ID: 1175756376

View in Genome Browser
Species Human (GRCh38)
Location 20:61533028-61533050
Sequence CAGGGAATGCCAGCTGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175756365_1175756376 24 Left 1175756365 20:61532981-61533003 CCCAGGCTCACTGGTTCCTTGGC 0: 1
1: 0
2: 1
3: 15
4: 251
Right 1175756376 20:61533028-61533050 CAGGGAATGCCAGCTGGTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 258
1175756369_1175756376 2 Left 1175756369 20:61533003-61533025 CCTGCTTTCCAAATGGCCTCTTC 0: 1
1: 1
2: 4
3: 26
4: 261
Right 1175756376 20:61533028-61533050 CAGGGAATGCCAGCTGGTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 258
1175756368_1175756376 8 Left 1175756368 20:61532997-61533019 CCTTGGCCTGCTTTCCAAATGGC 0: 1
1: 0
2: 3
3: 28
4: 199
Right 1175756376 20:61533028-61533050 CAGGGAATGCCAGCTGGTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 258
1175756372_1175756376 -6 Left 1175756372 20:61533011-61533033 CCAAATGGCCTCTTCTGCAGGGA No data
Right 1175756376 20:61533028-61533050 CAGGGAATGCCAGCTGGTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 258
1175756366_1175756376 23 Left 1175756366 20:61532982-61533004 CCAGGCTCACTGGTTCCTTGGCC 0: 1
1: 0
2: 2
3: 24
4: 456
Right 1175756376 20:61533028-61533050 CAGGGAATGCCAGCTGGTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175756376 Original CRISPR CAGGGAATGCCAGCTGGTGT GGG Intronic
900473088 1:2864054-2864076 CAGGGAAGGCCAGCAGGACTGGG - Intergenic
902198506 1:14816050-14816072 CTTGGAATGCCAGCTTCTGTTGG + Intronic
902983533 1:20141919-20141941 CAGGGAGTCCCAGCTGGGCTTGG + Intronic
904438244 1:30513203-30513225 CAGGGCGTGCCAGATGGTGGGGG + Intergenic
906058002 1:42930971-42930993 CAGGGAGTCCCAGATGGGGTGGG - Intronic
909531831 1:76690905-76690927 CAGTGAATGCCTGCATGTGTAGG + Intergenic
910495330 1:87820465-87820487 CAGGAACTGCCAGCTGGGTTGGG + Intergenic
911373682 1:97024742-97024764 CAGGGAATCCCAGTGGGAGTGGG - Intergenic
915284845 1:154846061-154846083 CAGCCGCTGCCAGCTGGTGTTGG - Intronic
915461401 1:156072569-156072591 CAGTGATTGCAAGCTGGGGTTGG + Exonic
915664181 1:157429846-157429868 CAGGGAATCCCAGTTGGTAAAGG + Intergenic
916958903 1:169869240-169869262 AAGGGAATGGCACCTGGGGTGGG - Intronic
919896360 1:202011954-202011976 CAGAGAAGGCCAGCTGGTTGGGG + Exonic
920535595 1:206734604-206734626 CTGCGAAAGCCAGCTGGTATAGG + Intergenic
921285965 1:213609592-213609614 CAGGGAATTCCAGGTGCTGGGGG + Intergenic
922353146 1:224751494-224751516 CTGGGACTGACAGCTGGTATTGG + Intergenic
923971503 1:239207681-239207703 CAGGGAATGCCAGATAAAGTGGG + Intergenic
