ID: 1175757363

View in Genome Browser
Species Human (GRCh38)
Location 20:61538286-61538308
Sequence GTGTCCTTCTCCCAGAGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 303}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175757363_1175757378 28 Left 1175757363 20:61538286-61538308 CCGTCACTCTGGGAGAAGGACAC 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1175757378 20:61538337-61538359 GCACCAGAGATTGGTAGGAGAGG No data
1175757363_1175757367 0 Left 1175757363 20:61538286-61538308 CCGTCACTCTGGGAGAAGGACAC 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1175757367 20:61538309-61538331 CTGCCATCTCCCCTCCCCAGGGG 0: 1
1: 0
2: 26
3: 101
4: 512
1175757363_1175757364 -2 Left 1175757363 20:61538286-61538308 CCGTCACTCTGGGAGAAGGACAC 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1175757364 20:61538307-61538329 ACCTGCCATCTCCCCTCCCCAGG 0: 1
1: 0
2: 6
3: 60
4: 573
1175757363_1175757377 23 Left 1175757363 20:61538286-61538308 CCGTCACTCTGGGAGAAGGACAC 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1175757377 20:61538332-61538354 CTGGTGCACCAGAGATTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 133
1175757363_1175757376 19 Left 1175757363 20:61538286-61538308 CCGTCACTCTGGGAGAAGGACAC 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1175757376 20:61538328-61538350 GGGGCTGGTGCACCAGAGATTGG 0: 1
1: 0
2: 2
3: 16
4: 199
1175757363_1175757366 -1 Left 1175757363 20:61538286-61538308 CCGTCACTCTGGGAGAAGGACAC 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1175757366 20:61538308-61538330 CCTGCCATCTCCCCTCCCCAGGG 0: 1
1: 0
2: 9
3: 82
4: 637
1175757363_1175757369 4 Left 1175757363 20:61538286-61538308 CCGTCACTCTGGGAGAAGGACAC 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1175757369 20:61538313-61538335 CATCTCCCCTCCCCAGGGGCTGG 0: 1
1: 0
2: 34
3: 79
4: 603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175757363 Original CRISPR GTGTCCTTCTCCCAGAGTGA CGG (reversed) Intronic
901862048 1:12080807-12080829 GTCTCATTCTCCCAAAGTGCTGG + Intronic
902143220 1:14374383-14374405 GTCCCCTTCTCCCACAGGGATGG - Intergenic
902363933 1:15958664-15958686 CTGTCCTTCTGCCCCAGTGAAGG - Intronic
902452249 1:16504178-16504200 GTCTCCTCCTCCCAAAGTGCTGG - Intergenic
902506292 1:16940635-16940657 GCGTCCATCTCCCAAAGTGCTGG + Intronic
903163782 1:21507322-21507344 GCCTCCTTATCCCAAAGTGATGG - Intergenic
903382923 1:22909247-22909269 GTGCCAGTCTCCCAGAGTGTGGG + Intronic
903965147 1:27083592-27083614 GTGTCATACTCTCAGAGTAAGGG - Intergenic
907878104 1:58514850-58514872 GTTTCCCTCTCCCAAAGTGGAGG - Intronic
907951590 1:59188887-59188909 GAGTCCTTCTCTCAGAAAGATGG - Intergenic
908997669 1:70177024-70177046 GTCTCCACCTCCCAGAGTGCTGG - Intronic
909566263 1:77056735-77056757 TTGTGTTTCTCCCAGGGTGAGGG + Intronic
910252779 1:85215574-85215596 GTTTCCTTCTCACAGAGTGTTGG - Intergenic
911633387 1:100207570-100207592 GTGTCAGTCTCCCAAAGTGTTGG - Intronic
