ID: 1175751329

View in Genome Browser
Species Human (GRCh38)
Location 20:61499902-61499924
Sequence CTGTGGCAGGGGTGGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 10, 3: 68, 4: 522}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175751320_1175751329 4 Left 1175751320 20:61499875-61499897 CCCTCCAGATGTGGGCATCGATT 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG 0: 1
1: 0
2: 10
3: 68
4: 522
1175751316_1175751329 16 Left 1175751316 20:61499863-61499885 CCTTGTTTTCTCCCCTCCAGATG 0: 1
1: 0
2: 0
3: 45
4: 416
Right 1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG 0: 1
1: 0
2: 10
3: 68
4: 522
1175751314_1175751329 30 Left 1175751314 20:61499849-61499871 CCTGTACCATGGAACCTTGTTTT 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG 0: 1
1: 0
2: 10
3: 68
4: 522
1175751319_1175751329 5 Left 1175751319 20:61499874-61499896 CCCCTCCAGATGTGGGCATCGAT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG 0: 1
1: 0
2: 10
3: 68
4: 522
1175751321_1175751329 3 Left 1175751321 20:61499876-61499898 CCTCCAGATGTGGGCATCGATTC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG 0: 1
1: 0
2: 10
3: 68
4: 522
1175751322_1175751329 0 Left 1175751322 20:61499879-61499901 CCAGATGTGGGCATCGATTCTGT 0: 1
1: 0
2: 0
3: 8
4: 49
Right 1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG 0: 1
1: 0
2: 10
3: 68
4: 522
1175751315_1175751329 24 Left 1175751315 20:61499855-61499877 CCATGGAACCTTGTTTTCTCCCC 0: 1
1: 0
2: 1
3: 16
4: 259
Right 1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG 0: 1
1: 0
2: 10
3: 68
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175751329 Original CRISPR CTGTGGCAGGGGTGGTTGGA AGG Intronic
900230678 1:1555473-1555495 CTGTGGCAGGCATGTCTGGAGGG + Intronic
900566877 1:3337655-3337677 CTGGGGCAGAGATGGTTGCATGG - Intronic
900624963 1:3603816-3603838 CTGGGGCCAGGGTGGCTGGACGG - Intronic
900879497 1:5370539-5370561 CTGTGGCAGGGGTTATTGTTTGG - Intergenic
901207985 1:7508239-7508261 CTGTGACAGGGGTCTGTGGAGGG - Intronic
901377446 1:8849368-8849390 CTGTACCGGGGGGGGTTGGAGGG - Intergenic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
902092678 1:13915996-13916018 CTGTGGCAGGGGTTGGGGGCCGG + Intergenic
902154604 1:14474567-14474589 CTGTGTGAGAGGTGGTCGGAAGG + Intergenic
902165093 1:14563709-14563731 CTGTGGCAGGGCTGAGAGGATGG - Intergenic
902644030 1:17785597-17785619 CTGTGACAGGGATGCTTGTAGGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904043877 1:27599160-27599182 CTGTGGTAGGGCTGTGTGGAGGG - Intronic
904048731 1:27625285-27625307 GTGTGCCAGGGGTGATAGGAAGG - Intronic
904255937 1:29255007-29255029 CTGAGCCAGTGGTGGTTGGGGGG + Intronic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904325876 1:29727294-29727316 CTGGGGGAGGGGTGGAGGGAAGG + Intergenic
904325926 1:29727406-29727428 CTGGGGGAGGGGTGGAGGGAAGG + Intergenic
904433416 1:30479465-30479487 CTGGGGGAGGGGTGGAGGGAAGG - Intergenic
904433475 1:30479603-30479625 CTGGGGAAGGGGTGGAGGGAAGG - Intergenic
904433499 1:30479659-30479681 CTGGGGGAGGGGTGGAGGGAAGG - Intergenic
904569278 1:31449128-31449150 CTGTGGCAGGCGTGGTGTGATGG - Intergenic
905107239 1:35571508-35571530 CTGTGGCTGGGGTTGAGGGAGGG + Intergenic
905274107 1:36806065-36806087 CTGTGGGAGGGGTGGGTGTGTGG - Intronic
906109246 1:43312310-43312332 TTGTTGCAGCCGTGGTTGGAGGG + Exonic
906694865 1:47817206-47817228 CTGGGGCAGGGGTGTTGGGGGGG - Intronic
906967652 1:50474317-50474339 CTGGAGCAGGGCTGGTAGGAAGG - Intronic
907431715 1:54416040-54416062 CTGTAGGAGGGGTGGCTAGATGG - Intergenic
907452329 1:54553753-54553775 CAGAGGCAGGGGTTGTTGGGGGG - Intronic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
908808737 1:67957745-67957767 CTGTGGTGGGGTTGGTTGAAAGG + Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909190484 1:72542992-72543014 CTGTGGCAACCATGGTTGGATGG - Intergenic
909652076 1:77986997-77987019 TTGTGGCAGGGGTGGAGGGTAGG - Intronic
909759538 1:79271037-79271059 GTGGGGCGGGGGTGTTTGGAGGG - Intergenic
910372350 1:86530231-86530253 CTGGGGGAGGGATGGTTGGAAGG - Intergenic
910430265 1:87153089-87153111 GGGTGGCAGGGCTGCTTGGATGG + Intronic
910624955 1:89296703-89296725 CATTGGCAGGGGAGGTTGGAGGG - Intergenic
913522261 1:119656036-119656058 CTGTTGAAGGGATGGATGGATGG - Intergenic
913616485 1:120565083-120565105 CTGAGGCAGGGGTGGTTTAGTGG + Intergenic
914573792 1:148945828-148945850 CTGAGGCAGGGGTGGTTTAGTGG - Intronic
915313275 1:155015214-155015236 CGGTGGCGGAGGTGGTGGGAGGG - Exonic
915834474 1:159164222-159164244 CTCTGGCAGTAGTGGATGGATGG - Intergenic
916206508 1:162320510-162320532 GTGGGGAGGGGGTGGTTGGAAGG - Intronic
916214769 1:162385278-162385300 ATATGGCAGTGGTGGTGGGAAGG - Intronic
916991097 1:170246353-170246375 CAGGGGCTGGGGTGGTTGGAGGG + Intergenic
917838729 1:178960734-178960756 CTGAGGGAGGGGTGGGTGGCAGG - Intergenic
918311413 1:183288036-183288058 CTGTGGCTGGTGGGGTGGGAGGG + Intronic
920169468 1:204061877-204061899 ATCTAGAAGGGGTGGTTGGAAGG + Intergenic
920200656 1:204257915-204257937 GTGGGGCTGGGGTGGGTGGAGGG - Intronic
920347732 1:205317489-205317511 CTCTGGCTGGTGTGGTGGGATGG - Intronic
920624642 1:207585113-207585135 CTGAGGGAGGGGTGGAGGGAAGG + Intronic
921605180 1:217143643-217143665 GTGTGCCAGAGGTGATTGGAGGG + Intergenic