1063806222 10:9645153-9645175 GAAGGAATGTCAGCTGGTGTTGG - Intergenic
1063858333 10:10280527-10280549 CAGAGAATGCCATCTGGAGAAGG - Intergenic
1064933851 10:20657894-20657916 CAGAGAAAGCCAGCTGGAGAAGG - Intergenic
1065508546 10:26454566-26454588 CTGGGAATGGTAGCTGGGGTGGG + Intronic
1065598570 10:27344756-27344778 CAGCACATGCCAGCAGGTGTTGG - Intergenic
1066072737 10:31836864-31836886 AAAGGAATGCCATCTGGTGATGG + Intronic
1067081017 10:43212204-43212226 CCTGGGATGCCAGCTGTTGTTGG + Intronic
1067401133 10:45974542-45974564 TAGGGAATGACAGCTAATGTAGG + Intronic
1067869485 10:49944121-49944143 TAGGGAATGACAGCTAATGTAGG + Intronic
1069430253 10:68328637-68328659 CAAGGACTGCCAGCTGCTTTTGG - Intronic
1070530310 10:77331199-77331221 GAGAGTATGCCAGCTGGGGTGGG - Intronic
1070831586 10:79421206-79421228 CAGAGAATGTCAGCTGGGATGGG - Intronic
1071026430 10:81119854-81119876 GAGTGAATTCAAGCTGGTGTAGG - Intergenic
1071479316 10:86052542-86052564 CTGGGAATACCAGGTGCTGTCGG + Intronic
1071889114 10:89983155-89983177 CAGTGAATGCCAGCTTTTCTGGG + Intergenic
1072552993 10:96493493-96493515 GAGGGCAAGCCAGCTGGAGTGGG + Intronic
1074102511 10:110364767-110364789 CTGGAAATGCCAGCAGGTGGGGG - Intergenic
1074529697 10:114288852-114288874 CAGGGACTGCCAGGTTGGGTAGG - Intronic
1074822057 10:117187124-117187146 TAGGCAAGGCCAGATGGTGTGGG - Intergenic
1074876668 10:117618957-117618979 CAAGGAATGCCAGGAGGTGACGG + Intergenic
1075017514 10:118921118-118921140 CAGGGAATGGCTGCTCATGTGGG - Intergenic
1075433812 10:122416313-122416335 CAGGGAAAGAGAGCTGTTGTGGG + Intronic
1075825666 10:125355554-125355576 CAGGGAATGCAAGCTGGGGCTGG - Intergenic
1077242771 11:1519376-1519398 CAGGGAAGGCCAGCAAGTGAAGG + Intergenic
1077902954 11:6504794-6504816 AAGGGGCTACCAGCTGGTGTTGG - Intronic
1079475685 11:20826693-20826715 CAGGGAAGGCCAGCTTCTATAGG - Intronic
1080419535 11:32097703-32097725 CAGGGAAGGCTTCCTGGTGTGGG + Intronic
1081631851 11:44694711-44694733 CAGAGAAGCCCAGCTGGTGGGGG - Intergenic
1082101080 11:48173466-48173488 CAGAACATGCCAGCTGGTTTTGG - Intergenic
1083249584 11:61457194-61457216 GAGGGAATGCCAGATGATGAAGG - Intronic
1083264008 11:61537787-61537809 CAGGGATTTCCAGTTGGGGTGGG + Intronic
1083285551 11:61656508-61656530 CAGGGAGTGCGAGGTGGTGAGGG + Intergenic
1084562321 11:69911840-69911862 CCTGAAATGCCAGCTGGTTTTGG + Intergenic
1084562515 11:69912668-69912690 CCTGGAATGCCAGCTGGTTTTGG - Intergenic
1087025430 11:93644809-93644831 CAGAGACTGCCAGTTGCTGTGGG + Intergenic
1089010016 11:115124520-115124542 CAGGGAAAGCAGGCAGGTGTGGG - Intergenic
1089151583 11:116368626-116368648 CAGGGAACCCCAGCAGGAGTGGG + Intergenic