912491914 1:110067091-110067113 GTGCCCCTCTCCCAAAGTGGAGG - Intronic
915286944 1:154859116-154859138 GTTACCTTCTCCCAAGGTGAGGG - Intronic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
916651149 1:166835829-166835851 TTCTCCATCTGCCAGAGTGAAGG - Intergenic
917342819 1:173996978-173997000 GTCTCCACCTCCCAGAGTGCTGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919038944 1:192357008-192357030 GTGTCTTTCTACCAGAGTATGGG - Intronic
919437505 1:197580345-197580367 GTCTCGGTCTCCCAGAGTGCTGG + Intronic
919665171 1:200284476-200284498 GCCTCCATCTCCCAGAGTGCTGG - Intergenic
920272087 1:204773286-204773308 GTGTCCTTCTCCCAAGGTGGAGG + Intergenic
921955741 1:220981639-220981661 GTCTCGGTCTCCCAGAGTGCTGG + Intergenic
922842813 1:228658028-228658050 GTCTCCTCCTCCCAAAGTGCTGG - Intergenic
924284300 1:242470090-242470112 GCCTCCGTCTCCCAGAGTGCCGG - Intronic
924354800 1:243161071-243161093 GTGTCAGCCTCCCAGAGTGCTGG - Intronic
924446265 1:244134847-244134869 GTTGTCTTCTTCCAGAGTGATGG + Intergenic
1063710722 10:8475553-8475575 GTTCCCTTCTCCCAGTGGGAAGG + Intergenic
1063969337 10:11370615-11370637 GCCTCCTTCTCCCAAAGTGCTGG - Intergenic
1064032171 10:11889760-11889782 GGGGCCCTCTCCCAGACTGAAGG + Intergenic
1064954637 10:20894218-20894240 GCATCGTTCTCCCAGAGTGCTGG - Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1065858309 10:29848770-29848792 GTGTCCACCTCCCAAAGTGCTGG - Intergenic
1066628035 10:37429312-37429334 ATGTCCTTTTCACTGAGTGAAGG - Intergenic
1068073201 10:52222053-52222075 TCCTCCTTCTCCCAGAGTCAGGG + Intronic
1069635430 10:69922027-69922049 GTGTCTGTCTCCCAGACTGCAGG + Intronic
1071462721 10:85913892-85913914 GTGTCCTCCTCCAAATGTGAGGG - Intronic
1071627769 10:87190306-87190328 GCCTCCGTCTCCCAGAGTGCTGG + Intronic
1071976959 10:90964834-90964856 GTGGCCTTCTCCTTGAGAGAGGG + Intergenic
1074752872 10:116603641-116603663 GTGTCCGCCTCCCAAAGTGATGG - Intronic
1075118735 10:119648949-119648971 GTCTCCGTCTCCCAAAGTGCTGG - Intergenic
1075675159 10:124291121-124291143 GTGTCCTTCATCCAGTCTGAGGG + Intergenic
1077210267 11:1367863-1367885 GTCTCCATCTCCCAGTGTGGGGG - Intergenic
1077640430 11:3876656-3876678 GCCTCCATCTCCCAAAGTGATGG + Intronic
1078051670 11:7970466-7970488 CTCTCCTTCTCCCAGCCTGACGG + Intronic
1078091885 11:8269070-8269092 GTGTCCGCATGCCAGAGTGAGGG + Intergenic
1078245558 11:9571130-9571152 GTCTCCGTCTCCCAAAGTGCTGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078746048 11:14115130-14115152 GTTTCCTTCTCCCATAATGGGGG - Intronic
1079355288 11:19725501-19725523 GTGTCCTTCTCCATTAGAGAGGG - Intronic
1080632632 11:34093116-34093138 GTCTCTGTCTCCCAGAGTGGTGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083616496 11:64028990-64029012 GGGTCCCTCTCCCAGAGTCCTGG - Intronic
1084383575 11:68828582-68828604 GGGCCCTTCTCCCAGCGTGCTGG - Intronic
1084628066 11:70324168-70324190 CTGTCCTTGTCCCAGGGTGCAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087301691 11:96443435-96443457 CTGGCCCTCTCCCAGAGGGAAGG + Intronic