922701869 1:227765932-227765954 CTGTGGAGGGTGGGGTTGGAAGG + Intronic
923016250 1:230128620-230128642 CGGGGGCGGGGGTGGTTGGGGGG + Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924432287 1:244007455-244007477 ATGTGGCAGGGGTGGGTGACAGG - Intergenic
924626226 1:245698425-245698447 TTCTGGCATGGGTGGTGGGAAGG + Intronic
1063680180 10:8179756-8179778 CTGGGGCTGGGTTGGTGGGAGGG - Intergenic
1064851548 10:19714327-19714349 GTTTGGCCAGGGTGGTTGGAGGG - Intronic
1066153381 10:32649152-32649174 CTGTGGGAGTTGTGGTGGGAGGG + Intronic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1069213039 10:65785428-65785450 TAGTGGGAGGAGTGGTTGGAGGG - Intergenic
1069718314 10:70534547-70534569 CTGGGGCAGGGGTGGTGGAGGGG + Intronic
1070404829 10:76085526-76085548 CTGGGGCTGGGGTGGAGGGAGGG + Intronic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070787032 10:79167930-79167952 CTGTGGCAGGGATGGCTCCAAGG + Intronic
1070961922 10:80505382-80505404 CTGTGGCAGGGGTGCTGGGGAGG + Intronic
1071124830 10:82321289-82321311 CTGTGGCAGGGGTGGGGGTGGGG + Intronic
1071445589 10:85743239-85743261 CTTTGGCAGAGGTGATTGGAAGG - Intronic
1071828548 10:89349671-89349693 GTCTGTCAGGAGTGGTTGGAGGG + Intronic
1072518551 10:96210334-96210356 CTGTGTCAGGAGTGGTGGGTTGG - Intronic
1073096523 10:100983564-100983586 CTGGGGCAGGAGTGGCTGGCCGG - Exonic
1073776253 10:106789113-106789135 CTGTCGCAGGCGTGGCTGAAAGG - Intronic
1074769799 10:116725825-116725847 GTGTGGCAGGGGTTGGGGGAGGG - Intronic
1075502889 10:122993980-122994002 CTGGGGCTGGGGTGCTTGGCTGG + Exonic
1075844992 10:125538178-125538200 GTCTGGCAGGGATGGCTGGAAGG + Intergenic
1075916412 10:126171383-126171405 CCGTGGCAGGGGTGGTTAGTTGG + Intronic
1076581793 10:131516983-131517005 CAATGGGAAGGGTGGTTGGATGG - Intergenic
1076819786 10:132932504-132932526 CTGTGTCAGGAGTGTTGGGAAGG - Intronic
1077114915 11:879788-879810 CTGAGGCAGGGCTGGGTGCATGG + Intronic
1077282530 11:1752180-1752202 CTGTGGCAGCTGTGGCTGGAGGG + Intronic
1077364096 11:2154610-2154632 CAGGGGCAGGGGTGAGTGGAAGG - Intronic
1077429224 11:2507769-2507791 CTGTAGCCTGGGTGGGTGGAAGG + Intronic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078551240 11:12281768-12281790 CTTGGGCAGTGGTGGCTGGAGGG - Intronic
1079025999 11:16948162-16948184 CAGAGGCTGGGGTGGGTGGAGGG + Intronic
1079356136 11:19731543-19731565 AGGTGGCAGGGGTTGTTGGGGGG + Intronic
1080075914 11:28149362-28149384 GTGTGGCAGGGGTGAGTGGTGGG + Intronic
1080234037 11:30048191-30048213 TTGTTGGCGGGGTGGTTGGAGGG - Intergenic
1081216835 11:40410602-40410624 CTGGGCCAGGGGTGGTTTGCTGG + Intronic
1081767540 11:45621931-45621953 TTGTGCCAGGGATGGTTGTAGGG - Intergenic
1081950807 11:47040918-47040940 CTATGGCAGCGGTGGTGGGGAGG + Intronic
1082792902 11:57359466-57359488 CTCTGACAGGCGTGGCTGGAAGG - Intronic
1083230171 11:61312376-61312398 CTGTGTCAGAGTTGGCTGGAGGG + Intronic
1083298129 11:61726167-61726189 ATGGGGCAGGGCTGGTGGGAAGG + Intronic
1084142162 11:67239857-67239879 CTATTGCAGTGGTGGTGGGAGGG + Intronic
1084268185 11:68015492-68015514 CTGGGGCAGGGGGGCATGGAGGG + Intronic
1084316801 11:68350379-68350401 CTGTGGCAGGCCTGGATGCATGG - Intronic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085618889 11:78022764-78022786 CTCTGGCCGAGCTGGTTGGATGG + Intronic
1086110444 11:83193382-83193404 CTTTCTCAGTGGTGGTTGGAAGG - Intergenic
1086395710 11:86413143-86413165 GTTTGGCTGGGGTGGTTGGAGGG - Intronic
1089400731 11:118162939-118162961 GGTTGGAAGGGGTGGTTGGAAGG - Exonic
1089615591 11:119692993-119693015 GAGTGGCAGGGGTGGGAGGATGG - Intronic
1089875290 11:121715454-121715476 ATGTGGCAGGGGTGGGGGCACGG + Intergenic
1090608709 11:128451367-128451389 CGGTGGGTGGGGTGGATGGAAGG + Intergenic
1091293171 11:134453721-134453743 CTGTGCCGGGGGTGTTGGGAAGG + Intergenic
1092411161 12:8253991-8254013 TTGTGGCAGCATTGGTTGGATGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1092845735 12:12583304-12583326 CTGTGTCAGGGATGGTCTGATGG + Intergenic
1094244256 12:28269542-28269564 GGGTGGCAGGGTTGGTTGGGGGG - Intronic
1095466259 12:42490685-42490707 CAGTGGAAGGGGTGGCAGGAGGG + Intronic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1096582140 12:52592538-52592560 CTGTGGCAGGGAGGGAGGGATGG - Intronic
1097227030 12:57483428-57483450 CTGTGTCAGGAATGGTTGGAAGG - Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1098876767 12:75873652-75873674 CTGTGGCAAGGGGAGTTGGGTGG + Intergenic
1099989247 12:89707151-89707173 GTGTGGCAGGGGTGGATTGGGGG - Intronic
1100030415 12:90181615-90181637 ATGTGGCAAGGGTGATTGGATGG + Intergenic
1101523487 12:105506234-105506256 CAGTGGCAGGGGTGGGGTGAAGG + Intergenic
1102587137 12:113931386-113931408 CTGTGGCTGGTGTGCTTCGAAGG + Intronic
1102634044 12:114307109-114307131 CTGGGGCAGGGGTGACTGCAAGG + Intergenic
1103058867 12:117842908-117842930 CTAAGGCAGGGGTGGAGGGAGGG - Intronic
1103297296 12:119898757-119898779 CTGTTGTGGGGGTGGGTGGAGGG - Intergenic
1103428263 12:120857811-120857833 CTGTCACAGGGGTGGGTGGAAGG + Intronic
1103912586 12:124360558-124360580 GTGTGGCAGGGGCTGCTGGAGGG - Intronic
1104859711 12:131917751-131917773 GAGTGGCAGGGGTGGTCTGAGGG - Intronic
1105682689 13:22745283-22745305 CCGGGGCAGGGGTGGTGGGGTGG + Intergenic
1105782345 13:23715845-23715867 CTGTGGCAGGGATGGGTCGGGGG + Intergenic
