ID: 1175754791

View in Genome Browser
Species Human (GRCh38)
Location 20:61522653-61522675
Sequence CACGCACGGCGCAGTCCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175754785_1175754791 -8 Left 1175754785 20:61522638-61522660 CCCCACTCGGAACTGCACGCACG No data
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG No data
1175754784_1175754791 4 Left 1175754784 20:61522626-61522648 CCAGGCAAGCAGCCCCACTCGGA No data
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG No data
1175754788_1175754791 -10 Left 1175754788 20:61522640-61522662 CCACTCGGAACTGCACGCACGGC No data
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG No data
1175754781_1175754791 9 Left 1175754781 20:61522621-61522643 CCCAGCCAGGCAAGCAGCCCCAC No data
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG No data
1175754778_1175754791 12 Left 1175754778 20:61522618-61522640 CCCCCCAGCCAGGCAAGCAGCCC No data
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG No data
1175754780_1175754791 10 Left 1175754780 20:61522620-61522642 CCCCAGCCAGGCAAGCAGCCCCA No data
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG No data
1175754779_1175754791 11 Left 1175754779 20:61522619-61522641 CCCCCAGCCAGGCAAGCAGCCCC No data
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG No data
1175754786_1175754791 -9 Left 1175754786 20:61522639-61522661 CCCACTCGGAACTGCACGCACGG No data
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG No data
1175754782_1175754791 8 Left 1175754782 20:61522622-61522644 CCAGCCAGGCAAGCAGCCCCACT No data
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175754791 Original CRISPR CACGCACGGCGCAGTCCGGG TGG Intronic