ID: 1175749329

View in Genome Browser
Species Human (GRCh38)
Location 20:61484418-61484440
Sequence GATGCAGCTCGTGCCCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175749329_1175749331 11 Left 1175749329 20:61484418-61484440 CCTCACTGGGCACGAGCTGCATC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1175749331 20:61484452-61484474 AGCCTGCCCCACTCTTCATCAGG 0: 1
1: 0
2: 3
3: 12
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175749329 Original CRISPR GATGCAGCTCGTGCCCAGTG AGG (reversed) Intronic
900400419 1:2470746-2470768 GAGGGAGCTCCTGCCGAGTGAGG - Intronic
900597909 1:3490804-3490826 GGTGCAGCTGCTGCCCTGTGGGG + Intronic
900953184 1:5870813-5870835 CCTGCAGGGCGTGCCCAGTGGGG - Intronic
904344308 1:29857888-29857910 GAGGCAGCTGGTGCTCTGTGAGG + Intergenic
905884027 1:41482171-41482193 GAGGCAGCTCAGGCCCAGAGAGG - Intronic
907136204 1:52141986-52142008 CCTGCGGCTCGTGCCCAGCGCGG + Intergenic
910461437 1:87451835-87451857 TATGCAGCTATTGCACAGTGGGG + Intergenic
914318660 1:146538134-146538156 TATGCAGCTATTGCACAGTGGGG + Intergenic
914495700 1:148195223-148195245 TATGCAGCTATTGCACAGTGGGG - Intergenic
915657704 1:157375358-157375380 GATGGAGCTGGTGTCGAGTGAGG + Intergenic
915671362 1:157491618-157491640 GATGGAGCTGGTGCCGAGTGAGG - Intergenic
918614771 1:186531857-186531879 CAGGCAGGTCCTGCCCAGTGAGG + Intergenic
921328930 1:214016052-214016074 GATGGAGCATCTGCCCAGTGAGG - Intronic
923215321 1:231843512-231843534 GATGGCCCTCGTGCCCAGTGTGG - Intronic
1063578879 10:7287502-7287524 GATGCAGGTGTAGCCCAGTGGGG - Intronic
1067475589 10:46563867-46563889 TATGCAGCCCAGGCCCAGTGTGG + Intergenic
1067619146 10:47777908-47777930 TATGCAGCCCAGGCCCAGTGTGG - Intergenic
1071522037 10:86337432-86337454 GTTGTAGCTGGGGCCCAGTGTGG - Intronic
1073024767 10:100479898-100479920 GTGGCAGCTGGTGCCCAGAGTGG + Exonic
1074764040 10:116687396-116687418 GAACCAGCTCCTGTCCAGTGAGG + Intronic
1076168659 10:128302421-128302443 GGTGCAGCTCTTTCCGAGTGTGG + Intergenic
1076746652 10:132517937-132517959 GGTGCAGCTAGGGCCCAGAGTGG - Intergenic
1077351619 11:2095664-2095686 GAAGGAGCTCTTGGCCAGTGAGG - Intergenic
1083193274 11:61067995-61068017 GATGTGGCTGGAGCCCAGTGTGG + Intergenic
1083595880 11:63918072-63918094 GCTGCAGCACGTGCCCCGGGCGG - Intergenic
1091429309 12:419277-419299 GATGCAGGTAGTCCCCAGGGAGG + Intronic
1092523615 12:9296141-9296163 GAAGCAGCTCGAGCCCAGCCAGG - Intergenic
1092543682 12:9435758-9435780 GAAGCAGCTCGAGCCCAGCCAGG + Intergenic
1092622414 12:10286847-10286869 ACTGCACCTGGTGCCCAGTGAGG - Intergenic
1092916661 12:13195626-13195648 GAAGCAGCTCAGGCCCAGAGAGG - Intergenic
1093094393 12:14956309-14956331 GATGAAACTGGGGCCCAGTGAGG - Intronic
1093321371 12:17719012-17719034 GATTCAGCTGGGGCCCATTGAGG - Intergenic
1094509262 12:31086293-31086315 GAAGCAGCTCGAGCCCAGCCAGG - Intronic
1096518971 12:52173567-52173589 GCTGCTTCTCGTGCCCTGTGTGG + Intronic