1105917639 13:24931859-24931881 CTTTGGGAGAGGTGGGTGGATGG - Intergenic
1106020572 13:25911079-25911101 TTGTGTCAGGGCTGTTTGGAGGG - Intronic
1106131786 13:26946870-26946892 CTGTGGCAGGGGACATTGGCAGG - Intergenic
1106384063 13:29267315-29267337 CTTTGGAAGGCGTGGTTGGGAGG - Intronic
1107556539 13:41520731-41520753 CTGTGCCAAGGGTGGCTGGGGGG + Intergenic
1110305533 13:73983221-73983243 CTGTGCCAGGGTTGGTTGCCTGG - Intronic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1111971680 13:94923560-94923582 CCTTGGCAGGGGTGACTGGAAGG - Intergenic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1114852742 14:26400614-26400636 ATGTGGCAGGGCTGGTTGGAGGG + Intergenic
1115392238 14:32866454-32866476 CTGTGGCAGGGTTGGATGGAGGG + Intergenic
1117374901 14:55111171-55111193 CTGTGGCAGCTGTAGTTGGCTGG + Intergenic
1117716501 14:58586967-58586989 CTATGGCAGGGGAGTTTGGAGGG - Intergenic
1118087870 14:62440263-62440285 CTGTGGCAGGGGTGTTTGCAGGG + Intergenic
1118158662 14:63266972-63266994 CTGTGTCAGGGGTAGTGTGAGGG - Intronic
1119216834 14:72875806-72875828 CAGTGGCAGGGGTGTCTGGGTGG + Intronic
1119427278 14:74543953-74543975 CTGGGGCAGGGGTGGCTAGGTGG - Intronic
1119522276 14:75294875-75294897 CTGGGGAGGGGGTGGTTAGAGGG - Intergenic
1120140007 14:80919463-80919485 GTGAAGGAGGGGTGGTTGGAAGG - Intronic
1120635224 14:86943060-86943082 CTGTGGCAGAAGTCATTGGATGG + Intergenic
1120851989 14:89179997-89180019 GTCTGGCAGTGGTGGATGGATGG + Intronic
1121658408 14:95615800-95615822 CTGTGGCAGAAGTGCTTGAAGGG + Intergenic
1121713961 14:96059681-96059703 CAGTGGCATGGGAGTTTGGATGG - Intronic
1121826921 14:97017735-97017757 CCTTGGCAGGGATGGCTGGAAGG - Intergenic
1121906820 14:97753541-97753563 CTGTGGCAGGAGGGGTGGGTTGG + Intronic
1121956658 14:98219563-98219585 CTTTGGCAGGGGAGTTGGGAAGG + Intergenic
1121958007 14:98231558-98231580 CTCTGGCAGGGTAGGGTGGAAGG - Intergenic
1122082515 14:99275113-99275135 CTGAGGCAGGGGTGGGTACATGG - Intergenic
1122129610 14:99597504-99597526 CTGTGTCAGGGGAGGTTGCGTGG - Intronic
1122154596 14:99742554-99742576 CTGGGGCTGGGGTGCTGGGACGG + Intronic
1122445418 14:101763870-101763892 CAGTAGCAGAGGTGGTTTGAAGG - Intronic
1122785903 14:104163119-104163141 CTGAGGCTGGGGTGGTGGGCAGG + Intronic
1122829367 14:104388232-104388254 CAGGGGCTGGGGTGCTTGGAGGG + Intergenic
1122853464 14:104548744-104548766 CTGGGGCAGGGGTGGGGGCAGGG - Intronic
1122967584 14:105138517-105138539 TGGTGGCAGGGGTGGTGGCACGG + Intergenic
1122981596 14:105194627-105194649 CTGACGCAGGGGTGCTGGGAAGG - Intergenic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124484019 15:30100277-30100299 CTATGGCAGGGGAGGTGGGTGGG + Intergenic
1124519561 15:30396947-30396969 CTATGGCAGGGGAGGTGGGTGGG - Intergenic
1124539092 15:30569274-30569296 CTATGGCAGGGGAGGTGGGTGGG + Intergenic
1124759558 15:32438298-32438320 CTATGGCAGGGGAGGTGGGTGGG - Intergenic
1124848161 15:33311311-33311333 CTGGGGCAGGGGTGGCGGTAGGG - Intronic
1125030237 15:35068771-35068793 CTCTGGTAGGGGTGGTTGGTTGG - Intergenic
1126273362 15:46848009-46848031 CTGTGGCAGGATTGGATGTAGGG + Intergenic
1126409410 15:48356539-48356561 TGGTGGCAGGGGTGGTTAGCAGG + Intergenic
1126856058 15:52840509-52840531 CTATGGCTGGGCTGGTGGGAAGG - Intergenic
1128719883 15:69940511-69940533 CTGTGTGTGAGGTGGTTGGAGGG - Intergenic
1128922313 15:71622993-71623015 CTGTTGCAGTGCTGGTTGGATGG + Intronic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129336828 15:74857208-74857230 CTGTCGCAGAGGAGGTTGGAAGG - Intronic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1129468467 15:75737636-75737658 ATGTGGTAGGGGTGGCTGCAGGG - Intergenic
1129727105 15:77906860-77906882 ATGTGGTAGGGGTGGCTGCAGGG + Intergenic
1130758992 15:86797734-86797756 ATGGGGCAGGGGTGGTGGGGAGG + Intronic
1130890005 15:88125684-88125706 CTGTGGCAGGGTGGGGTGGTGGG - Intronic
1131385241 15:92000904-92000926 CTGAGTCTGGGGTAGTTGGAGGG + Intronic
1131402288 15:92134880-92134902 GTGGGGCAGGGGTGGAAGGAGGG + Intronic
1131517172 15:93087356-93087378 CTGGGGCAGACGTGGCTGGATGG - Intronic
1131542722 15:93288466-93288488 GTGAGGCAGAGGTGGTTGGTGGG - Intergenic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1132467306 16:83267-83289 CTGGGGCACGGGGGGTTGGAGGG + Intronic
1132700712 16:1220946-1220968 CTGGGGCAGGGGTGGCTGAGGGG - Exonic
1132981623 16:2741189-2741211 CTGAGGCAGGGGTTGGTGCAGGG - Intergenic
1133039735 16:3054127-3054149 CAGAGGCAGGGATGGATGGACGG + Intronic
1133039755 16:3054271-3054293 CAGAGGCAGGGATGGATGGACGG + Intronic
1133039778 16:3054407-3054429 CAGAGGCAGGGATGGATGGATGG + Intronic
1133039788 16:3054475-3054497 CAGAGGCAGGGATGGATGGATGG + Intronic
1133043593 16:3073854-3073876 CAGAGGCAGGGATGGATGGATGG + Intronic
1133043616 16:3073986-3074008 CAGGGGCAGGGATGGATGGATGG + Intronic
1135544700 16:23357848-23357870 TTATGGCAGGTGTGGTTGGCGGG - Intronic
1136075933 16:27817232-27817254 CTGTGGCAGGGGTGGGTGTCAGG + Intronic
1136269820 16:29141820-29141842 CTGTGGCATGGGGGGGTGGTGGG + Intergenic
1136512035 16:30744012-30744034 CTGTGACAGCAGTGGTTGGAAGG + Intronic
1136751371 16:32638322-32638344 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1137399475 16:48141603-48141625 CTGTGGCAGAGATGGGTGGTAGG - Intronic
1137713488 16:50583410-50583432 CCTTGGTAGGGGTGGCTGGAAGG - Intronic
