ID: 1175751397

View in Genome Browser
Species Human (GRCh38)
Location 20:61500410-61500432
Sequence CCCTCTCCACGCCCGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175751397_1175751401 13 Left 1175751397 20:61500410-61500432 CCACATCACGGGCGTGGAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1175751401 20:61500446-61500468 GCAGTGTCTTTCCACCTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 133
1175751397_1175751399 9 Left 1175751397 20:61500410-61500432 CCACATCACGGGCGTGGAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1175751399 20:61500442-61500464 AAATGCAGTGTCTTTCCACCTGG 0: 1
1: 0
2: 1
3: 17
4: 187
1175751397_1175751400 10 Left 1175751397 20:61500410-61500432 CCACATCACGGGCGTGGAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1175751400 20:61500443-61500465 AATGCAGTGTCTTTCCACCTGGG 0: 1
1: 0
2: 1
3: 25
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175751397 Original CRISPR CCCTCTCCACGCCCGTGATG TGG (reversed) Intronic
900830040 1:4959398-4959420 TCCTCTCCACTCCCGGGAAGGGG + Intergenic
903450420 1:23450035-23450057 CCCTATCCCTGCCTGTGATGGGG - Intronic
905155202 1:35972185-35972207 CCCTGTCCATGCCGTTGATGTGG + Exonic
913200365 1:116491111-116491133 CTCTCTCCACACCCTGGATGGGG - Intergenic
919820371 1:201468597-201468619 CGCACTCCACGGCCTTGATGCGG + Exonic
920123413 1:203675454-203675476 CCCCCTCCAGGCCCTGGATGAGG + Intronic
923694029 1:236228758-236228780 TCCTCTCCACGCTCCAGATGAGG + Intronic
1070777806 10:79120016-79120038 CCCTCTCCACGCCACTGTTATGG - Intronic
1070800141 10:79240320-79240342 CCCGCTCCACCCCCTTGATAAGG - Intronic
1073552313 10:104414952-104414974 CACTCCCCACGCCCGTGAATGGG + Intronic
1077301622 11:1849911-1849933 CCTTCTCCACGACGGTGATGTGG + Intergenic
1079135852 11:17775682-17775704 CCATCTCCGCTCCTGTGATGTGG + Intronic
1085525253 11:77160204-77160226 CCGTCTCCCCGCGGGTGATGAGG - Exonic
1091567509 12:1659918-1659940 CCAGCTCCACGTCCCTGATGTGG - Intergenic
1092881877 12:12893020-12893042 ACCTCTCCACGCCCTTGGAGAGG - Intronic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1116836022 14:49769435-49769457 CCCTCCCCACGCCCGTGCCTTGG + Intronic
1123203484 14:106691187-106691209 CCCTCCCCAGGCACCTGATGTGG + Intergenic
1125300842 15:38252514-38252536 CCCCCTCCACCCCCCTGAGGAGG + Exonic
1129450450 15:75648330-75648352 CCCTCTCCCCGCCCCAGAAGTGG - Exonic
1132568857 16:635409-635431 CCCTCACCCCGACTGTGATGGGG + Intronic
1132568868 16:635443-635465 CCCTCACCCCGACTGTGATGGGG + Intronic
1132568879 16:635477-635499 CCCTCACCCCGACTGTGATGGGG + Intronic
1132568890 16:635511-635533 CCCTCACCCCGACTGTGATGGGG + Intronic
1132690974 16:1181765-1181787 CCCTCTTCAGGCCTGAGATGAGG - Intronic
1132802756 16:1762377-1762399 CCATCTCCACCCGCGTGAAGCGG - Exonic
1135158189 16:20072204-20072226 CTCTCCCCAAGCCAGTGATGAGG - Intronic
1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG + Exonic
1139361739 16:66403731-66403753 CCCTCTCCAGGCCTGTCAAGAGG + Exonic
1142312011 16:89319644-89319666 CCATCTCCATGACTGTGATGAGG - Intronic
1142708549 17:1710791-1710813 CCCTCCCCGCGTCCGTGGTGGGG + Intergenic
1147931527 17:43984222-43984244 CCCTCTGCGCGGCCGGGATGTGG + Intronic
1151749547 17:76028736-76028758 CCCTCTCCACGGCCGAGTTCAGG - Intergenic
1151770816 17:76159464-76159486 CCATCTCCAAGCACGTGAAGTGG + Exonic
1159365878 18:67464893-67464915 CCCACTCCAGGCTTGTGATGGGG + Intergenic
1165427963 19:35756101-35756123 CCCTCTCCCCCGCAGTGATGAGG + Intronic
925085336 2:1103101-1103123 GCCTCTCCACACCCATGACGTGG - Intronic
926358910 2:12066960-12066982 CCCTCTCAACTCCCGTGATAAGG - Intergenic
942058868 2:172209565-172209587 CTCTTTCCACGCCACTGATGAGG - Intergenic
947729577 2:232420524-232420546 CCCCCTGCACGGCAGTGATGGGG + Intergenic