1098113931 12:67154668-67154690 GATGCAGCTACTGCCAAGAGTGG + Intergenic
1100799044 12:98212285-98212307 GAACCAGCTCGTGCCCAGAGAGG - Intergenic
1102952208 12:117038378-117038400 GAAGCAGCTCCTGCCCTGTGTGG - Intergenic
1120016884 14:79484076-79484098 GATCCGGTTCGTGACCAGTGGGG - Intronic
1122689990 14:103527752-103527774 GAGGCAGCTGGTGGCCAGCGTGG + Intergenic
1123971296 15:25510321-25510343 GATGCATGTCAAGCCCAGTGGGG + Intergenic
1124923509 15:34048476-34048498 CATGGAGGTCCTGCCCAGTGAGG - Intronic
1128750498 15:70145450-70145472 GGGGCAGCTGGTGCCCAGGGAGG + Intergenic
1129922279 15:79329541-79329563 CATACAGCTTGTGCCCAGAGAGG + Intronic
1131258995 15:90878927-90878949 GCTGTAGGTCGTGGCCAGTGTGG - Exonic
1143336310 17:6174192-6174214 GATGCTGCTGGTGCCGAGTTCGG + Intergenic
1144100368 17:11937450-11937472 GCTGCAGCTCCAGCACAGTGCGG - Exonic
1144459285 17:15444994-15445016 GATGCAGCTTGCGGCCAGAGAGG - Intronic
1147034893 17:37672543-37672565 GCTCCAGCTAGGGCCCAGTGGGG - Intergenic
1147565201 17:41531902-41531924 GATGCAGGTGGTTCCCAGAGTGG + Intergenic
1149557708 17:57585913-57585935 ACTGCAGCTCGCGCCCAGCGGGG - Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1161052200 19:2170365-2170387 CAAGCAGTCCGTGCCCAGTGAGG - Intronic
1161699040 19:5785025-5785047 GGTGCTGCTGGTGCCCAGAGAGG - Intronic
1166154369 19:40899872-40899894 GAGGCAGCTGAGGCCCAGTGGGG + Intergenic
1167608309 19:50493415-50493437 GAGGCAGCCCGTGCCCATGGAGG - Intergenic
928097202 2:28412082-28412104 GCTGCAGCCCATGCGCAGTGGGG + Exonic
932320738 2:70820426-70820448 GCCCCAGCTCTTGCCCAGTGAGG - Intronic
938341838 2:130541145-130541167 GGTGCTGCCCGTGCCCAGCGTGG + Intronic
938347992 2:130579566-130579588 GGTGCTGCCCGTGCCCAGCGTGG - Intronic
944491784 2:200265343-200265365 GATTCTGCTGGTGACCAGTGGGG - Intergenic
944600407 2:201297566-201297588 GATACTGCTCATGTCCAGTGAGG + Intronic
947791494 2:232871756-232871778 GAAGCAGCTTCTTCCCAGTGAGG - Intronic
947916327 2:233834166-233834188 GTTGCAACTGGAGCCCAGTGAGG + Intronic
1169123624 20:3111845-3111867 GATGGAGCACTTGCCCTGTGAGG - Intronic
1169570292 20:6898805-6898827 GAAGCAGCACCTGCCCAGGGAGG - Intergenic
1170706557 20:18749257-18749279 GAGGCAGCTGCAGCCCAGTGAGG + Intronic
1172046634 20:32085060-32085082 GATGCAGTGCCAGCCCAGTGTGG + Intronic
1174391174 20:50219244-50219266 GAGGCAGCTCCTGCTCAGCGAGG - Intergenic
1175282074 20:57810686-57810708 CATGCTGCTCGTGCCCATTACGG - Intergenic
1175749329 20:61484418-61484440 GATGCAGCTCGTGCCCAGTGAGG - Intronic
1179455201 21:41494473-41494495 GATGCACCTCGTAGACAGTGGGG + Exonic
1179714978 21:43281891-43281913 GATGCACCCCATGCCAAGTGGGG - Intergenic
1179799280 21:43803362-43803384 GACGCATCCCGTGTCCAGTGTGG - Intronic
1180693855 22:17739603-17739625 AGTGGAGCACGTGCCCAGTGGGG - Intronic
1181065880 22:20305854-20305876 GGTACTGCTTGTGCCCAGTGAGG + Intergenic