1140409047 16:74730300-74730322 CTGTGGCAGGGGTGGGGGTTGGG + Intronic
1140913064 16:79470769-79470791 CTGTTGAATGGGTGGATGGATGG + Intergenic
1141350834 16:83294397-83294419 CAGGGGCTGGGGTGGTTGCAGGG - Intronic
1141473461 16:84255179-84255201 CATTGGCAGGGATGGCTGGAAGG + Intergenic
1141568578 16:84920435-84920457 CTGTGGCTGGGTTGCTGGGATGG - Intronic
1142007157 16:87694898-87694920 CTGTGGCAGCCGCGGTTGCACGG + Intronic
1142073441 16:88103780-88103802 CCGTGGCATGGGGGGTTGGTGGG + Intronic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1203053505 16_KI270728v1_random:897577-897599 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1142558181 17:793750-793772 CTGGGGGAGGGGTGTTTGCAGGG + Intergenic
1142605449 17:1078721-1078743 ATGTGGCCGGGGAGGTTAGAGGG - Intronic
1143197818 17:5089650-5089672 CTTGGGCAGGGGTGGGTGGGAGG - Intronic
1143451911 17:7041762-7041784 CTGGGGGAGGCGTGGCTGGAGGG + Exonic
1143575459 17:7790040-7790062 CTTTGCCAGGGATGGTTTGAAGG + Intronic
1143585874 17:7849965-7849987 CTCTGGCAGGGGTGGTTCTGAGG - Intronic
1143621782 17:8084911-8084933 CTCTGGCAGGGGTGGGTGCAAGG + Intronic
1143974765 17:10821634-10821656 CTGTGCCATGGGGGTTTGGAGGG - Intergenic
1144078128 17:11737322-11737344 CGGTGGGAGGGGTGGGTGGGGGG - Intronic
1144697594 17:17315685-17315707 GGGTGGCAGGGGTGGGTGGAGGG + Intronic
1146078728 17:29757770-29757792 CAGTGGCAGGGGTGGGGGGTGGG + Intronic
1146696395 17:34911800-34911822 CTGTGGCAGGAATGGGAGGAAGG - Intergenic
1148031119 17:44621792-44621814 GTGTGGCAGGGCTGGTTAGATGG - Intergenic
1148084755 17:44987435-44987457 CTCTGACAGGGGAGGTGGGATGG + Intergenic
1148350454 17:46938104-46938126 CTCTGGGAGGGGTGGGTGGGAGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1151323995 17:73367872-73367894 GTGAGGCAGGAGTGGGTGGATGG - Intronic
1151329840 17:73400320-73400342 GTGTGGAAGGGTTGGTTGGGAGG - Intronic
1151412040 17:73937366-73937388 ATGTGGCAGGAGTAGTTGGGTGG + Intergenic
1151979409 17:77499731-77499753 GAGTGGCAGGGGTGGCTGGCTGG - Exonic
1152073881 17:78147163-78147185 CTTTGGCTGGGCTGTTTGGAGGG + Intronic
1152228413 17:79103076-79103098 CAGTGGCAGGGCTGGTTGGTTGG + Intronic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152394420 17:80023733-80023755 CTGTGGCCGGGGTGGTGGGAGGG - Intronic
1152408845 17:80111974-80111996 CTCTTCCAGGGGTGGTTGGGGGG + Intergenic
1152829423 17:82488047-82488069 CTGTACCAGGAGTGGCTGGAGGG + Exonic
1153070239 18:1097453-1097475 CTTAGGAAGTGGTGGTTGGAAGG + Intergenic
1154316877 18:13311274-13311296 CTTTGTCAGGGGTGGATGGTGGG + Intronic
1154357571 18:13633498-13633520 CTGAGGCAGGGGTGGGCTGAGGG - Intronic
1157689407 18:49668824-49668846 AAGTGGCAGGGGTGGGTGGGTGG + Intergenic
1157725155 18:49958580-49958602 AGGAGGCAGGGGTGGGTGGATGG - Intronic
1159471332 18:68860528-68860550 GTGTGGCAGGGGTGTAGGGAGGG - Intronic
1161006072 19:1937437-1937459 CTGAGGCCGGGTTGGCTGGAGGG - Intergenic
1161262101 19:3343824-3343846 CTGGGACAGGGGTGGGTGGGTGG - Intergenic
1161287464 19:3476399-3476421 CTGATGGATGGGTGGTTGGAGGG + Intronic
1161341061 19:3742560-3742582 CCGGGACAGGGGTGGGTGGATGG + Intronic
1161707776 19:5830078-5830100 CTGTGGCAGGGGAGCTTCGGGGG - Intergenic
1162112052 19:8404639-8404661 CTGTGGCAGGGAGGGATGGAAGG + Intronic
1162957439 19:14107139-14107161 CGTTGGGAGGGGTGGTGGGATGG + Intronic
1163272443 19:16262374-16262396 CTGTGGCAAGGGTGCCTGGGTGG - Intergenic
1163314986 19:16535575-16535597 CTGTGGCAGGGGTGGCATGGTGG + Exonic
1163496247 19:17648014-17648036 CTGTGGAGGGGGGGATTGGAAGG - Intronic
1163586273 19:18165800-18165822 CTTTGTTAGGGGTTGTTGGAAGG + Intronic
1163633411 19:18428036-18428058 CTGTGGCTGGGGAGGTGGGGTGG + Intronic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1165164500 19:33842047-33842069 CTGTTTCAGGGGTAGCTGGAGGG - Intergenic
1167293272 19:48635875-48635897 CTGGGGCAGTGGTGGGCGGAGGG - Exonic
1167402081 19:49279594-49279616 CTGTGGCAGCTGCGGTTGGCTGG + Intergenic
1167796462 19:51712931-51712953 CTGGGGCAGGGTTGGTGTGAGGG - Intergenic
1168588681 19:57614955-57614977 CAGTGGCAGGAGGGGTTGGGTGG + Intronic
925155735 2:1647957-1647979 CAGAGCCAGGGGTGGATGGACGG - Intronic
925166405 2:1718632-1718654 CTGTGGCAGGTTTGGGTGGTAGG - Intronic
925904953 2:8534841-8534863 CTGAGTCAGGGGTGCTTGGGGGG + Intergenic
925930360 2:8702463-8702485 CTGTTGCAGGAGTGGTGGCAAGG - Intergenic
925969258 2:9095686-9095708 TGGTGGCAGGGGTGGTGGCAGGG - Intergenic
925969263 2:9095698-9095720 TGGTGGCAGGGGTGGTGGCAGGG - Intergenic
926126680 2:10276648-10276670 CTGGCCCAGGGGTGGGTGGAGGG - Intergenic
926515057 2:13832974-13832996 CTGGGGCAGGGGTGGGGGGAGGG + Intergenic
926703502 2:15819885-15819907 CTGTGGCTGGGGCTGTGGGAGGG + Intergenic
926767125 2:16331194-16331216 CTGTGGCAGGTCTGGGTGCATGG - Intergenic
927893981 2:26769680-26769702 CTGAGGCAGAGGTGGCTGGAGGG - Intronic
928170064 2:28997921-28997943 CTGGGGCAAGCGGGGTTGGAGGG + Intronic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
929576821 2:43057325-43057347 CTGTGGCCAGGGTGGCTGGGTGG - Intergenic
929737472 2:44565175-44565197 CTATGGCAAGGGTGGCTTGATGG + Intronic
930149213 2:48041255-48041277 CTGTTGGAGGGGTGAGTGGAGGG - Intergenic
930909237 2:56610840-56610862 CTGTGGCTCTGGTGGTTGAAGGG - Intergenic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
