTTACTGTGGTTGG - Intergenic
939344292 2:140943162-140943184 TTGCCCTTTTTTACTGTTGCTGG - Intronic
940578143 2:155541297-155541319 GGGCCCTCTGTAGCTGTGGGAGG + Intergenic
942451432 2:176110164-176110186 TGGCCCTATTTCAGTGGGGGCGG - Intronic
1169563255 20:6825054-6825076 TAACCCTCGATTACTGTGGGAGG + Intergenic
1173599588 20:44284007-44284029 TGGCCCTCTTTGGATTTGGGAGG - Intergenic
1174324110 20:49765460-49765482 TGGCCCTCTTTTCCTGCAGGTGG + Intergenic
1174401169 20:50276757-50276779 AGTCCTTCTTTTACTCTGGGTGG + Intergenic
1175749039 20:61482511-61482533 TGGCCCTCTTTTACTGTGGGTGG + Intronic
1175749197 20:61483597-61483619 TGGCCCTCTTTCACTGTGGTTGG + Intronic
1181873316 22:25920614-25920636 TGGTCCTCTTTTCCAGTTGGAGG - Intronic
1183192118 22:36328283-36328305 TGCCCCTCCTGTACTGGGGGAGG - Intronic
950542459 3:13620559-13620581 TGGCCTCATTTTACAGTGGGGGG - Intronic
951011982 3:17691943-17691965 TGGCTCTCTTTTGTTGTGTGTGG - Intronic
952028065 3:29108028-29108050 GAACCCTCTTTCACTGTGGGTGG + Intergenic
952880184 3:37980469-37980491 TGGCCACCTTTTTCTGTGGCAGG + Intronic
954457922 3:50610033-50610055 TGGCCCTTTCTCACTGTGAGTGG - Intronic
955395530 3:58554483-58554505 TGGCCCCCTTTAGCTGTGGCTGG + Intergenic
963264292 3:143224791-143224813 TGGCACACTTTTTCTGTTGGTGG + Intergenic
966201387 3:177362129-177362151 TGGTCCTCCTGTGCTGTGGGAGG + Intergenic
966985387 3:185175450-185175472 GGGCCCTCTTTTACTGCTTGTGG - Intergenic
969646796 4:8435198-8435220 TTGCCCTCTTTTGCTGGGCGCGG + Intronic
972093491 4:35318483-35318505 TTGTCCTCTGTTAATGTGGGTGG + Intergenic
973531902 4:51843511-51843533 TGGCTCTCTTTCAGTGTTGGGGG + Intronic
974427015 4:61754771-61754793 TGGGCCTATTTTGGTGTGGGGGG - Intronic
974638938 4:64604540-64604562 TTGTCCTTTTTTACTGTTGGGGG + Intergenic
977883327 4:102231723-102231745 TGTTCCTCCCTTACTGTGGGAGG - Intergenic
980411721 4:132428726-132428748 TTGTCCTTTTTTACTGTTGGTGG + Intergenic
984034225 4:174646480-174646502 TCGGCCTTTTTTACTGTGAGGGG + Intronic
985726504 5:1518725-1518747 TGGCCCTGTGTTCCAGTGGGAGG + Intronic
987192702 5:15495297-15495319 AGGCCCTCATTTTCTCTGGGGGG - Intergenic
988306852 5:29504015-29504037 TTCCCCTCTTTTACTGTGAGGGG - Intergenic
989322989 5:40158893-40158915 TGTCCCTCTCTTACTTTGGCAGG - Intergenic
990590655 5:57259917-57259939 TGGTCCTCTTTTGCTTTGAGTGG + Intronic
992888867 5:81185587-81185609 TGGCCAGCTTTTCCTGTGTGGGG - Intronic
1001728994 5:173934153-173934175 TGTCACTCTGTTACTGTGGCTGG - Intronic
1005406119 6:25489859-25489881 TGGCCTTGTTTTATTTTGGGGGG - Intronic
1005979820 6:30828346-30828368 TGGCTCCCCTTTACTATGGGGGG + Intergenic
1006365749 6:33614136-33614158 TGGCCCTCTCTGACTGTGATAGG - Intergenic
1006674802 6:35754778-35754800 TGGCCTTCATGTGCTGTGGGAGG + Intergenic
1007264328 6:40585763-40585785 TGGCCTTCTAGTACTGGGGGAGG - Intronic
1008925689 6:56889845-56889867 TGGCCCCCTCTTTCTGTGGCAGG - Intronic
1009633736 6:66235548-66235570 TGACCTTCTTGTACTGTGTGTGG - Intergenic
1012257890 6:97055333-97055355 TATCCCTCTTTTACAGTGGGAGG + Intronic
1013942981 6:115688287-115688309 TGGCTCTCTTATGTTGTGGGTGG - Intergenic
1014306786 6:119752918-119752940 TGTCCCTTTTTTACTGTTGTTGG + Intergenic