1089494106 11:118899873-118899895 CCAGGGAGGCCAGCTGGTGTGGG - Intronic
1091003758 11:131933285-131933307 CAGGTGATGCCTGCGGGTGTAGG - Intronic
1092462569 12:8698637-8698659 CCGGGAACGCCGGCTGGAGTCGG + Intronic
1094023897 12:25942338-25942360 CATGGAGTGGCAGCTGGTGGTGG - Intergenic
1094817672 12:34203895-34203917 CTGGGAATGCCGGGTGCTGTAGG + Intergenic
1095520826 12:43063399-43063421 CAGGGAATGACAGGATGTGTAGG + Intergenic
1101654563 12:106708554-106708576 CAGGGCAGGCTAGGTGGTGTTGG + Intronic
1102275846 12:111581350-111581372 CAGGGAAGACCAGCTGTGGTCGG - Intronic
1107549540 13:41462084-41462106 CAGGGAATGGCTGGGGGTGTGGG - Intronic
1108520015 13:51238129-51238151 CACAGAATGCCAGCTGTTGTGGG + Intronic
1111734836 13:92125039-92125061 GAGGGAATGCCAGCAAGAGTTGG - Intronic
1111915593 13:94357039-94357061 CTGGGAAAGCCAGGTGGGGTGGG - Intronic
1111944628 13:94651399-94651421 CTGGGAATACCAGGTGCTGTAGG - Intergenic
1113400579 13:109988993-109989015 CTTGGAATGGCAGCTGGAGTTGG - Intergenic
1117412750 14:55465829-55465851 CAGGTATTGCCACCTGGTGCAGG + Intergenic
1117447298 14:55816352-55816374 CAAGCAAGGCCAGCTGGTGGAGG - Intergenic
1117464519 14:55978999-55979021 AAGTGACTGCCAGCTTGTGTGGG + Intergenic
1118229704 14:63936642-63936664 CAGGGAAGGGCAGATGGTGCTGG + Intronic
1118417130 14:65552841-65552863 GGGGGAATGCCATCTGATGTTGG + Intronic
1118920882 14:70149104-70149126 CCAGGAATTCCAGCAGGTGTTGG - Intronic
1119667906 14:76498156-76498178 CAGGGAGTGCTGCCTGGTGTGGG - Intronic
1121031193 14:90659987-90660009 GAGAGAATGGCAGGTGGTGTCGG + Intronic
1121279785 14:92690184-92690206 CAGGTAATGGCAGCTGGAATGGG + Intergenic
1122977504 14:105176943-105176965 CAGGTGAGGCCAGCTGGGGTGGG - Exonic
1123218289 14:106832201-106832223 AAGGGGATGCCACCTGATGTCGG - Intergenic
1124326214 15:28765214-28765236 GAGGGAATGCCAGCAAGAGTTGG - Intergenic
1124693154 15:31842553-31842575 CAGGGAATGGGGGCTGGTGGGGG + Intronic
1126176802 15:45743380-45743402 CAGGGAATGAGAGCTTGTGGTGG - Intergenic
1127872316 15:63083682-63083704 CAAGGAATCCCTGCTGGAGTGGG - Intergenic
1129356603 15:74995998-74996020 CAGGGAACGCCAGGTGGGGCTGG - Intronic
1129932472 15:79423547-79423569 CAGGGAGTGCAGGATGGTGTGGG - Intronic
1130913822 15:88289650-88289672 CAAGCCTTGCCAGCTGGTGTGGG - Intergenic
1131378022 15:91941247-91941269 AAGGGAATGTGAGCTGGTTTAGG + Intronic
1132231625 15:100188771-100188793 CAGGGATTGTCAGCTGGCTTTGG - Intronic
1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG + Intronic
1132878459 16:2150474-2150496 CGAGGAATTCCAGCTGGTGGGGG - Intronic
1133393819 16:5430238-5430260 CAGGAAATGGCAGCAGGTGGTGG + Intergenic