932417600 2:71583309-71583331 CTGTGGCAGGGCTGTTGGAAGGG - Intronic
932654132 2:73593745-73593767 CTGTGGCAGAGGTGGGAGGCTGG - Intronic
932776554 2:74531389-74531411 CTGGGGCAGGGATTCTTGGAAGG - Intronic
933648680 2:84831855-84831877 CTGTGTCAGACGTGGTTGGCAGG - Intronic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933816702 2:86074380-86074402 CAGTGGCAGCAGTTGTTGGAGGG - Intronic
934501975 2:94869237-94869259 CTGTGACAGGGAGGATTGGAGGG - Intergenic
934919876 2:98334198-98334220 CTGTGGCAGGGGTGGGGGTGGGG + Intronic
936796255 2:116208143-116208165 CTGAGGCCAGGGTGATTGGACGG - Intergenic
937074293 2:119089779-119089801 CTGTGGGAGATGTGGTGGGACGG - Intergenic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937253865 2:120541162-120541184 CTCTGGCAGGAATGGCTGGAGGG + Intergenic
938036064 2:128035946-128035968 TTTTGGGGGGGGTGGTTGGAGGG - Intergenic
938287240 2:130128551-130128573 CTGTGGAGGGGGTGGTTGGGGGG - Intronic
938314290 2:130315403-130315425 CTGTGGCAGGGATGATTGGAGGG + Intergenic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
938469182 2:131544002-131544024 CGGTGGCGGGGGTGGTGGGCGGG + Intergenic
938469260 2:131544322-131544344 CTGTGGAGGGGGTGGTTGGGGGG + Intergenic
938680369 2:133683766-133683788 GTGTGGCAGGGGTTGTTGTGGGG - Intergenic
939005570 2:136782607-136782629 CTGAGGCTGGGGTGGTTGGGGGG + Intronic
939678646 2:145103683-145103705 CTAGGGCAGGGGTGTTTGGGGGG + Intergenic
939849944 2:147292447-147292469 AGGTGGCAGGGCTGGTGGGAGGG - Intergenic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
941723445 2:168836647-168836669 CTGTGCCAGGAGTGTGTGGATGG - Intronic
941840406 2:170076856-170076878 CTATGGTAGGGGTGGTGGTAGGG + Intronic
944821924 2:203440555-203440577 CCATGGCAGGGGGAGTTGGAGGG + Exonic
945877556 2:215294332-215294354 TTGTAGCAGGGTTGGTTGGTGGG - Intergenic
946179180 2:217939802-217939824 ATGTGGGAGGGGTGGTGGGTGGG - Intronic
947735333 2:232451732-232451754 CAGTGGCAGGGGTGGCTGGCAGG - Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948178489 2:235961992-235962014 CTGGGGCAGGGCGGGGTGGAGGG + Intronic
948210541 2:236189956-236189978 GGGTGGAAGGGGTGGCTGGAGGG + Intergenic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948734735 2:239994616-239994638 CTGGGGCGGGGATGGGTGGATGG - Intronic
948776725 2:240293045-240293067 CTGTGGCTGGGGTGACTGGGTGG + Intergenic
949009233 2:241669030-241669052 GTGGTGCAGGGGTGGGTGGAGGG - Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169589766 20:7127499-7127521 ATGTGGGAGGTGTGATTGGAAGG + Intergenic
1170594143 20:17792845-17792867 CTGAGGGAGGGGAGGTTGGGTGG - Intergenic
1170735585 20:19011438-19011460 CCTTGGCAGGGATGGCTGGAAGG + Intergenic
1170794439 20:19533993-19534015 CTGGGGCAGTGGTGTTTGCAGGG + Intronic
1171371647 20:24666111-24666133 CTGAGGCTGGGGTGGTGTGAAGG - Exonic
1172530375 20:35626851-35626873 GTGTGGCTGGGGTGTTTGCAGGG - Intronic
1173034045 20:39391354-39391376 CTGTGGCTGGAGTGGATCGAAGG + Intergenic
1173190912 20:40875069-40875091 CTGGGGCTGGGCTGGTGGGATGG - Intergenic
1173385536 20:42584024-42584046 CCTTGGCAGGGATGGCTGGAGGG - Intronic
1173801809 20:45898832-45898854 CTGTGGCACTGGGGGTTAGAGGG + Exonic
1173940166 20:46904183-46904205 CTGTTCCTGGGGTGGTTGGGAGG + Intronic
1175398661 20:58686168-58686190 CTGTGGCAGGGCTGGCTTCAAGG + Intronic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1175967081 20:62665198-62665220 CTCTGGCAGCGGGGGTGGGAGGG - Intronic
1175985150 20:62760870-62760892 CTGCGGCGAGGGTGGTGGGAGGG - Exonic
1176231815 20:64036762-64036784 CTGTGGCGTGTGTGGTTGGGGGG + Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1178639250 21:34332952-34332974 CTGGGGCAGGGGAGGTTTAAAGG + Intergenic
1179041829 21:37809930-37809952 CAGTGACAGGGGTGGTGGGTTGG - Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179800518 21:43809645-43809667 CTGCGGCAGGGGTGAGGGGAGGG + Intergenic
1180019027 21:45108615-45108637 ATGTGGGTGTGGTGGTTGGAAGG - Intronic
1180137866 21:45872701-45872723 CTGTGGCTTCGGTGCTTGGAGGG + Intronic
1180869996 22:19140600-19140622 TGGTGGCAGGGTTGGTCGGAGGG - Intronic
1181058296 22:20270143-20270165 CTGCGGCAGGAGGGGTGGGAGGG - Intronic
1181267753 22:21640918-21640940 CTGGGGGAGGGGTAGTTTGAGGG + Intergenic
1181632749 22:24159839-24159861 CTGTGGACGGGGTGGCTGGCAGG - Intronic
1182047339 22:27285714-27285736 GTGTGGAATGGATGGTTGGATGG + Intergenic
1182302129 22:29342860-29342882 ATGTGGCAGGGGCCGGTGGAGGG - Intronic
1182321666 22:29481738-29481760 CTGTGGCGGAGGTGGCTGGTGGG + Intronic
1182685779 22:32121044-32121066 CAGTGGCAGGGGTGGAGGGACGG - Intergenic
1183099866 22:35577194-35577216 CTCAGGCAGTGGTGGTCGGAGGG + Intergenic
1183106556 22:35619068-35619090 CTGTGAGAGGGATGGATGGATGG - Intronic
1183191311 22:36323607-36323629 CTGTGGCAGGTGTGCTTGTAAGG - Intronic
1183212022 22:36457121-36457143 CGGGTGCAGGGGAGGTTGGAAGG - Intergenic
1183464811 22:37974154-37974176 CTGTCTTCGGGGTGGTTGGAGGG + Exonic
1183664810 22:39241222-39241244 GTGAGGCAGGGCTGGGTGGAGGG - Intronic
1183816779 22:40308534-40308556 CTATGGCATGGTTGGTGGGAAGG + Exonic
1184744631 22:46449174-46449196 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184744666 22:46449346-46449368 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184744673 22:46449377-46449399 ATGTGTGATGGGTGGTTGGATGG - Intronic