1087442826 11:98207825-98207847 GTGTCATGCTCCCAGACTGTGGG - Intergenic
1088043485 11:105418216-105418238 GAGTCATTCTACCAGACTGATGG + Intergenic
1089998008 11:122927482-122927504 GTGTCTGTGTCCCAGAGTGCTGG - Intronic
1090291303 11:125547448-125547470 GTCTCAGTCTCCCAGAGTGCTGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092816844 12:12319708-12319730 TTGACCTTCTGCCAAAGTGATGG + Intergenic
1097241801 12:57580745-57580767 CATTCCTTCTCCCAGAGCGAAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098386667 12:69927025-69927047 GCCTCCTTCTCCCAGATTCAAGG + Intronic
1100988585 12:100228363-100228385 GTGTCAGTCTCCCAAAGTGCTGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101205305 12:102481273-102481295 GTACCCTTCTCCCAGAGTGGTGG - Intergenic
1101560751 12:105855532-105855554 GTGAAATTCTCCCAGCGTGAGGG - Intergenic
1101626681 12:106450267-106450289 GTTTCCTTCTTCAAGAGTAACGG - Intronic
1102710628 12:114923242-114923264 GTGTCATGCTCTTAGAGTGAAGG - Intergenic
1103244798 12:119447395-119447417 GTGTTCTTCTGCCTGATTGATGG - Intronic
1103601535 12:122057578-122057600 GGGTCTTTCTCCCAGGCTGATGG + Intronic
1104862539 12:131931406-131931428 GTCTCCGTCTCCCAAAGTGCTGG + Intronic
1105511949 13:21059714-21059736 GCCTCCGTCTCCCAGAGTGCTGG - Intronic
1108575326 13:51785400-51785422 GTGTACTTCTCCCACAGAGGTGG - Intronic
1112579718 13:100668105-100668127 TTGTCCTTCTCCGAGACTGTCGG - Intronic
1112686759 13:101837986-101838008 GTGTCCTTCTCCCATGGTGCTGG + Intronic
1112699669 13:101991882-101991904 TTGTCCTTCTCCCTGCGTGAAGG - Intronic
1114039674 14:18665621-18665643 GTGTCAGTCTCCCAAAGTGCTGG + Intergenic
1114044715 14:18864176-18864198 GTGTCAGTCTCCCAAAGTGCTGG + Intergenic
1114119508 14:19655349-19655371 GTGTCAGTCTCCCAAAGTGCTGG - Intergenic
1115006837 14:28496273-28496295 GTCTCCATCTCCCAAAGTGCTGG + Intergenic
1115675264 14:35666472-35666494 GTGTCAGTCTCCCAAAGTGTTGG + Intronic
1115742958 14:36407462-36407484 GTGGCTTCCTACCAGAGTGATGG - Intergenic
1115903699 14:38183675-38183697 GTGTGCATCTCCTACAGTGATGG - Intergenic
1120589268 14:86355972-86355994 GCCTCCTTCTCCCAAAGTGTTGG + Intergenic
1121270793 14:92636798-92636820 GCCTCCTTCTCCCAAAGTGCTGG - Intronic
1124006093 15:25796629-25796651 GGGACCTTCTCCCATAGTCATGG + Intronic
1124373610 15:29116936-29116958 ATGCCCATCTCCTAGAGTGAAGG - Intronic
1125619319 15:41045641-41045663 GTCTCATTCTCCCAAAGTGCTGG - Intronic
1126733242 15:51705944-51705966 TTGTCCTTATCCCAGAGTAATGG - Intronic
1127187202 15:56492273-56492295 GTGTCCTCCTCATAGCGTGAGGG - Intergenic
1127510993 15:59641102-59641124 ACCTCCTTCTCCCAGAGTGCTGG - Intronic
1127781479 15:62320319-62320341 CTGTCCTTCTCCCAGCTGGATGG + Intergenic
1128332001 15:66762075-66762097 GTGTTCTTCTTCCAGTCTGAGGG + Intronic
1129080142 15:73032406-73032428 GGGTCCTTGTCCTAGAGGGATGG + Intergenic