1133532102 16:6664863-6664885 CAAGGTCTGCCAGCTGGTGAAGG - Intronic
1137399262 16:48140148-48140170 AAGGGAACCCCAGGTGGTGTGGG - Intronic
1137960621 16:52878362-52878384 CAGGGAAAGACAGCTTTTGTAGG - Intergenic
1138113489 16:54342410-54342432 CAAGAAATACCAGCTGGTGATGG + Intergenic
1139404345 16:66706461-66706483 CAGGGAATCCCAGCTTCTGCGGG + Intergenic
1140378536 16:74465210-74465232 CAGGGAATACCTGCTGGAGGAGG + Intronic
1144582322 17:16465942-16465964 CTGTGAATTCCAGCTGGGGTGGG + Intronic
1147189814 17:38731804-38731826 CAGGAAATACCAGGTGCTGTAGG - Intronic
1147808244 17:43147819-43147841 TAGGGAAGGCCACCAGGTGTTGG - Intergenic
1147937677 17:44022599-44022621 CAGGGAATCCCAGTTGGTAAAGG - Intronic
1147967498 17:44200738-44200760 CAGGAAAGGCGAGCAGGTGTGGG - Intergenic
1148141743 17:45333890-45333912 CAGGGAACACCAGCAGGGGTGGG + Intergenic
1149208245 17:54274139-54274161 CAGGTAATGCCAGAAGGGGTGGG - Intergenic
1150281788 17:63933133-63933155 CAGGGAACAGGAGCTGGTGTGGG + Intergenic
1151119124 17:71772684-71772706 GAGGGAATGCCAGTTAGTCTAGG - Intergenic
1152725008 17:81940901-81940923 CTGGGACAGCCAGCTGGTGGTGG - Exonic
1154376814 18:13817549-13817571 CAGGTCATGCCGGCTGGGGTTGG + Intergenic
1155110686 18:22711228-22711250 CAGGGAATGGCAGCGGGGGTGGG - Intergenic
1155274196 18:24170507-24170529 CTGGGAATACCAGGTGCTGTCGG - Intronic
1157117628 18:44876775-44876797 CAGGGAATGACCACAGGTGTGGG - Intronic
1157268272 18:46248151-46248173 AAGGCACTGCCTGCTGGTGTTGG + Intronic
1158382755 18:56952213-56952235 CAGCGAATTCCAGGTGGTGAGGG + Intronic
1162609237 19:11736889-11736911 CAGGGAATGGAAACTGGGGTGGG + Intronic
1164806542 19:31121349-31121371 CAGGAAATGTCTGCCGGTGTAGG - Intergenic
1166861500 19:45814362-45814384 AAGTGAATGCTAGCTGTTGTTGG + Intronic
925015893 2:523858-523880 CAGGGAATGACAGTGGTTGTTGG + Intergenic
926294849 2:11561663-11561685 CTGGGAATACCAGGTGCTGTAGG - Intronic
926994048 2:18714788-18714810 CAGGCAAAGCCAGCTTATGTAGG + Intergenic
927335534 2:21919262-21919284 CTGGGAAAGCCAGTGGGTGTGGG - Intergenic
927369558 2:22338888-22338910 CTGGGAATACCAGGTGCTGTAGG - Intergenic
927790108 2:26003012-26003034 CAGGGCATGCCAGCTGGACAGGG - Intergenic
928820673 2:35356684-35356706 GTGGGAATGCCAGCTGCAGTGGG - Intergenic
932408605 2:71530877-71530899 CAAAGAAGGCCAGCTGGGGTGGG - Intronic
932688148 2:73891109-73891131 CAGGGAGTTCCAGGTGGTTTTGG - Intergenic
933268266 2:80204934-80204956 CAGGGAAAGAGAGCTTGTGTAGG + Intronic
933307633 2:80621686-80621708 CAGGAAATCCCAGGTGGTTTTGG + Intronic
933342495 2:81040218-81040240 CAGGGGACCCCAGCTGCTGTTGG - Intergenic
