ID: 1175751397

View in Genome Browser
Species Human (GRCh38)
Location 20:61500410-61500432
Sequence CCCTCTCCACGCCCGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175751397_1175751401 13 Left 1175751397 20:61500410-61500432 CCACATCACGGGCGTGGAGAGGG No data
Right 1175751401 20:61500446-61500468 GCAGTGTCTTTCCACCTGGGTGG No data
1175751397_1175751399 9 Left 1175751397 20:61500410-61500432 CCACATCACGGGCGTGGAGAGGG No data
Right 1175751399 20:61500442-61500464 AAATGCAGTGTCTTTCCACCTGG No data
1175751397_1175751400 10 Left 1175751397 20:61500410-61500432 CCACATCACGGGCGTGGAGAGGG No data
Right 1175751400 20:61500443-61500465 AATGCAGTGTCTTTCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175751397 Original CRISPR CCCTCTCCACGCCCGTGATG TGG (reversed) Intronic