1129204992 15:74032280-74032302 GTTTCAGTCTCCCAGAGTGCTGG - Intronic
1129488557 15:75902088-75902110 GGCACCTTCTCCCAGAGGGATGG + Intergenic
1131034040 15:89209642-89209664 GACTCCTTCTCCCAGACAGATGG + Intergenic
1131070776 15:89464378-89464400 GTGTTCTTCTCCAAGTGTGAGGG - Intergenic
1132712087 16:1273465-1273487 GCCTCCTCCTCCCAGTGTGAGGG + Intergenic
1133879468 16:9766799-9766821 GGGTCCTTCTCCCCTAGGGATGG + Intronic
1134132392 16:11658579-11658601 GTCTCAGCCTCCCAGAGTGATGG - Intergenic
1134367715 16:13594814-13594836 GTTTCCTTCTCCTGGACTGAAGG + Intergenic
1135841580 16:25881685-25881707 GTGACCATCTACCACAGTGAAGG - Intronic
1136532846 16:30881596-30881618 TTTTCATTCTCCCAGTGTGAAGG + Intronic
1137539926 16:49355277-49355299 GGGTCCTGCCCCCAGGGTGAAGG + Intergenic
1139549093 16:67663620-67663642 GTGTCCTTCACCCTGAGTGTCGG + Intronic
1139819062 16:69705423-69705445 GTGTCTACCTACCAGAGTGAGGG + Intergenic
1139851547 16:69953564-69953586 GTGTCAGCCTCCCAGAGTGCTGG - Intronic
1139880523 16:70176476-70176498 GTGTCAGCCTCCCAGAGTGCTGG - Intronic
1139932686 16:70541728-70541750 GTCTCCTTCTTCCAGAGGCATGG - Exonic
1140371986 16:74419042-74419064 GTGTCAGCCTCCCAGAGTGCTGG + Intronic
1140585010 16:76278940-76278962 GGTTCCTTCTTTCAGAGTGATGG - Intronic
1140679860 16:77374464-77374486 GGGTCCTTCTCAGAGAATGAGGG - Intronic
1142896230 17:2980866-2980888 CATTCCTGCTCCCAGAGTGAGGG - Intronic
1145414784 17:22705607-22705629 GTGTCCAGCACCCAGAGTAATGG + Intergenic
1147873593 17:43605114-43605136 GTTGGCTTCCCCCAGAGTGACGG + Intergenic
1148069303 17:44898467-44898489 GCGTCTTTCTCCCAAAGTGCTGG + Intronic
1148287017 17:46402982-46403004 GCCTCATTCTCCCAGAGTGCTGG + Intergenic
1148309186 17:46620572-46620594 GCCTCATTCTCCCAGAGTGCTGG + Intronic
1150312988 17:64144877-64144899 GCCTCCGTCTCCCAGAGTGCTGG + Intergenic
1150782813 17:68136575-68136597 GCCTCATTCTCCCAGAGTGCTGG + Intergenic
1150782830 17:68136717-68136739 GCCTCATTCTCCCAGAGTGCTGG - Intergenic
1150900064 17:69263943-69263965 GTCTCGGTCTCCCAGAGTGCTGG + Intronic
1151496289 17:74460161-74460183 GCCTCCGTCTCCCAGAGTGTTGG + Intergenic
1155034491 18:22014299-22014321 GTTTCCTTCACCCAGAAAGATGG + Intergenic
1156435751 18:37127457-37127479 GCCTCCATCTCCCAAAGTGATGG - Intronic
1157598235 18:48876658-48876680 GGGTCCTTCCACCCGAGTGAGGG + Intergenic
1160346240 18:78134875-78134897 GTGTCCTTCCCCCAGGGAAATGG + Intergenic
1160346291 18:78135105-78135127 GTGTCCTTCCCCCAGGGAAATGG + Intergenic
1161099711 19:2415655-2415677 GTGTCCTCCTTCCAGAATGTGGG + Exonic
1161465830 19:4429765-4429787 GAGTCCCTGTCCCACAGTGAGGG + Exonic
1163539986 19:17902778-17902800 GTGTCATCCTCCCAAAGTGCTGG + Intergenic
1164096354 19:22013129-22013151 GTCTCGGTCTCCCAGAGTGCTGG + Intergenic
1164296255 19:23912767-23912789 GTGGCCTTCACGCTGAGTGAAGG - Intergenic
1165704410 19:37965561-37965583 GCGTCGTTCTCCCAAAGTGCTGG + Intronic
1166180975 19:41108632-41108654 GTGTCAGTCTCCCAAAGTGCTGG - Intergenic