1184744680 22:46449408-46449430 CTGTGTGATGGGTGGTTGGATGG - Intronic
1185276407 22:49951825-49951847 CTGGGGCAGGGCCAGTTGGAAGG + Intergenic
1185370065 22:50456769-50456791 CCAGGGCAGGGGTGGTTGGCAGG + Intronic
1185413849 22:50699312-50699334 CTGGGGCAGGGATGGTCTGAGGG + Intergenic
949891727 3:8738266-8738288 CTGTGGCAGATGTGGGTGGAGGG - Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950333543 3:12176110-12176132 GTGTAGGAGGGGTGGTGGGAAGG - Intronic
950550131 3:13661308-13661330 CCGGGGCCGGGGTGGTGGGAGGG + Intergenic
950714870 3:14840741-14840763 CTGTGGTGGGGTTGGTTGGTTGG - Intronic
950941667 3:16898908-16898930 CTGTGGCAGGGGTTGGAGGGTGG + Intronic
950968809 3:17166267-17166289 CTGTGGCAGGGGTCCATAGAGGG - Intronic
951760650 3:26143985-26144007 CATTGGCAGGGGTGGCTGGAAGG - Intergenic
952419039 3:33114664-33114686 CTTTGGCAGGGCTGGATGGGAGG - Intronic
952536233 3:34312355-34312377 CTGAGGCAGGGGTGATAGGGAGG - Intergenic
952902741 3:38120781-38120803 ATGAGGCAGGTGAGGTTGGATGG - Intronic
953167959 3:40482144-40482166 CAGTGCCAGGGGTAGCTGGATGG + Intronic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
956250812 3:67231868-67231890 CTGTGGCAGCCATGGTTGGCTGG - Intergenic
958144096 3:89601677-89601699 TTGAGACAGAGGTGGTTGGAGGG + Intergenic
959253040 3:103972523-103972545 CTGGGGCAGGGGTGGAGGGGCGG + Intergenic
960023957 3:112987868-112987890 GTTTGGCCGGGGCGGTTGGAGGG - Intergenic
961166775 3:124769054-124769076 CTGTGGCAGGTCTGGTTGTCAGG + Exonic
962108189 3:132415520-132415542 CTGTAGCAGGGGTAGTTAGAAGG + Intergenic
962326186 3:134434521-134434543 CTGAGGCTGGGGTGGTGGGAGGG - Intergenic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
964386698 3:156155213-156155235 CTGTGTGAGGGGTGGTGGCAGGG - Intronic
964477314 3:157108827-157108849 CTGTGCCAGGGCTGTTTGGAGGG - Intergenic
964812724 3:160683176-160683198 TTGAGGCAGGTGTGGCTGGATGG - Intergenic
965157839 3:165087492-165087514 TTGAAGCAGGGGTGGTTGTAAGG - Intergenic
965256364 3:166418616-166418638 CTGGGGCAGGGCTGGGAGGAGGG - Intergenic
967098167 3:186194148-186194170 CTGAGCCACGGGTGGTTGGTTGG + Intronic
967294974 3:187955774-187955796 CTTGGGGATGGGTGGTTGGAGGG - Intergenic
968524916 4:1051696-1051718 CTGTGGACGTGGTGCTTGGATGG + Intergenic
968581198 4:1396181-1396203 TTGTGGCAAGTGTGGGTGGAAGG - Intergenic
968757665 4:2425400-2425422 CAGTGTCAGTGGTGGTTGGTGGG + Intronic
968811266 4:2800621-2800643 CCGTGCCAGGGGTGGGTGCAGGG + Intronic
969125339 4:4943805-4943827 CTGAGGCAGGGGTTGTGGGGTGG + Intergenic
969126474 4:4951932-4951954 ATGTGGCAGGGTTGGGTGCAGGG - Intergenic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969365547 4:6692257-6692279 CTCTGGCTGGGGTGGTATGATGG + Intergenic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969526254 4:7705630-7705652 CTGTGGCAGGTGTGGATCTATGG + Intronic
969538597 4:7771851-7771873 CTGGGGCAGGGATGGGGGGATGG + Intronic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
969724346 4:8910506-8910528 CAGTGGCAGGGGTGGGGGGGCGG + Intergenic
970492144 4:16585310-16585332 CAATGGCAGGGGTGTTAGGATGG + Intronic
971337637 4:25738790-25738812 CTGAGGCAGGGGTTGTGAGAGGG - Intergenic
972323110 4:37991052-37991074 CTGGGGCGGGGGTGGGTGGGGGG + Intronic
972971679 4:44583541-44583563 CTGTGGCATGTGTGGGTGGCAGG - Intergenic
975966104 4:79973980-79974002 CTGTGGTTGGTTTGGTTGGATGG + Intronic
976075044 4:81288370-81288392 CTGTGGGAGGGGTGAAGGGAAGG - Intergenic
976297891 4:83489917-83489939 CTGTGGCAGGGAAGGTTAGAGGG - Intronic
976369149 4:84267059-84267081 CTGTGGCAGGGGAGATTGCATGG + Intergenic
976609126 4:87011149-87011171 CTGGGGCAGGGGTGTATGCATGG + Intronic
976930719 4:90563449-90563471 CAAGGGCAGGAGTGGTTGGAGGG - Intronic
977768616 4:100830477-100830499 CATTAGCCGGGGTGGTTGGAAGG - Intronic
977937440 4:102823366-102823388 CAGTGGAAGTGGTGGTAGGAGGG + Intronic
978435731 4:108682260-108682282 GTGAGGCAGGGGTGGTGGGAGGG + Intergenic
978852225 4:113352929-113352951 CTGTGGTGGTGGTGGTGGGAGGG - Intronic
978904814 4:113993647-113993669 CTGGGGCAGGGATGGTGGGGTGG - Intergenic
979840552 4:125434785-125434807 CCTTGGCAGGGTTGGTTGGAAGG + Intronic
980873636 4:138638574-138638596 CTGTGGCAGGAGTGGGGAGATGG - Intergenic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
981689341 4:147489668-147489690 CTGTGGCATGGAAGGTGGGATGG + Intronic
982162055 4:152580107-152580129 CTGTGACAGAGGGGGCTGGATGG + Intergenic
984991769 4:185387882-185387904 CTGAGGCAGGGGTGGAATGAAGG + Intronic
985393481 4:189515835-189515857 GTGTAGCAGGTGTGGTGGGATGG + Intergenic
985649752 5:1101955-1101977 CTGTGGCTGGGGGGCTTGGCAGG - Intronic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
987068049 5:14308781-14308803 CTGTAGGATGGGTGGTTGGTTGG - Intronic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
988837175 5:35044849-35044871 CTGTGGCAAGGCTGCCTGGAGGG + Intronic
989035669 5:37169205-37169227 CTGTGGCAGAGCAGGTTGGAAGG + Exonic
989125010 5:38044598-38044620 CTGGGGGAGGGGGGGTGGGAAGG - Intergenic
989210627 5:38855690-38855712 CGGTGGCAGTGGGGGTTGGGGGG - Intronic
990205774 5:53427584-53427606 CTAAGGGTGGGGTGGTTGGAGGG - Intergenic
990662623 5:58034520-58034542 CTGTGGGAGGTGGGTTTGGAGGG - Intergenic
991008986 5:61861956-61861978 CTGTGGCAGGAAGAGTTGGAAGG - Intergenic
