ID: 1175754859

View in Genome Browser
Species Human (GRCh38)
Location 20:61523024-61523046
Sequence CAGAGGAAGGAGCAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2323
Summary {0: 1, 1: 2, 2: 27, 3: 233, 4: 2060}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175754850_1175754859 -6 Left 1175754850 20:61523007-61523029 CCACCGGCCTCCAGGAGCAGAGG 0: 1
1: 0
2: 3
3: 60
4: 333
Right 1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG 0: 1
1: 2
2: 27
3: 233
4: 2060
1175754852_1175754859 -9 Left 1175754852 20:61523010-61523032 CCGGCCTCCAGGAGCAGAGGAAG 0: 1
1: 0
2: 4
3: 77
4: 507
Right 1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG 0: 1
1: 2
2: 27
3: 233
4: 2060
1175754845_1175754859 22 Left 1175754845 20:61522979-61523001 CCTGCAGACCAGTTGGTAGCTCC 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG 0: 1
1: 2
2: 27
3: 233
4: 2060
1175754846_1175754859 14 Left 1175754846 20:61522987-61523009 CCAGTTGGTAGCTCCATCAGCCA 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG 0: 1
1: 2
2: 27
3: 233
4: 2060
1175754849_1175754859 1 Left 1175754849 20:61523000-61523022 CCATCAGCCACCGGCCTCCAGGA 0: 1
1: 0
2: 2
3: 21
4: 251
Right 1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG 0: 1
1: 2
2: 27
3: 233
4: 2060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175754859 Original CRISPR CAGAGGAAGGAGCAGGAGGG AGG Intronic
Too many off-targets to display for this crispr