925776674 2:7342779-7342801 GCCTCCTTCTCCCAGAGTGCTGG - Intergenic
926323352 2:11764394-11764416 GTCTCATTCTCCCAAAGTGCTGG + Intronic
927191534 2:20520260-20520282 CTGTCCCTCTCCCACAGGGATGG + Intergenic
928695552 2:33846216-33846238 GTGTCGGTCTCCCAAAGTGCTGG + Intergenic
928703405 2:33922189-33922211 GTGTCTTTTTCCCTCAGTGATGG - Intergenic
928945401 2:36767422-36767444 GTGTCCTCCTCCTAGATTCAAGG + Intronic
929056490 2:37881409-37881431 GTGTGCTTGTCCCAGGATGAGGG + Intergenic
929481013 2:42308251-42308273 TTGGCCTCCTCCCAAAGTGATGG - Intronic
930747019 2:54895306-54895328 ATGTCCATGTCCCAAAGTGATGG - Exonic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934983937 2:98870511-98870533 TTGGCCTTCTCCCAGGGAGAGGG + Intronic
937062447 2:118990728-118990750 GTGACCTTCTCCCAAAGTGGAGG + Intronic
940800973 2:158132003-158132025 TTATCCTTCTGCCAAAGTGAAGG + Intronic
941539452 2:166764515-166764537 GGGCCCTTCTCTCAGAGTGCAGG - Intergenic
941977166 2:171418190-171418212 GTGTCAATCTCCCAAAGTGCTGG + Intronic
942156538 2:173134517-173134539 TTGTCCTCCTCCCAAAGTGCTGG + Intronic
946281104 2:218666049-218666071 GCCTCCTTCTCCTAGAGGGAAGG + Exonic
947337491 2:229102630-229102652 TTGTTCTTATCACAGAGTGAGGG + Intronic
947644013 2:231724774-231724796 GTCTCCGTCTCCCAAAGTGCTGG + Intergenic
948566683 2:238891707-238891729 GCTTCCAGCTCCCAGAGTGAGGG - Intronic
948859637 2:240746590-240746612 GTGCCCTACTCCCTGAGCGAGGG - Intronic
948984713 2:241513649-241513671 GCCTCCTCCTCCCAGAGTGCTGG + Intergenic
1169426058 20:5498205-5498227 ATCTCCCTCTCCCAGAGTGATGG + Intergenic
1169428160 20:5512152-5512174 GTCTCCTTCTCCCAGGGTGATGG + Intergenic
1170619101 20:17979326-17979348 GTCTCCGTCTCCCAAAGTGCTGG + Intronic
1170750103 20:19137854-19137876 GAGTCATATTCCCAGAGTGATGG - Intergenic
1171428668 20:25064765-25064787 TTGTCCCTGGCCCAGAGTGACGG - Intergenic
1171989295 20:31683517-31683539 GCCTCGTTCTCCCAGAGTGCTGG - Intronic
1172429547 20:34877877-34877899 CTGTCCTTTACCCAGACTGAGGG - Intronic
1172456761 20:35081735-35081757 GTCTCGGTCTCCCAGAGTGCTGG - Intronic
1173110261 20:40180749-40180771 GCCTCCTCCTCCCAGAGTGCTGG + Intergenic
1174592243 20:51655338-51655360 GGCTCCATCTCCCAGAGTGCTGG - Intronic
1174798303 20:53540920-53540942 GTGTCTTCCTCCCAAAGTGATGG - Intergenic
1175757363 20:61538286-61538308 GTGTCCTTCTCCCAGAGTGACGG - Intronic
1176192236 20:63817320-63817342 GCCTCCTTCTCCCAGACTCAAGG - Intronic
1176278029 20:64285610-64285632 GTCTCTTGCTCCCAGTGTGACGG - Intronic
1176624071 21:9076080-9076102 GTGTCCTTGGCCCAGACTGCAGG + Intergenic
1176737111 21:10560503-10560525 GGGTGCTTCTAGCAGAGTGATGG - Intronic
1178702097 21:34842241-34842263 GTGTCGGCCTCCCAGAGTGCTGG - Intronic
1179177358 21:39018458-39018480 GTCTCCGTCTCCCAAAGTGCTGG - Intergenic
1179565402 21:42244807-42244829 GTGTGCCTCTCCCATAGGGAAGG - Intronic
1179587769 21:42384532-42384554 GTGTGCTTTTCTCATAGTGAAGG + Intronic
1179962972 21:44781250-44781272 TTATCCTTCCCCCAGAGTGGAGG - Intronic