934096922 2:88615294-88615316 TAGGGAATGACTGATGGTGTGGG - Intronic
935688897 2:105712593-105712615 CAGGAAGTGACAGCTGGGGTGGG - Intergenic
936064296 2:109318869-109318891 CAAGGAATTCCAGCTGGCTTTGG - Intronic
937320476 2:120957920-120957942 CAGGGAAGGGCAGATGGTGCTGG - Intronic
937348173 2:121140982-121141004 CAGGAAATGCCAGCAGGTGAAGG + Intergenic
938097628 2:128473984-128474006 CAGGCCATGCCAGCTGGAGGGGG + Intergenic
938406633 2:131036542-131036564 CAGGGAAGGTCACCAGGTGTCGG - Intronic
938558624 2:132449897-132449919 CAGGGGATGCTAGAAGGTGTAGG - Intronic
938968251 2:136407472-136407494 CAGGGAACTCAAGCAGGTGTTGG + Intergenic
939122972 2:138140559-138140581 CTGGGAATACCAGCAGGAGTTGG - Intergenic
944673605 2:202016617-202016639 CAGGTATTGCCAGTTGTTGTAGG - Intergenic
946811265 2:223528590-223528612 CAAGGACTGCAAGCTGGTGAGGG + Intergenic
947818946 2:233057524-233057546 AAGGGACTGCCAGCTGCTGCTGG - Intergenic
948524772 2:238564694-238564716 CAGGGAAAGCCAGCCGGAGCAGG + Intergenic
1168734113 20:115530-115552 CAGGCAAGGCTAGCTGGTTTGGG + Intergenic
1170812319 20:19684231-19684253 CAGAGAAGGAAAGCTGGTGTGGG - Exonic
1173004748 20:39131368-39131390 TAGGGAAAGACAGCGGGTGTTGG + Intergenic
1173069869 20:39753038-39753060 CAGGAAAAGCCAGCAGGGGTAGG - Intergenic
1173370020 20:42426876-42426898 CAGGGGAAGCCAGCAGGTGATGG + Intronic
1174078805 20:47956788-47956810 CAGGGAACTGCAGCTGGGGTTGG - Intergenic
1174138909 20:48399092-48399114 CAGGGAACTGCAGCTGGAGTTGG + Intergenic
1175266288 20:57705435-57705457 CAGGGGAGAACAGCTGGTGTTGG + Intronic
1175273047 20:57748427-57748449 CAATGAATGGCAGCTGGTGGTGG + Intergenic
1175756376 20:61533028-61533050 CAGGGAATGCCAGCTGGTGTGGG + Intronic
1175770303 20:61619251-61619273 GAGGGAATGGCAGCTGGGGCTGG - Intronic
1176372330 21:6069582-6069604 CAGGGAGTGCCGACTGGTGTCGG - Intergenic
1176863627 21:14029033-14029055 CATGGAATGCAAACTGGGGTTGG - Intergenic
1179541319 21:42085019-42085041 AAGGGAAGGCCTGCTGCTGTGGG + Intronic
1179728121 21:43351776-43351798 CAGGAAATGCCAGTTAGTTTGGG - Intergenic
1179751188 21:43468957-43468979 CAGGGAGTGCCGACTGGTGTCGG + Intergenic
1180049708 21:45325556-45325578 CAGGTATTGCCACCTGTTGTGGG - Intergenic
1181673082 22:24434997-24435019 CAGGGACAGCCACCTGGTGCAGG - Intronic
1182029491 22:27146745-27146767 CAGTAAATGCCAGCTGCAGTGGG + Intergenic
1183664829 22:39241310-39241332 CAGGGCAGGCCTGCTGGTGGAGG - Intronic
1184356123 22:43980640-43980662 AAGAAAATGCCAGCTGCTGTGGG + Intronic
1184527083 22:45030727-45030749 CCCGCAATGCCAGCTGGTGAAGG + Intergenic
1185304108 22:50103059-50103081 CAGGTAATGCCAGCCGGCCTGGG + Intronic
