ID: 1175755162

View in Genome Browser
Species Human (GRCh38)
Location 20:61525081-61525103
Sequence CTGTTGTCATTAAGCTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175755159_1175755162 23 Left 1175755159 20:61525035-61525057 CCAAGTCAGAAATTATGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1175755162 20:61525081-61525103 CTGTTGTCATTAAGCTCAAATGG 0: 1
1: 0
2: 0
3: 14
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175755162 Original CRISPR CTGTTGTCATTAAGCTCAAA TGG Intronic
905084414 1:35358115-35358137 CTGATTGTATTAAGCTCAAAGGG + Intronic
908504607 1:64783999-64784021 CTGTTCTCATTAAGTTAACAGGG + Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
910409121 1:86922089-86922111 CTGTTGTCTTTAGGATTAAAGGG + Intronic
910514463 1:88044325-88044347 CTGTTTTCTTTATGCACAAAAGG - Intergenic
910535237 1:88290089-88290111 ATGTTGACAGTAAGCTCAATGGG - Intergenic
910662299 1:89686856-89686878 CTGATGTCACTAACATCAAAGGG + Intronic
911261479 1:95691636-95691658 CTGATGTAATTGAGCTCTAATGG + Intergenic
913969012 1:143399952-143399974 CTGTGATCATGAAGCTCCAAGGG + Intergenic
914063389 1:144225551-144225573 CTGTGATCATGAAGCTCCAAGGG + Intergenic
914115761 1:144740803-144740825 CTGTGATCATGAAGCTCCAAGGG - Intergenic
917883046 1:179358319-179358341 CTGCTGTCAATAAGCCCTAATGG + Exonic
919666487 1:200297657-200297679 CTGGTGTCATTGAGCTCAATGGG - Intergenic
920968709 1:210723683-210723705 CTGATTTCATTAAGCTGAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921694299 1:218190098-218190120 ATATTGCCATTAAACTCAAATGG + Intergenic
923480551 1:234379304-234379326 CTGTTGGCATTAAGTCCAAGAGG + Intronic
1063759903 10:9062014-9062036 CAGTAGTCATTAAGCTCTTAGGG + Intergenic
1064513714 10:16123524-16123546 CTGCTGACATGAAGCTCAAAGGG + Intergenic
1068399039 10:56504816-56504838 CTGTTTTCATTAGGCTAAATGGG + Intergenic
1069220478 10:65877143-65877165 CTGTTGTTTTATAGCTCAAAAGG + Intergenic
1070530680 10:77334475-77334497 ATGATGTAATAAAGCTCAAATGG - Intronic
1070543395 10:77433782-77433804 CAGTAGTTATTATGCTCAAAAGG + Intronic
1073485415 10:103814796-103814818 CTGTTGTCATGGAGCTTATATGG + Intronic
1073721689 10:106179985-106180007 TTGATGTCATTAAGAACAAACGG - Intergenic
1077725737 11:4673138-4673160 CTGTTCTCATTAATCTGGAAGGG - Intergenic
1079547097 11:21645663-21645685 ATGGTGGCATGAAGCTCAAAAGG - Intergenic
1079809811 11:24983200-24983222 TTGATGTGATTAAACTCAAAGGG - Exonic
1084231559 11:67757243-67757265 CTGTTCTCACTAAGGTCCAAGGG - Intergenic
1087663949 11:101020359-101020381 TTGTTTTAATTAAGCTTAAACGG + Intergenic
1094598372 12:31886159-31886181 CTGTCCTCATTAATCTCCAAAGG + Intergenic
1094819996 12:34216921-34216943 CTGTTGTCACCATGCTCAATTGG + Intergenic