1180463238 22:15586733-15586755 GTGTCAGTCTCCCAAAGTGCTGG + Intergenic
1180563109 22:16638025-16638047 GGGTGCTTCTAGCAGAGTGATGG - Intergenic
1180936294 22:19627376-19627398 GCTTCCTTCTCCCAGAGACAGGG - Intergenic
1183117944 22:35706341-35706363 GTCTCCGTCTCCCAAAGTGCTGG + Intergenic
1184591949 22:45490806-45490828 GTGTCCTTGTCCCAGACTGCGGG - Intergenic
1184836389 22:47024602-47024624 GTGTCAGTCTCCCAAAGTGCTGG - Intronic
1185171677 22:49298016-49298038 GTGTCCTTAGCCCAGAATGCCGG - Intergenic
950274349 3:11645720-11645742 GTCTCAGTCTCCCAGAGTGCTGG - Intronic
950447103 3:13044694-13044716 ATGTCCTTCTCCAGGAGTGTGGG - Intronic
950608821 3:14111320-14111342 GTGTCCCTCTCCTTGAGTGTGGG + Intergenic
951012097 3:17693144-17693166 GTCTGCAGCTCCCAGAGTGACGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
952687091 3:36162464-36162486 CTATCCTTCTCACAGATTGAGGG + Intergenic
952884083 3:38002201-38002223 CTGTCCCTGTCCCAGACTGATGG + Intronic
952894881 3:38071873-38071895 TAGTCCTTTTCCAAGAGTGAGGG + Intronic
953875944 3:46666996-46667018 CTGTCACTCTCCCAGAGGGACGG - Intergenic
954391043 3:50268013-50268035 GTGTCTGGCTCCTAGAGTGAAGG + Intronic
954876567 3:53806337-53806359 GTTTCCTGGCCCCAGAGTGAAGG - Intronic
956713910 3:72061803-72061825 GTATCCTGCTCCAAGGGTGAGGG + Intergenic
958414599 3:93858896-93858918 GTCTCATTCTCCCAAAGTGCTGG - Intergenic
959169862 3:102831154-102831176 GTGGGCTTCCACCAGAGTGATGG - Intergenic
959529318 3:107414360-107414382 GTGGCCATCTCACAGAGGGAAGG - Intergenic
960040304 3:113143662-113143684 GCTTCTTTCTCCCAGAGAGAGGG - Intergenic
961676209 3:128568394-128568416 GTGACCTTCTCCTGGAGTAAAGG - Intergenic
961818768 3:129564661-129564683 GGGTCCTTCTGGCAGAGTGCAGG + Intronic
963596782 3:147337591-147337613 GCGTATTTCTCCCAGACTGATGG + Intergenic
964461763 3:156939337-156939359 GGTTCCTTCTCCGACAGTGAAGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966854938 3:184187353-184187375 GTCACCTTCTCCCTGAGGGAAGG - Intronic
967029013 3:185588292-185588314 GTCTCGGTCTCCCAGAGTGCTGG + Intronic
968476862 4:814725-814747 GAGTCCCTGTGCCAGAGTGATGG + Intronic
969659731 4:8519508-8519530 GTTCCCATCTCCCAGAGTGAGGG - Intergenic
972989387 4:44804773-44804795 GTGTACTTATCCCAGCATGAGGG - Intergenic
974591987 4:63963416-63963438 GTCTCCATCTCCCAAAGTGCTGG + Intergenic
975410183 4:74039511-74039533 GAGACCTTCTCCCAGTGGGAGGG + Intergenic
979247002 4:118518585-118518607 GTGTCAGCCTCCCAGAGTGCTGG + Intergenic
979675855 4:123409731-123409753 CAGTTCTTCTCCCAGAGTAAAGG + Intergenic
980374131 4:131920705-131920727 GTCTCGTCCTCCCAGAGTGCTGG + Intergenic
984433283 4:179676106-179676128 GCCTCCGTCTCCCAGAGTGCTGG + Intergenic
984575565 4:181444133-181444155 ATGTCATTCTCTCAGAGTGTGGG - Intergenic
984720675 4:182970171-182970193 GTGTCAGCCTCCCAGAGTGCTGG - Intergenic
987224067 5:15821416-15821438 ATGTCCTTCTCCCTGTGCGACGG - Intronic