992950176 5:81850852-81850874 CTGTCGTGGGGGTGGGTGGACGG - Intergenic
992995644 5:82329687-82329709 CTTTGGCAGGGGTCGGGGGAGGG + Intronic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995124101 5:108563149-108563171 CTGATGCAGGGGTGGGTGGTAGG - Intergenic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
995956200 5:117779188-117779210 GTGTGGCGGGGGTGGGTGGTGGG + Intergenic
996047903 5:118896853-118896875 CTTTGGCAGGGATGGGTGAAAGG - Intronic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
996425835 5:123312897-123312919 CACTGGCAGGGGTGGCTGGAGGG + Intergenic
996831416 5:127744245-127744267 CTGAGGCATGGGTGGTAGGTTGG + Intergenic
996950530 5:129120291-129120313 CCTTGGCAGGGATGGCTGGAAGG + Intergenic
997438525 5:133892374-133892396 CAGGGGCAGGGGTGGGTGGATGG - Intergenic
997472397 5:134124171-134124193 CTTTGGCAGGGGTGGAGGGTGGG + Intronic
997584720 5:135037562-135037584 ATTTGGGAAGGGTGGTTGGAAGG + Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998449202 5:142221177-142221199 CTGGGGCTGGGGTGGTAGGGTGG + Intergenic
998668357 5:144324920-144324942 CTGTGGCAGGGGTGAAGGGAGGG + Intronic
999190406 5:149742886-149742908 GTGTGGCTGGGGTGGGTGGTGGG + Intronic
999384436 5:151144406-151144428 CTGGGGCAGGGGTGTGTGGGCGG + Intronic
999637622 5:153639258-153639280 GTGTGGCATGGGTGCCTGGAGGG - Intronic
1001012541 5:168111426-168111448 CGGTGGCAGGGGTTGGGGGAGGG + Intronic
1001132278 5:169074096-169074118 CTGGGGCAGTGGTGGATGGAGGG + Intronic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1004263472 6:14129071-14129093 CTGAGGGAGGGGTTGCTGGATGG + Intronic
1005006132 6:21289328-21289350 CTTTGGAAGGGGTGGATTGAGGG + Intergenic
1006638649 6:35477321-35477343 CGGCGGCAGGGGCGGCTGGATGG + Exonic
1006830637 6:36965894-36965916 TTGGGGCTGGGGAGGTTGGAGGG - Intergenic
1007179156 6:39915838-39915860 CTGGGGCTGGGGTGGTGGGGAGG + Intronic
1007715166 6:43851450-43851472 CTGGGGCTGGGGTGGTCGCAGGG + Intergenic
1008700723 6:54096424-54096446 CTGTGGAAGGTGTGGTTGGCAGG + Intronic
1009390610 6:63139501-63139523 GTGGGGGAGTGGTGGTTGGATGG - Intergenic
1009847306 6:69150374-69150396 CTGTGGCAGTGGTGTTTGTGGGG - Intronic
1010026268 6:71221367-71221389 CTGTCTCAGGGGTGGTGGGGGGG - Intergenic
1010108281 6:72193150-72193172 TGGTGGCATGGGTAGTTGGAGGG + Intronic
1010557105 6:77296028-77296050 CAGAGGCTGGGGTGGTTGGCAGG - Intergenic
1011430049 6:87275780-87275802 ATGGGGCAGGGGTGGTTGTGAGG - Intergenic
1012637186 6:101558566-101558588 ATGTGGTAGGGGTGGGTGTATGG + Intronic
1016317697 6:142808471-142808493 ATGTGGGAGGGATGGATGGATGG + Intronic
1016374489 6:143406476-143406498 GTGGGGCAGTGGGGGTTGGAAGG + Intergenic
1017188643 6:151628055-151628077 CTGATGCAGTGCTGGTTGGAAGG + Intergenic
1017519643 6:155190475-155190497 CTGTGACAGGGATGGCTGGTGGG + Intronic
1017618441 6:156270099-156270121 CTGTGGCAGAGGTGGCTTGGGGG - Intergenic
1019524799 7:1476113-1476135 CAGTGACAGGGGTGGGTGGACGG + Intronic
1019657017 7:2201310-2201332 TTGTGACAGGGCTGGTAGGAGGG - Intronic
1019709459 7:2511669-2511691 CTGGGGCTGGGGTGGAGGGAGGG - Intergenic
1019762398 7:2823137-2823159 CTATGGCAGGCTTTGTTGGAGGG + Intronic
1020896300 7:13944547-13944569 CTGGGGCGGGGGTGGTGAGACGG + Intronic
1021024246 7:15643996-15644018 TGGTTGCAGGGGTGGCTGGAAGG + Intronic
1021815057 7:24438778-24438800 CTGTGGTGGGGATGGCTGGAAGG - Intergenic
1022090554 7:27105291-27105313 CTGAGGGAGGGGTGGTTTGGAGG - Intergenic
1022484731 7:30769753-30769775 ATGTGCCAGTGGTGGTTGTAAGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1023307691 7:38848708-38848730 GTGTGGCAGGGCTGGCTGGCTGG + Intronic
1023565191 7:41517098-41517120 AAGTGGCTGGGGTGGTGGGAAGG - Intergenic
1023582948 7:41701219-41701241 CTGTGGCTTGGCTGGGTGGAGGG - Intronic
1024265902 7:47606256-47606278 CTGTGGCAGGGGTGGGGTAAGGG + Intergenic
1024628749 7:51230514-51230536 GTGGAGCAGGGGTGGTGGGAAGG - Intronic
1027561138 7:79731957-79731979 CTGTGGCAGGCCTGGTTTTAGGG - Intergenic
1028577654 7:92370171-92370193 CTGTGGGATGGGTGGCTGGCAGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028617952 7:92791169-92791191 ATGTGGCGGGGGTGGAGGGATGG + Intronic
1028669412 7:93384062-93384084 CTGGGGCAGGGCTGATTGGGAGG - Intergenic
1029234188 7:99099595-99099617 CTGTGGCAGCGGTGGGAGGTGGG + Intronic
1029548593 7:101224278-101224300 CGGTGGCAGGGGTGAGTGGGAGG - Intergenic
1029598160 7:101548656-101548678 CTGGGGCAGGGAGGGTGGGAAGG + Intronic
1030288065 7:107847140-107847162 GTGGGGCAGGGGTGGGAGGATGG + Intergenic
1030289188 7:107855464-107855486 CTTTGGCCGTGGTGGTTGGCAGG + Intergenic
1030587235 7:111435762-111435784 CTGTGGCAGCTGTGATTGGCTGG - Intronic
1031367819 7:120924914-120924936 CAGGGGCAGGGGAGGTTTGAGGG - Intergenic
1032075614 7:128834468-128834490 GTGGGGCAGGGGTGGGTGGGTGG - Intronic
1032581195 7:133105138-133105160 CTGGGGCGGGGGTGGGTGGAGGG - Intergenic
1032803065 7:135331946-135331968 CTGTGGCTTGGGTGGTTTGTTGG - Intergenic
1033150509 7:138910794-138910816 CTGAGGCAGAGGAGGTTGGGAGG - Intronic
1033607531 7:142938355-142938377 CTTGGGCAGAGATGGTTGGAGGG - Intergenic
1034176531 7:149104405-149104427 GTGTGGCAGGCGAGCTTGGAAGG + Exonic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1035057136 7:156043267-156043289 CTGTGGCTGGGAAGTTTGGAAGG - Intergenic