1016055653 6:139575245-139575267 TGCCCCACTTTTACCATGGGAGG + Intergenic
1016389041 6:143557007-143557029 TGGCCCTCTCTAACTGAGGCTGG - Intronic
1017224672 6:152007143-152007165 TCACCCTCTTTTACTGAGTGTGG - Intronic
1018051742 6:160015396-160015418 AGGGCCTTTTTTACTCTGGGGGG + Intronic
1018160671 6:161039108-161039130 TGGCCCAAATTCACTGTGGGAGG + Intronic
1019460415 7:1155526-1155548 TGGCCCTTTTTTACTGGGATGGG + Exonic
1019655913 7:2195560-2195582 TGCCCCTCCCTTGCTGTGGGAGG + Intronic
1023026816 7:36058321-36058343 TGTCCCTCCCTCACTGTGGGAGG + Intergenic
1026858152 7:73768553-73768575 TGGCCCGGTTTTACTTTTGGTGG + Intergenic
1030114687 7:106054320-106054342 TGGCCTTCCTTCACTGTGGTGGG + Intergenic
1030333221 7:108295490-108295512 TTGCCCTATTCTACTGTGGGTGG - Intronic
1035003389 7:155635276-155635298 AGGTTCTCTATTACTGTGGGAGG - Intronic
1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG + Intergenic
1037861692 8:22409900-22409922 AGGGCCTCTATTACTGAGGGTGG - Intronic
1039398634 8:37248440-37248462 TGTCCCTCCTTGACTGAGGGAGG + Intergenic
1040417006 8:47204587-47204609 TGACCCTATTGTGCTGTGGGAGG - Intergenic
1042541107 8:69907747-69907769 TGGCCCTCTTGAGCTGTGGTGGG - Intergenic
1044308281 8:90663621-90663643 TTGTCCTCTTTTACTGTTGTTGG + Intronic
1045333551 8:101178588-101178610 TGGCCATCATTGACTGAGGGGGG + Intronic
1047597912 8:126397018-126397040 TGGCCTCTTTTCACTGTGGGTGG - Intergenic
1048267205 8:132998236-132998258 TGGCCCCTTTTTGCTCTGGGAGG + Intronic
1049792869 8:144480250-144480272 TGGCCAGCTTTTACTGTGAAGGG + Intronic
1051441913 9:17093745-17093767 TGGACTTCTTTTAATGAGGGAGG + Intergenic
1051938107 9:22469058-22469080 AGGCTCTCTTTTGCTATGGGAGG - Intergenic
1052320221 9:27159642-27159664 AGGCCCACTTTTATTTTGGGAGG - Intronic
1052918835 9:33946528-33946550 TGGCCCTCTTTTTCTCTATGGGG + Intronic
1053571928 9:39318720-39318742 TGGCCCCTTTTAACTGTGGCTGG - Intergenic
1053882677 9:42611626-42611648 TGGCCCCTTTTAACTGTGGCTGG + Intergenic
1053889992 9:42682676-42682698 TGGCCCCTTTTAACTGTGGCTGG - Intergenic
1054093482 9:60877431-60877453 TGGCCCCTTTTAACTGTGGCTGG - Intergenic
1054114965 9:61153351-61153373 TGGCCCCTTTTAACTGTGGCTGG - Intergenic
1054125217 9:61300291-61300313 TGGCCCCTTTTAACTGTGGCTGG + Intergenic
1054221704 9:62419094-62419116 TGGCCCCTTTTAACTGTGGCTGG + Intergenic
1054229010 9:62490079-62490101 TGGCCCCTTTTAACTGTGGCTGG - Intergenic
1054592791 9:67029183-67029205 TGGCCCCTTTTAACTGTGGCTGG + Intergenic
1055755534 9:79553756-79553778 TTGCCCTATTTTTTTGTGGGTGG - Intergenic
1058007767 9:99937790-99937812 TGGGTCTCTTTTACTTTGGTAGG + Intronic
1059416376 9:114165134-114165156 TAGCCCTGTTTTACAGTGGAGGG + Intronic
1061133553 9:128721247-128721269 TGGCCCACTTCTTCTGTGGATGG - Exonic
1186500143 X:10044464-10044486 TGCCCTTCTTTGACTGTGTGAGG + Intronic
1188465154 X:30471393-30471415 TGTACCTCTTCCACTGTGGGTGG - Intergenic
1189350998 X:40275668-40275690 TTGGCCTCATTTAATGTGGGAGG + Intergenic
1199453012 X:147994224-147994246 CCTCCCTCTTTGACTGTGGGTGG - Intronic
1199863181 X:151820311-151820333 TGGCCCAGGTTTACTGTGGCTGG + Intergenic
1200981448 Y:9266560-9266582 TGGCTCTCTCTCACTGTGGAGGG - Intergenic
1202070937 Y:20990857-20990879 TAGCCCTCTTTTAGTGTCAGAGG + Intergenic