988428951 5:31096539-31096561 GTTTCCCTCTGCCACAGTGATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992175889 5:74148371-74148393 GTGTGCTCCTGCCAGAGTCAGGG + Intergenic
992763831 5:79976289-79976311 GTCTCGGTCTCCCAGAGTGCTGG - Intergenic
992948923 5:81837736-81837758 TTGTCCATCTCCCAGTATGAAGG + Intergenic
994111987 5:96016786-96016808 GTGACATTCTCTCAGAGTGCTGG + Intergenic
996022400 5:118605690-118605712 GTGTCCGTTTCCCAAAGTGCTGG + Intergenic
997158935 5:131586929-131586951 GTGTGCTTCTCCCAGTGTGCAGG - Intronic
999863785 5:155678741-155678763 GTGTCCTTATCCCAGAGTCCTGG - Intergenic
1000368823 5:160515718-160515740 GTAACTTTCTCCCAGACTGATGG - Intergenic
1001437366 5:171710598-171710620 GTGGCCTTGTCACAGAGGGAGGG + Intergenic
1002382131 5:178838732-178838754 CTGTCATCCTCCCAGAGGGACGG + Intergenic
1002648594 5:180674533-180674555 CTGTCATCCTCCCAGAGGGACGG - Intergenic
1005339500 6:24830213-24830235 GTCTCCGTCTCCCAAAGTGCTGG + Intronic
1005449028 6:25955189-25955211 GTGTCATCCTCCCAAAGTGTTGG + Intergenic
1005949507 6:30621065-30621087 CTGTCCTTCTCACATATTGAAGG - Intronic
1006098251 6:31669596-31669618 GTCTGCTTCTCCCAGAATCAGGG + Intronic
1006539353 6:34726913-34726935 GTCTCAGTCTCCCAGAGTGCCGG + Intergenic
1006580999 6:35078038-35078060 GCGTCCTTGTCCCAGGGAGAAGG - Intronic
1007068032 6:39012893-39012915 GTGTCCTAACCCCAGACTGATGG - Intronic
1008049409 6:46884771-46884793 GTCAACTTCCCCCAGAGTGAGGG - Intronic
1008288010 6:49678015-49678037 GTTTCTGTCTCTCAGAGTGAAGG + Intergenic
1008604672 6:53128789-53128811 TTTTCCTTCTCCAAGAGTTATGG - Exonic
1008693300 6:54005193-54005215 GTCTCCATCTCCCAAAGTGCTGG + Intronic
1010327277 6:74579216-74579238 ATGTCCTTGTGCCAGAGTGCAGG + Intergenic
1010964458 6:82187817-82187839 TTTTCCTTCTGCCAGAGTAAAGG - Intronic
1011898649 6:92263886-92263908 GTTTCTTTTTCCCAGAGTTAAGG - Intergenic
1012033528 6:94102581-94102603 CTATACTGCTCCCAGAGTGAAGG + Intergenic
1013405270 6:109837733-109837755 ATGTCCTCCTCCCAAAGTCAGGG - Intergenic
1013619862 6:111877828-111877850 GTGTCCCACTCTAAGAGTGAAGG - Intergenic
1013697040 6:112715895-112715917 GAGGGCTTCTCCCAGAATGAGGG + Intergenic
1014567694 6:122970360-122970382 GGCTCCTTCTCCAAGAGTGAAGG + Intergenic
1016125897 6:140402869-140402891 GTGTCCTTGTACCAGTGTTATGG - Intergenic
1016527886 6:145023243-145023265 GTAACCTTCGCCCAGACTGATGG + Intergenic
1017168687 6:151435096-151435118 GTCTCAGTCTCCCAGAGTGCAGG + Intronic
1017724506 6:157267744-157267766 GTGTCCTTCACCCAGGCCGAGGG + Intergenic
1018832870 6:167459037-167459059 GTATCCATCTCCCTGAGGGAGGG - Intergenic
1019727591 7:2611614-2611636 GTGTCCTCCTCCCATAGAGCAGG - Exonic
1019769538 7:2875007-2875029 GTGTCCTTGTCTGAGAGTCAAGG - Intergenic
1020069218 7:5214749-5214771 GTGGGCTTGTCCCAGAGTGCTGG - Intronic
1020249147 7:6453304-6453326 CTGTCCACCTCCCAGAGTGCTGG - Intronic
1020617855 7:10482214-10482236 GGTTGCTTCTCCCAGAGTTAGGG - Intergenic
1021992115 7:26149291-26149313 GCTTCCTTCCCCCAGAGTGAGGG + Intergenic