1098769951 12:74539648-74539670 CTGTTGTCAAGAAGATCCAAAGG - Exonic
1098867892 12:75783449-75783471 CTGTTCACCTTAAGCACAAACGG + Intergenic
1100121765 12:91376685-91376707 ATGTAGTCATTAATATCAAAAGG - Intergenic
1101245673 12:102882131-102882153 ATGTTGTCTTTAACATCAAAAGG - Intronic
1102768815 12:115455476-115455498 CTGTTTCCAAGAAGCTCAAAGGG - Intergenic
1103181838 12:118919427-118919449 GAGCTGTCATTAGGCTCAAATGG + Intergenic
1105391969 13:19988131-19988153 CTGTTTTCTTTTAACTCAAAGGG + Intronic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1107198664 13:37686201-37686223 CTAAAGTCATTAAGATCAAATGG - Intronic
1108314423 13:49223442-49223464 CTGCTGTCACTCAGCTCCAAAGG + Intergenic
1108561278 13:51646520-51646542 CTGTTGTCAGGAAGCTCACAGGG - Intronic
1111941613 13:94614337-94614359 CTGTAGTCCTTTGGCTCAAAAGG + Intronic
1112074931 13:95902152-95902174 TTATTGTCATTAATCTCAAGTGG + Intronic
1113295382 13:108954264-108954286 CTGTTTTCATTAGAGTCAAAGGG - Intronic
1113806608 13:113113812-113113834 CTGGTGTCAGTAAGCTGAGAAGG - Intronic
1115188138 14:30716062-30716084 CTGCTGTGATTAAGCTCACAAGG - Intronic
1116386607 14:44338373-44338395 CTGATGACAGTAATCTCAAAGGG - Intergenic
1117166635 14:53040996-53041018 TTTTTGTCATGAAGCTCAAAGGG + Intronic
1118583984 14:67334073-67334095 CAGTTGACTTTAAGATCAAAAGG + Exonic
1126207282 15:46059900-46059922 CTCATGTCATTAACCTGAAATGG + Intergenic
1126730740 15:51680087-51680109 CTGTTATTATGAAGATCAAATGG - Intergenic
1127272467 15:57413749-57413771 TTGTTGTCAAAAAGGTCAAAAGG - Intronic
1127745567 15:61967829-61967851 CTGTTGTTTTTAAGTTAAAAAGG - Intronic
1129129574 15:73481438-73481460 CTATTGTCATTTATGTCAAAGGG + Intronic
1133835625 16:9364851-9364873 CTGTTTTCCTTTAGCTTAAAGGG - Intergenic
1146936453 17:36815252-36815274 CTGTTGTCAGTATCCTCAATAGG + Intergenic
1148949066 17:51293142-51293164 CTGTGGTCATTAAGCTAGAGTGG + Intronic
1150016269 17:61560535-61560557 AAGATTTCATTAAGCTCAAAAGG + Intergenic
1151234806 17:72712127-72712149 TTGTTGTCATTAAGCTGAGAGGG + Intronic
1153491568 18:5654849-5654871 CTCTTTTCATTAGGCTCAGAAGG + Intergenic
1155047260 18:22113785-22113807 CTTTTGTCATTAAGCTTAGGAGG + Intergenic
1157509200 18:48256699-48256721 ATATTATCATTAAGGTCAAAAGG + Intronic
1158378957 18:56906986-56907008 GTGTTTTCATTAAGCTCATCAGG + Intronic
925157960 2:1661670-1661692 CTGTTTTTATTAAGCTCAGTAGG - Intronic
926064905 2:9830851-9830873 CTGTTGTCATTAAACAGTAAAGG - Intergenic
926622709 2:15061544-15061566 CTGATGTCATCAAGGTCACAGGG + Intergenic
927264990 2:21136436-21136458 CTGTTCTCAAAAAGGTCAAAAGG - Intronic
932015272 2:68019516-68019538 GTCTTGTCCTTAAACTCAAAGGG + Intergenic
932059848 2:68485259-68485281 CTGATGTCATTAAAGACAAAAGG - Intronic