949533909 3:4980624-4980646 AAAGGAAGGCCAGTTGGTGTTGG - Intronic
950192869 3:10990253-10990275 CAGAGAATGCCAGCGGGGGCAGG + Intergenic
951868562 3:27334270-27334292 CAAGTAATGCATGCTGGTGTTGG - Intronic
952969697 3:38643197-38643219 CAAGGGACACCAGCTGGTGTGGG - Intronic
953877432 3:46674267-46674289 AAGGCAATGCCAGCTCCTGTGGG + Intronic
955406396 3:58628291-58628313 TACGGAATGGCAGCTGGTGGAGG + Intergenic
956211201 3:66803597-66803619 GAGGGGATACCTGCTGGTGTTGG - Intergenic
956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG + Intergenic
957186914 3:76953565-76953587 CAGGGAATTCTAGCTTGAGTTGG - Intronic
957945599 3:87058652-87058674 CAGGGAAAGAGAGCTTGTGTAGG + Intergenic
959844371 3:111016382-111016404 TAGGGAATGGAATCTGGTGTTGG - Intergenic
960718309 3:120599503-120599525 CAGGAAATCCAAGCAGGTGTGGG + Intronic
961128104 3:124439766-124439788 CACAGACTGTCAGCTGGTGTGGG + Intronic
962385217 3:134927364-134927386 TAGGGAATGCCAGCTCATTTTGG - Intronic
962989603 3:140566208-140566230 CAGGCAAGCCCAGCTGGAGTGGG + Exonic
963076520 3:141352534-141352556 AAGGGAAAGCCAGCTAGGGTTGG + Intronic
964465153 3:156983775-156983797 CAGGGTATGCTACCTGGTGGGGG - Intronic
964529791 3:157655175-157655197 CAGGCACACCCAGCTGGTGTGGG - Intronic
967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG + Intergenic
967915970 3:194578485-194578507 CAGGGGATGCTAGCTGGGCTGGG + Intergenic
968417378 4:451959-451981 CAGGGAATCCCAGTTGGTAAAGG + Intronic
971002560 4:22339149-22339171 CAGGGAATCCCAGTTGGTAAAGG - Intergenic
973279359 4:48342274-48342296 GAGGGAACGTCAGCTGGAGTTGG + Intronic
973691446 4:53437376-53437398 TTGAGAATGCCAGATGGTGTAGG + Intronic
978587161 4:110285812-110285834 CAGTGACTACCAGCTGTTGTGGG + Intergenic
980996355 4:139783470-139783492 CAGGTAGTACCTGCTGGTGTGGG + Intronic
985553839 5:546573-546595 TAGGGCAGGGCAGCTGGTGTTGG - Intergenic
986133119 5:4948863-4948885 CAGGGAATGACAGCTGACTTAGG + Intergenic
990608142 5:57430452-57430474 CTGGGATTGCCAGTTGGTGAAGG + Intergenic
990701628 5:58480901-58480923 CAGGGAGTGCCAGCATGTGCAGG + Intergenic
990701779 5:58482211-58482233 CAGTGAATGACAGCATGTGTAGG + Intergenic
990701788 5:58482293-58482315 CAGTGAATGACAGCATGTGTAGG + Intergenic
990701796 5:58482375-58482397 CAGTGAATGACAGCATGTGTAGG + Intergenic
990701830 5:58482571-58482593 CAGTGAATGACAGCATGTGTAGG + Intergenic
990749170 5:58994287-58994309 CTGGTAATGCCATGTGGTGTTGG - Intronic
991207127 5:64061967-64061989 CAGGGAACGCCAACTGGAGAAGG - Intergenic
995120900 5:108534212-108534234 CAGGGCAGGCCAGGTGGTTTTGG + Intergenic