948207902 2:236172673-236172695 CCCTCTCCACTCCAGCGACGAGG + Intergenic
948822773 2:240558213-240558235 CCCCCAACACTCCCGTGATGGGG + Intronic
1168831403 20:847049-847071 CCCTCTCCACGCCCACCGTGGGG - Intronic
1170658475 20:18313871-18313893 CTCTCCCCACGCCAGTGCTGAGG - Intronic
1170669214 20:18415267-18415289 CTCTCTCCAGGCCAGTGGTGAGG + Intronic
1171106463 20:22438248-22438270 CCCTCTCCATGCACTTGTTGGGG - Intergenic
1175751397 20:61500410-61500432 CCCTCTCCACGCCCGTGATGTGG - Intronic
1180069553 21:45429564-45429586 CCCTCTCCAGTCTCATGATGGGG + Intronic
1182705085 22:32271940-32271962 CCTTCTCCTCGCCAGTCATGTGG - Intergenic
1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG + Intronic
1184492133 22:44815841-44815863 CCCACCCCACCCCCGTCATGTGG - Intronic
1184520942 22:44993601-44993623 CTGTCTCCAAGCCTGTGATGGGG - Intronic
1185111894 22:48904963-48904985 CCCTCTCCGTTCCCCTGATGTGG + Intergenic
1185111911 22:48905028-48905050 CCCTCTCCGTTCCCCTGATGTGG + Intergenic
951109806 3:18789621-18789643 CCCTCACCACCCCCGCAATGTGG - Intergenic
952311252 3:32192470-32192492 CCCTCTCCACTCCCAGGCTGTGG + Intergenic
953012401 3:39039715-39039737 CCCTATCCCCTCCAGTGATGAGG + Intergenic
961467629 3:127091188-127091210 TCCTCCCCACCCCAGTGATGTGG - Intergenic
962753622 3:138452050-138452072 CCCGCTCCACGTCCGGGAAGTGG - Exonic
986693509 5:10333038-10333060 CTCTCTCCCCGCGTGTGATGGGG + Intergenic
994824691 5:104698420-104698442 TCCGCTCCAGGCCTGTGATGGGG - Intergenic
996359267 5:122627647-122627669 CCCTCTCCACACTCTTCATGTGG + Intergenic
1002761957 6:209304-209326 GCCTCTCCAGGGCCTTGATGGGG - Intergenic
1004454906 6:15783418-15783440 CCATCTCCGTGCCCATGATGAGG - Intergenic
1006102070 6:31691725-31691747 CCCGCCCCACCCCTGTGATGTGG - Intronic
1007399048 6:41593415-41593437 CCCTCCCAAGGCCCGTGTTGTGG + Intronic
1011954947 6:93015403-93015425 CCCACTCCAGACCTGTGATGGGG - Intergenic
1018618600 6:165709684-165709706 CACTCTCCACCCCCATGCTGCGG + Intronic
1021189354 7:17602450-17602472 CCCACTCCACACCTGTGATGGGG - Intergenic
1030218073 7:107067062-107067084 CCCCCTCCCTGCCAGTGATGTGG + Intronic
1030407554 7:109133311-109133333 CCCACTTCAGGCCTGTGATGGGG - Intergenic
1033452069 7:141471055-141471077 CCCCATCCTCGCCAGTGATGGGG - Exonic
1034716881 7:153251665-153251687 CCGTCTCCACTCCCATTATGAGG - Intergenic
1035732023 8:1860197-1860219 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1035732066 8:1860334-1860356 TCCTCTCCATGCCCCCGATGTGG + Intronic
1035732088 8:1860401-1860423 TCCTCTCCATGCCCCCGATGTGG + Intronic
1035732106 8:1860465-1860487 TCCTCTCCATGCCCCTGATGTGG + Intronic
1037238586 8:16751444-16751466 CTCTTTCCTCCCCCGTGATGTGG + Intergenic
1048989669 8:139753853-139753875 CCCTCTCCTCGCCTGTGTTGTGG + Intronic
1049056262 8:140239594-140239616 TCCCCTCCACGGCCGTGAGGAGG - Intronic
1049714757 8:144084629-144084651 CCCTTTCCATGCCCAGGATGGGG + Intronic
1058506895 9:105675328-105675350 CCTTCTCAACTTCCGTGATGGGG - Intergenic
1059259136 9:112959145-112959167 CTGTCTCCAGGCCCGAGATGAGG - Intergenic
1060531454 9:124349399-124349421 CCCTCTCTACTTCAGTGATGAGG + Intronic
1061052315 9:128203940-128203962 CTCTCTCCATGCCCATGTTGGGG - Intronic
1061269052 9:129526178-129526200 CCCACTCCAAGCCCAGGATGTGG - Intergenic
1062232125 9:135487534-135487556 CCCTCTCCGCTCCCGGGCTGGGG - Exonic
1190748059 X:53338285-53338307 CCCTCTCCCCTCCCCTGAGGTGG + Intergenic
1190798735 X:53769490-53769512 CCCTCTCCCCTCCCCTGAGGTGG + Intergenic
1194444107 X:93966240-93966262 CCCACTCCAGTCCTGTGATGGGG + Intergenic
1195654626 X:107323374-107323396 CCCTCTCCCCACCCGAGAAGAGG + Intergenic
1200121690 X:153794127-153794149 CCCTTTCCCCGCCCCTGGTGGGG + Exonic