934173713 2:89560872-89560894 CTGTGATCATGAAGCTCCAAGGG + Intergenic
934284028 2:91635221-91635243 CTGTGATCATGAAGCTCCAAGGG + Intergenic
936660493 2:114537667-114537689 CGGTTGTCATAATGATCAAATGG - Intronic
937652140 2:124331121-124331143 GTGTTGTCATTAAGGACATATGG - Intronic
937766877 2:125671692-125671714 CTGATATCATTAAGCCCAAGAGG + Intergenic
937772334 2:125735033-125735055 CTGTTCTCATGATGCTAAAAAGG + Intergenic
943038786 2:182778993-182779015 GTTTTGTCATTGAGCTCATAAGG + Exonic
945135128 2:206618841-206618863 CTTTTGTGATTAATCTGAAAGGG - Exonic
946630378 2:221660980-221661002 CAAGTGTCATTAAGCTCAAATGG + Intergenic
948363819 2:237441719-237441741 CTGTGATGATTAAGATCAAAGGG + Intergenic
948596405 2:239082299-239082321 CCGTTGTCACTAAGCACAACTGG - Intronic
1168888966 20:1281448-1281470 CTTTTTTCTGTAAGCTCAAAAGG + Intronic
1170706655 20:18749784-18749806 CTGTTGACATTAAGGTGAAATGG + Intronic
1173718572 20:45232948-45232970 ATGTTGTCATTTAAATCAAATGG + Intergenic
1175755162 20:61525081-61525103 CTGTTGTCATTAAGCTCAAATGG + Intronic
1177657463 21:24037254-24037276 CTGTTGTTATTAATTTCACATGG - Intergenic
1182045157 22:27268465-27268487 CTGCTCTCATTAAGGTCAAAAGG - Intergenic
950617774 3:14175969-14175991 CTGGTGTCATTCAGCCTAAACGG - Intronic
951242449 3:20302955-20302977 CTGCTGTCAACAAGCTCATAGGG - Intergenic
956314451 3:67918639-67918661 CAGTTGTCCTTAACCTCCAATGG - Intergenic
957389413 3:79543916-79543938 CTGCTTTCATTAAGCTTAAAAGG - Intronic
959688484 3:109173314-109173336 CTGTTGTGTTTACCCTCAAACGG - Intergenic
961480493 3:127176389-127176411 CTGGTATCCTTAAGCTCACAGGG - Intergenic
961880171 3:130056202-130056224 CTGTTCTCACTAAGGTCCAAGGG - Intergenic
963676421 3:148317062-148317084 CTATTGCCATGAAGCACAAAGGG - Intergenic
964271869 3:154965457-154965479 CTGGGGTCATTAGGCTCCAAAGG - Intergenic
967117680 3:186356497-186356519 CAGTTGATATTAAGCTCAACAGG + Intronic
970834457 4:20385202-20385224 CTGTTGTAATGAAAATCAAATGG + Intronic
973300639 4:48579454-48579476 CTGTTTTCATTATTCTCAAGAGG + Intronic
980274913 4:130637751-130637773 ATATTGTCATTAAACTCATATGG + Intergenic
984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG + Intronic
984323335 4:178222595-178222617 CGTTTTTCATTAAGTTCAAATGG - Intergenic
984962028 4:185107030-185107052 CTGTTGGCATTAAGAATAAAAGG - Intergenic
985306790 4:188551703-188551725 CTGATCTCATTAACTTCAAATGG + Intergenic
986812110 5:11371262-11371284 CTGTTATCATGAAACTCCAAGGG + Intronic
989444035 5:41508134-41508156 CTGTTGGTATTATACTCAAATGG - Intronic
991556337 5:67898728-67898750 CTGCTGTTATTAAACTTAAAAGG - Intergenic
994946685 5:106402894-106402916 CTGTTGTCATTGATATAAAAAGG + Intergenic