995324299 5:110873146-110873168 CAGGGAGTGCCAGATGGAGAGGG + Intergenic
998211877 5:140205800-140205822 CAGGGAAAGCCAGTTGCTGAGGG + Intronic
998250202 5:140547487-140547509 CAGGAACTGGAAGCTGGTGTGGG + Intronic
999036207 5:148353488-148353510 CAGGGGATGTCAGCTGCTGCTGG - Intergenic
999419843 5:151431381-151431403 CAGGGACTGGCAGCTGGTGGAGG + Intergenic
999745384 5:154587857-154587879 CAGGGGTTGCCAGCTGGGGCTGG + Intergenic
1000303197 5:159973394-159973416 CGGGGAACCCCAGCTGGGGTTGG - Intergenic
1000715957 5:164644659-164644681 CAGGGTATGCCAGGTTGTGATGG - Intergenic
1000888175 5:166772263-166772285 CAGGGAAAGCAGGCTGCTGTGGG + Intergenic
1002027581 5:176405966-176405988 CACGGAGGGCCAGCAGGTGTGGG - Intronic
1002300204 5:178253413-178253435 CAGTGAATGAAAGCAGGTGTTGG - Intronic
1002325801 5:178404787-178404809 CAGGGAATGCCAAGAGGTGTGGG - Intronic
1002450844 5:179317757-179317779 CAGGGAGTCTCAGCTGGTGCTGG - Intronic
1003515045 6:6810802-6810824 CAACGAATGTCAGGTGGTGTTGG + Intergenic
1003889700 6:10553220-10553242 CAGGGCGTGCCAGCTGGAGGAGG - Intronic
1007767133 6:44167138-44167160 GAGGGAAGGGCTGCTGGTGTCGG - Intronic
1009637621 6:66285658-66285680 CACTGAATGCCAGCTGGTGCAGG + Intergenic
1013095986 6:106945121-106945143 AAGGAGATGCCAGCTGGAGTTGG + Intergenic
1013630188 6:111979119-111979141 CCTGGAATGCCAGCTCTTGTTGG + Intergenic
1018316593 6:162562484-162562506 TAGTGAATGCCACCTGGTCTGGG - Intronic
1018936179 6:168275387-168275409 GAGGGAATGCCAGCGTGGGTGGG - Intergenic
1018953002 6:168391300-168391322 CAGGGCCTGCCAGGAGGTGTGGG - Intergenic
1023493301 7:40767531-40767553 CTGGGCAGGCCAACTGGTGTGGG + Intronic
1023872053 7:44268630-44268652 CTGGGAATGGCTGCTGGTGGAGG - Intronic
1024198670 7:47084878-47084900 CAGGGAATGCGTGTTTGTGTTGG - Intergenic
1026531164 7:71198560-71198582 CAGCTAGTGTCAGCTGGTGTTGG - Intronic
1028701485 7:93785954-93785976 CAGGGAATGCCAATTGATTTTGG + Intronic
1028712258 7:93922376-93922398 TGGGGACTGCCAGCTGATGTGGG + Intronic
1030209317 7:106980846-106980868 CAGGAAATGCCAGGTGGAGCAGG - Intergenic
1030673487 7:112362455-112362477 CAGGGAATGAAAGCTGATGAAGG - Intergenic
1031736773 7:125374312-125374334 CTGGGGTTGGCAGCTGGTGTTGG + Intergenic
1032594319 7:133224428-133224450 CTGGGAATGCAGGCTGGAGTAGG - Intergenic
1032703643 7:134403808-134403830 CAGGGTAAGGCAGCTGCTGTGGG + Intergenic
1032748643 7:134813873-134813895 CAGGGGATGTCAGCTGGTAAAGG + Intronic
1032806469 7:135359890-135359912 CAGGGCTTGCCAGTTGGGGTAGG - Intergenic
1033636628 7:143218026-143218048 CATGGAGGGCCAGATGGTGTTGG + Intergenic
1034747246 7:153533821-153533843 CAGGAAAAGCCAGCTAGTCTGGG + Intergenic