1181327270 22:22059412-22059434 TTTGCAGGTGGTGCCCAGTGAGG + Intergenic
1184853208 22:47132564-47132586 GAGGCAGCTCATGTCCTGTGGGG - Intronic
1185163621 22:49244348-49244370 GGCGCAGCTCCTGCCCAGGGAGG - Intergenic
1185410565 22:50679317-50679339 GATGCTGCACGTGCCCAAAGCGG - Intergenic
953386939 3:42512098-42512120 GATGGAGCTCGTGCTCACTGTGG + Intronic
953703300 3:45213142-45213164 GGTGGAGGTGGTGCCCAGTGAGG - Intergenic
954383984 3:50234936-50234958 GTTGCAGCCATTGCCCAGTGGGG + Intronic
960841387 3:121962980-121963002 GTTGGAGGTCCTGCCCAGTGAGG - Intergenic
968560603 4:1279281-1279303 GATGCAGCCCTTGACCAGGGAGG - Intergenic
968640462 4:1712083-1712105 GAGGGAGCGCGTGCCCCGTGGGG - Intronic
969289188 4:6227780-6227802 CATACACCTCGTGCCCTGTGGGG + Intergenic
973727445 4:53790336-53790358 GATGAAGCTCATGCCCAGGTGGG + Intronic
977323623 4:95548920-95548942 GATTCAGCTTCTGCCCAGTGGGG - Exonic
985820017 5:2153361-2153383 GATGCTGCTTGTGAGCAGTGAGG + Intergenic
987045975 5:14108663-14108685 GTTGCAGATCGTGCCCAGTAGGG + Intergenic
1001764454 5:174234489-174234511 GAGGCAGCTGGGGCCCTGTGGGG - Intronic
1006340039 6:33441820-33441842 GATGCATGTGGGGCCCAGTGAGG - Intronic
1019070517 6:169341219-169341241 GAGGCAGCCAGAGCCCAGTGAGG + Intergenic
1019426992 7:982622-982644 GATGCAGGTGGTGGCCTGTGAGG + Intergenic
1019592218 7:1841325-1841347 GATGCAGCTTCAGCCCAGGGAGG - Intronic
1023542201 7:41277642-41277664 GAGGCAGCTCCTGCCCTGTCAGG + Intergenic
1023606559 7:41936652-41936674 GGTGCAGCCTGTGCCCAGGGAGG - Intergenic
1023836641 7:44072524-44072546 CAAGCAGCTCGGGGCCAGTGGGG + Exonic
1023931582 7:44709472-44709494 GATGAAGCTCTTGGCCAGAGGGG - Intergenic
1024308408 7:47947422-47947444 CCTGCAGATCTTGCCCAGTGGGG - Intronic
1024613026 7:51083300-51083322 GCTGGATCTGGTGCCCAGTGAGG - Intronic
1033271715 7:139938236-139938258 GATGCAGCGGTTGGCCAGTGGGG + Intronic
1038011568 8:23480498-23480520 GATGCAGCCAGCACCCAGTGGGG - Intergenic
1039665540 8:39522859-39522881 GCTGCAGCTCGAGGCCAGGGTGG + Intergenic
1040003878 8:42601561-42601583 GCTGCAGCTCCTGTCCAGTGAGG - Intergenic
1041254197 8:55965336-55965358 GATGCAGCAGGTGCCCTGGGAGG - Intronic
1041260913 8:56019849-56019871 CATGCACATCCTGCCCAGTGTGG + Intergenic
1044749045 8:95398859-95398881 GATGGAGCTCTTACCCAATGGGG - Intergenic
1050546505 9:6714247-6714269 AAAGCAGATCCTGCCCAGTGTGG + Intergenic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1060989250 9:127838802-127838824 GATCCAGCCCCTGCCCAGCGGGG + Intronic
1061799767 9:133107368-133107390 GATGCAGCTTGAGCCTTGTGGGG + Intronic
1185780831 X:2843367-2843389 GATGCGGCTTGTGCCCAGCTGGG + Intronic
1186607848 X:11110479-11110501 GATGCAGATCGTCCCCAAGGAGG + Intergenic
1187371672 X:18714225-18714247 GAAGCAGCTCATGCTCAGTGTGG + Intronic
1189340831 X:40203356-40203378 GCTGTAGCTCTTGCACAGTGTGG - Intergenic
1191781964 X:64878847-64878869 GCTTCAGCTCATGCTCAGTGGGG - Intergenic