1035203710 7:157281608-157281630 CTCGGGCAGGAGTGGGTGGAGGG - Intergenic
1035258414 7:157646708-157646730 CTGTGGCTTGGGTGGCTGCATGG + Intronic
1035470339 7:159105275-159105297 CTGTGCCAGGAGTGCATGGAGGG - Intronic
1036616083 8:10388855-10388877 CAGTGGCAGGGGTGGGTCGCAGG - Intronic
1036753676 8:11458504-11458526 CTGGGGCAGGGGTGATGGGCAGG - Intronic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1037018348 8:13936859-13936881 CTGTGGGTGGGGTGGAGGGAGGG - Intergenic
1037401790 8:18501441-18501463 CAGGGGCAGGGGTGGTTGATGGG + Intergenic
1037769261 8:21789333-21789355 CAGGGGCAGTGGGGGTTGGAGGG - Intronic
1038781951 8:30575625-30575647 CTGTGGGAGTTGTGGTGGGATGG - Intergenic
1039101734 8:33948710-33948732 CTGTTGGAGTGGTGGCTGGAAGG + Intergenic
1039720526 8:40159487-40159509 CTGTGCCAGGGCTGGCTGGCTGG + Intergenic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1040899264 8:52402105-52402127 TTGTGGCAGTGGTGGTGGCATGG + Intronic
1041364644 8:57089133-57089155 CTGTTGGAGGGGTGGGGGGAGGG - Intergenic
1042177832 8:66054877-66054899 CTGGGGTAGGGGAGGTGGGAGGG + Intronic
1042708408 8:71687394-71687416 GCCTGGCAGGGGTGGTTGAATGG + Intergenic
1043404622 8:79917635-79917657 CTTTGGCAGGGGTGCTTGAAAGG - Intergenic
1043769873 8:84184647-84184669 CCGTGGGAGGGGTGGGGGGAGGG - Intronic
1044541354 8:93411921-93411943 GTGTGGCAGGGGTGTAGGGAGGG - Intergenic
1046041527 8:108911649-108911671 GTGTGGCAGGTGGGGTGGGAGGG - Intergenic
1046082941 8:109394507-109394529 CTGTTGCGGGGGTGGTGGGAAGG + Intronic
1047183812 8:122614172-122614194 CTGTGGTTGGGGTGGTGGGGGGG + Intergenic
1047253346 8:123197107-123197129 CTGGGGCAGGGGTGGCAGAAGGG + Intronic
1047358262 8:124143771-124143793 CATTGGAAGAGGTGGTTGGATGG + Intergenic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1048799428 8:138182419-138182441 GTGTGGCAGGCGTGGATGGCAGG - Intronic
1049258476 8:141626256-141626278 ATGAGGAAGGGGTGGATGGATGG + Intergenic
1049698298 8:143994344-143994366 GTGAGGCAGGGGAGGTTGGGAGG - Intronic
1049711963 8:144068849-144068871 CTGTGGCAGGTGTTGGGGGACGG - Intergenic
1050131988 9:2422432-2422454 CTGTGTCAGGGAGGGCTGGAAGG + Intergenic
1051741718 9:20258884-20258906 CTGTAGCATGGATGGATGGATGG - Intergenic
1053023936 9:34715246-34715268 TGGTGGCAGGGGTGGTGAGAGGG + Intergenic
1053411650 9:37919739-37919761 CAGTGGCTGGGCTGGTTGGTGGG + Exonic
1055111721 9:72566500-72566522 CTGTTTCAGGTGGGGTTGGAGGG + Intronic
1055429984 9:76233530-76233552 CTCTGGCAGGTGTGGTGGCATGG - Exonic
1055752138 9:79518406-79518428 GTGAGGCAGGAGTGGTTGGCAGG + Intergenic
1056517914 9:87372431-87372453 CTGTGGGAGGTGGGGTTGGAAGG - Intergenic
1056756640 9:89385868-89385890 CCTTGGCAGGGGTGGGTGGGCGG - Intronic
1056805259 9:89723635-89723657 GTGTGGCTGGGATGGTTGCATGG - Intergenic
1057444490 9:95104146-95104168 GAGAGGCAGGGGTGGTGGGAGGG + Intronic
1057569101 9:96190264-96190286 CCTTGGCAGGGGTGGTTGGAAGG + Intergenic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1058100546 9:100914292-100914314 CTGTGGCAGCTGTGGTTGGCTGG + Intergenic
1058526811 9:105867322-105867344 CTGTGGCCGGGGTGGGTGTGGGG + Intergenic
1058629126 9:106968529-106968551 ATGTGTCAGGGTTGGTTGGTTGG + Intronic
1058687209 9:107489496-107489518 CTGTGGCCGGGGCGGTGGGCGGG + Exonic
1059045079 9:110857919-110857941 ATGGGGCATGAGTGGTTGGAAGG - Intergenic
1059923954 9:119187387-119187409 TTGTGGCAGTGGTGGTGGCAAGG - Intronic
1060242402 9:121915096-121915118 CACTGGCAGTGGTGGTGGGAGGG + Intronic
1060823349 9:126673765-126673787 CTTGTGCAGGGGTGGTGGGAGGG + Intronic
1060912798 9:127364085-127364107 TTGGGGGTGGGGTGGTTGGAGGG - Intronic
1061055670 9:128221567-128221589 CTGAGGCAGGGGTGGCCAGAGGG - Intronic
1061403571 9:130381744-130381766 CTGGGGCTGTGGTGGTTGGCGGG - Intronic
1061962951 9:133997805-133997827 ATGTGGGAGGGATGGATGGAAGG - Intergenic
1061963117 9:133998296-133998318 ATGTGGGAGGGATGGATGGAGGG - Intergenic
1062631051 9:137463340-137463362 CTGTGGCAGGGGCCGTGGGGCGG + Intronic
1185583364 X:1227375-1227397 CTGAGGAATGGGTGGATGGATGG + Intergenic
1186357396 X:8801672-8801694 AAGGGGCAGGGGTGGCTGGAAGG - Intergenic
1187681189 X:21769448-21769470 CCTTGGCAGGGGTGGCTGGAAGG + Intergenic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189232910 X:39466090-39466112 TGGTGGCAGGGGTGGTTGGGGGG - Intergenic
1190596783 X:52059814-52059836 CTGGGGCAGGGGTGATCAGAGGG + Intergenic
1190612041 X:52194259-52194281 CTGGGGCAGGGGTGATCAGAGGG - Intergenic
1193067574 X:77275739-77275761 CTGTGGCAGTGGTGGTGGTGGGG - Intergenic
1193482118 X:82039841-82039863 CAGAGGCTGGGGCGGTTGGAAGG + Intergenic
1193482130 X:82039998-82040020 CAGAAGCTGGGGTGGTTGGAAGG - Intergenic
1194288593 X:92040119-92040141 CTGGGGCTGGGGGGATTGGAGGG + Intronic
1196741094 X:119026704-119026726 CTGTCAGAGGGGTGGTGGGAGGG + Intergenic
1197605394 X:128579587-128579609 CTGTGGTAGAGCTGGTGGGAAGG - Intergenic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1198125204 X:133636986-133637008 GTTGGGCAGGGGTGGTGGGAAGG - Intronic
1199233706 X:145467753-145467775 CTGTGGCAGTGGTGCGTGGCTGG - Intergenic
1200116701 X:153772690-153772712 ATGCGGCAGGGGTGGGTGGGAGG + Intronic
1200606114 Y:5264684-5264706 CTGGGGCTGGGGGGATTGGAGGG + Intronic
1202036418 Y:20641393-20641415 CTGTTGGCGGGGTGGTGGGAGGG - Intergenic