1035148031 7:156840302-156840324 CAGGAAGTGCCAGCAGGGGTGGG + Intronic
1035310590 7:157965434-157965456 CTGGGAATGCCAAATGGTGTTGG - Intronic
1035452764 7:158989054-158989076 TAGAAAATGCCAGCTGGTGAAGG + Intergenic
1035775208 8:2182458-2182480 CAGTGGATTCCAGCTGGTTTTGG + Intergenic
1036546622 8:9776734-9776756 TAGTGAATGCCTGCTGGTGAAGG + Exonic
1036899217 8:12658985-12659007 CACGGAGTGACAGCTGGTGACGG - Intergenic
1037779947 8:21861110-21861132 CTGGGAATTCCAGGTGATGTGGG - Intergenic
1038842926 8:31202921-31202943 CAGGGAATGGCTGTTGGTCTAGG - Intergenic
1039455601 8:37703907-37703929 CAGGGGCTGACAGCTGGTTTCGG - Intergenic
1040528129 8:48242162-48242184 CAGGACATGCCAACTGCTGTTGG - Intergenic
1041926033 8:63237262-63237284 AAGGAAATGCCAGCTGGTCGTGG - Intergenic
1041942953 8:63409036-63409058 CAGGGAAGACCAGCTGTGGTCGG - Intergenic
1042527748 8:69782053-69782075 CAGGGCCTGTCAGCGGGTGTGGG + Intronic
1045871144 8:106928242-106928264 CAATAAATGCTAGCTGGTGTTGG - Intergenic
1046285939 8:112092744-112092766 CAGGCAATGCCCACTGGTCTGGG - Intergenic
1046642061 8:116743160-116743182 CAGGCAAGGCCAGGTGGTGGTGG + Intronic
1046647371 8:116800893-116800915 CAGGGAACCCCATCTGGGGTTGG + Intronic
1048489420 8:134878855-134878877 CAGTAAATGTCAGCTGTTGTTGG + Intergenic
1048647301 8:136436366-136436388 CAGAAAATGCCAGCCAGTGTGGG - Intergenic
1051604535 9:18907020-18907042 CAGGGATTGTGAGCTGGTGGTGG + Intronic
1053350972 9:37413025-37413047 CAGGTAATGCCAGCTGCTGAGGG + Intergenic
1055723837 9:79206162-79206184 CATGGCAGGCCAGCAGGTGTTGG - Intergenic
1057885572 9:98827134-98827156 CTGGGAGTGCCAGCTGGAGAAGG + Intronic
1057904148 9:98971524-98971546 CAGTGAAGGCCAGCAGGTGCGGG - Intronic
1059326625 9:113507636-113507658 CAGGTACGGACAGCTGGTGTGGG + Exonic
1059431461 9:114252885-114252907 CCTGGAATGCCAGGTGGTATGGG + Exonic
1060884558 9:127141199-127141221 CAGGGAATGCCAGGGGTTGTGGG + Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061045708 9:128163792-128163814 GAGGGCATGCCAGGTGGTGGGGG - Exonic
1062456862 9:136644146-136644168 CAGGGAATGCCAGACGCTTTGGG - Intergenic
1062622302 9:137428571-137428593 AAGGGAAAGCCCACTGGTGTGGG + Intronic
1187307892 X:18113728-18113750 CAGTGAATGGCAGATGGTGGAGG - Intergenic
1187344018 X:18446681-18446703 CAGGGAATACCGACTGGGGTTGG - Intronic
1191214527 X:57921234-57921256 AAGGGAAAGCCAGCTGGGGTGGG - Intergenic
1195356982 X:104048353-104048375 CAGGCAATGGCAGGTGGTGGGGG + Intergenic
1197403965 X:126027722-126027744 CAGGCAGTGGCAGCTGGTGTTGG + Intergenic
1202089571 Y:21175810-21175832 CAGGAAACCCCAGCTGCTGTTGG + Intergenic