ID: 1175754791

View in Genome Browser
Species Human (GRCh38)
Location 20:61522653-61522675
Sequence CACGCACGGCGCAGTCCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175754788_1175754791 -10 Left 1175754788 20:61522640-61522662 CCACTCGGAACTGCACGCACGGC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1175754781_1175754791 9 Left 1175754781 20:61522621-61522643 CCCAGCCAGGCAAGCAGCCCCAC 0: 1
1: 0
2: 4
3: 40
4: 496
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1175754786_1175754791 -9 Left 1175754786 20:61522639-61522661 CCCACTCGGAACTGCACGCACGG 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1175754784_1175754791 4 Left 1175754784 20:61522626-61522648 CCAGGCAAGCAGCCCCACTCGGA 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1175754782_1175754791 8 Left 1175754782 20:61522622-61522644 CCAGCCAGGCAAGCAGCCCCACT 0: 1
1: 0
2: 1
3: 35
4: 346
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1175754785_1175754791 -8 Left 1175754785 20:61522638-61522660 CCCCACTCGGAACTGCACGCACG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1175754778_1175754791 12 Left 1175754778 20:61522618-61522640 CCCCCCAGCCAGGCAAGCAGCCC 0: 1
1: 0
2: 10
3: 136
4: 1466
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1175754780_1175754791 10 Left 1175754780 20:61522620-61522642 CCCCAGCCAGGCAAGCAGCCCCA 0: 1
1: 0
2: 9
3: 125
4: 1895
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1175754779_1175754791 11 Left 1175754779 20:61522619-61522641 CCCCCAGCCAGGCAAGCAGCCCC 0: 1
1: 1
2: 9
3: 216
4: 5017
Right 1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175754791 Original CRISPR CACGCACGGCGCAGTCCGGG TGG Intronic
900244392 1:1630746-1630768 CCCGAAGGCCGCAGTCCGGGCGG - Intergenic
901066704 1:6497624-6497646 CGCGCACGGCTCTGTCCTGGAGG + Intronic
901577392 1:10211200-10211222 CGCGCACGTTGCAGCCCGGGGGG + Intronic
916792463 1:168136542-168136564 AAAGCAAGGCGCAGTGCGGGCGG + Intronic
920409571 1:205749357-205749379 CACGCTCGGCCCGATCCGGGAGG + Intronic
1077145420 11:1042243-1042265 CCCGCCCGGAGCAGTCCAGGGGG - Intergenic
1077187255 11:1240858-1240880 CACACACGGTGGAGACCGGGAGG - Exonic
1088679390 11:112226357-112226379 CACGCACTGCGCAGCCGCGGTGG + Exonic
1097894230 12:64808390-64808412 CAGGCACGGCACAGTCCAGTGGG - Intronic
1103724673 12:122991752-122991774 CACACTCGGCACAGCCCGGGCGG + Intronic
1106871984 13:34031451-34031473 CAACCAAGGCGCAGTCCTGGGGG + Intergenic
1113311876 13:109140441-109140463 CGCGCACTGCGGAGTCCCGGGGG - Exonic
1113491177 13:110693259-110693281 CACCAACGGCCCAGTCCTGGAGG + Intronic
1133547173 16:6818806-6818828 CAGGCACGGACCAGTCAGGGAGG - Intronic
1138652215 16:58467028-58467050 CAAGCAGGTCACAGTCCGGGAGG + Intronic
1143510973 17:7394773-7394795 CACGCACGCCGCCGGCCTGGCGG - Exonic
1145390827 17:22454279-22454301 CACGCCAGTCGGAGTCCGGGCGG + Intergenic
1146058666 17:29593449-29593471 CGCGCCCGGCGCGGTGCGGGCGG - Exonic
1146183362 17:30710378-30710400 CAAGCCGGCCGCAGTCCGGGGGG + Intergenic
1146403605 17:32519266-32519288 CAGGCACTGGGCAGGCCGGGTGG + Intronic
1148549581 17:48542516-48542538 CAGGGCCGGCGAAGTCCGGGTGG - Intronic
1161080600 19:2308174-2308196 CGCGCACGGCGGAGCCCGGGAGG - Intronic
1162497003 19:11029010-11029032 CACACAGGGCACACTCCGGGTGG - Intronic
1163836644 19:19579057-19579079 CACGCCCGGCCCAGACTGGGTGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1171393777 20:24817871-24817893 CACTGACGGCACAGTCAGGGAGG + Intergenic
1172354309 20:34269028-34269050 CACGCAGGGCGCAGATAGGGGGG - Exonic
1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG + Intronic
1179654704 21:42837861-42837883 CACGCACAGCCCAGTCTGCGGGG - Intergenic
1185296862 22:50058743-50058765 CCCGCAGCGCGCAGCCCGGGAGG - Intergenic
950043318 3:9933792-9933814 CACCCGCGCCGCAGTCCAGGGGG - Intergenic
969586488 4:8097109-8097131 CACACACGAAGCAGTCGGGGTGG + Exonic
984187248 4:176560984-176561006 CACGCAGGGGGCTGTCAGGGGGG - Intergenic
986166108 5:5272715-5272737 CACGAACGGCACAGTCAGGGTGG + Intronic
1004075634 6:12341854-12341876 CACGCACTGCGGAGTGTGGGAGG + Intergenic
1007994985 6:46297473-46297495 CAACCACTGCACAGTCCGGGTGG + Intronic
1011284047 6:85705407-85705429 CAGGCACGGAGCAGCCAGGGAGG + Intergenic
1018978388 6:168582818-168582840 CACGCACGGGGAAGACCCGGGGG + Intronic
1022026056 7:26448882-26448904 CATGTAGGGCGCATTCCGGGTGG + Intergenic
1040309317 8:46228571-46228593 CACGCCCGGGACAGTCCTGGGGG - Intergenic
1062452071 9:136620019-136620041 CACGCAAGGGGCAGGCCGAGGGG + Intergenic