995511812 5:112918202-112918224 CTGTTCTCAAAGAGCTCAAAGGG + Intronic
1003662335 6:8074336-8074358 CTTTTCTCAGTCAGCTCAAAAGG + Intronic
1004211720 6:13653283-13653305 CTGTTGTAATTACTGTCAAAAGG - Intronic
1004240331 6:13915650-13915672 TTGTTTTCATTAAAATCAAACGG + Intergenic
1009882385 6:69584529-69584551 CTAGTGTAATTAAGCTCAAAAGG - Intergenic
1011262463 6:85483672-85483694 CTGTGGTTATTGAGCTGAAAGGG + Intronic
1013167575 6:107607381-107607403 CTGTTATCATTCAGCTCCCAAGG + Intronic
1013452319 6:110295878-110295900 TTGTTTTCAGTAAACTCAAAGGG - Intronic
1016525556 6:144998148-144998170 CTTTTTTCTTTAAGCTCAGAAGG - Intergenic
1017271865 6:152516527-152516549 CTGTTGTCATACAGCTGAAATGG + Intronic
1020315210 7:6900905-6900927 CTGTTCTCACTAAGGTCCAAGGG - Intergenic
1022287383 7:28966763-28966785 CTGCAGTCATTGAGCTCACAGGG + Intergenic
1022379370 7:29845318-29845340 CTGCTGTCACTGAGCTCAAGGGG - Intronic
1026403737 7:70043168-70043190 CTGATGTCATTATGCATAAATGG + Intronic
1027784432 7:82562676-82562698 CTGATGTCACTAAGTACAAAGGG + Intergenic
1031081183 7:117258443-117258465 CTGTTCTCAGTAATTTCAAAAGG + Intergenic
1031441338 7:121798319-121798341 CTGTTGTGCTTAAGCACAATGGG + Intergenic
1032546251 7:132746048-132746070 CAGTTGTCATAAAGATTAAAGGG + Intergenic
1033954923 7:146835014-146835036 CTGTAGTGATTAACCTCAAGGGG - Intronic
1040980195 8:53238998-53239020 CTATTGTCATGAAGGTGAAAAGG - Intronic
1044136006 8:88586386-88586408 CTGTAGTCACTAAGCCTAAAGGG + Intergenic
1046190342 8:110786735-110786757 ATTTTCTCATTGAGCTCAAAGGG + Intergenic
1046858759 8:119066735-119066757 CTCTTGTGATTAAATTCAAAAGG - Intronic
1047386483 8:124414968-124414990 ATATTGTAATTATGCTCAAAAGG - Intergenic
1051200651 9:14618697-14618719 CTTTTGTTATTAAACTCAAAAGG - Exonic
1051889219 9:21925724-21925746 CTGATGGCCTTAAGCTGAAAAGG + Intronic
1056709069 9:88976119-88976141 CTGTGGTCCTGAAGCTCAAGAGG - Intergenic
1057888550 9:98850571-98850593 CAGTTGTCTTTAAACTCCAAAGG - Intergenic
1060650525 9:125322670-125322692 CTGTTTTCCTTAACCTCACATGG + Intronic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1186008851 X:5106603-5106625 CAGTTGTCATGAGACTCAAAAGG - Intergenic
1186780957 X:12911540-12911562 CTGATGTCATCAAGTTAAAATGG - Intronic
1189445848 X:41080755-41080777 CTGTTGTCATAAAGATTAAGTGG + Intergenic
1194351892 X:92831030-92831052 CTGGTGTCATAAATGTCAAATGG + Intergenic
1195526470 X:105896146-105896168 TTCTTGTCCTTAAGCTCATAGGG + Intronic
1197090952 X:122536680-122536702 CTGTTTTCATTTAATTCAAAGGG - Intergenic
1200660201 Y:5947722-5947744 CTGGTGTCATAAATGTCAAATGG + Intergenic
1201766466 Y:17577491-17577513 CTGTTGTCACCATGCTCAATTGG + Intergenic
1201835086 Y:18328498-18328520 CTGTTGTCACCATGCTCAATTGG - Intergenic