1022393743 7:29966352-29966374 GTGCCCTTCTTCCAGTGTGAAGG - Intronic
1024003709 7:45209897-45209919 GTCTCTGTCTCCCAGAGTGCTGG - Intergenic
1025899498 7:65732330-65732352 GTGTCGGTCTCCCAAAGTGCTGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030092182 7:105867442-105867464 GTCTCCTCCACCCACAGTGAAGG + Intronic
1030995346 7:116352752-116352774 CTTTCCTTCACCCGGAGTGAGGG - Intronic
1031972724 7:128075803-128075825 GCCTCCTCCTCCCAGAATGAGGG + Intronic
1033022558 7:137741064-137741086 GAGTGCTTGTCCGAGAGTGATGG + Intronic
1034641324 7:152605918-152605940 GTCTCATTCTCCCAAAGTGCTGG - Intergenic
1035478307 7:159159270-159159292 GGGTCTTCCTCCCAGAGTGGGGG - Intergenic
1036168674 8:6461844-6461866 GTGTATTTCTACCAGAGTGCTGG - Intronic
1037533345 8:19801601-19801623 GTGTCGGACTCCCAGAGTGCTGG - Intergenic
1037565812 8:20117490-20117512 GAGGGCTTCTCCCACAGTGAGGG + Intergenic
1037764588 8:21764581-21764603 GGGTCCTTCTAACAGAGAGAAGG - Intronic
1037898383 8:22673422-22673444 TAGTCATTCTCCCAGAGTGGAGG - Intergenic
1040856443 8:51953477-51953499 GTGTCAGCCTCCCAGAGTGCTGG + Intergenic
1040934357 8:52767232-52767254 GTGTCGACCTCCCAGAGTGCTGG - Intergenic
1044675904 8:94728311-94728333 GATTCCTTATCCCAGAGTAAGGG - Intronic
1045035746 8:98175295-98175317 GTGTCCGTCTGACAGATTGATGG + Intergenic
1046922901 8:119752449-119752471 GTGACCATATCCCAGAGGGAAGG - Intronic
1048300228 8:133245973-133245995 TTGTCCTTCCCCCAGTGCGAGGG + Intronic
1050320644 9:4448881-4448903 GTCTGCAGCTCCCAGAGTGATGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051624915 9:19090086-19090108 GTCTCAGTCTCCCAGAGTGCTGG + Intronic
1052628359 9:31005241-31005263 GTGCTCTTCTCCCAGGGAGATGG - Intergenic
1053198118 9:36135917-36135939 GTGTGCTGCTCCCAGGGTCAGGG + Intergenic
1055314056 9:75015534-75015556 GTGTCTTCCTCCCAAAGTGCTGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056737863 9:89225171-89225193 GTGTCCTTCGGGCACAGTGATGG - Intergenic
1057044978 9:91878657-91878679 GTGTGCTTCTCAGAGAATGATGG - Intronic
1057208055 9:93184911-93184933 GTGTCCTTGGCCCACAGAGATGG + Exonic
1058716727 9:107729093-107729115 GTGTCAGTCTCCCAAAGTGCTGG + Intergenic
1059134566 9:111793129-111793151 GTCTCGGTCTCCCAGAGTGCTGG + Intronic
1060525027 9:124315631-124315653 GTGCCCTTCTCCCCGAGTGAAGG + Intronic
1060807983 9:126589834-126589856 GTCTCAGTCTCCCAGAGTGCTGG - Intergenic
1060954866 9:127631462-127631484 GTGAAATTCTCCCAGAGCGAAGG - Intronic
1061666798 9:132164775-132164797 CAGTCCTTCACCCAGAGAGAGGG + Intronic
1061975695 9:134067301-134067323 GCGGCCTCCTCCCAGAGTTACGG - Intronic
1062053233 9:134457894-134457916 GTGTCCTTCGCCCAGAGGCCTGG - Intergenic
1062555315 9:137111171-137111193 CTGTCTTACTCCCAGAGTGCTGG - Intronic
1189288218 X:39866966-39866988 AGGTCCTTCTCCCAGGATGAGGG + Intergenic
1189560536 X:42187529-42187551 GATTCCTTCTCCTAGAATGAGGG - Intergenic
1189792451 X:44616807-44616829 GTCTCCGTCTCCCAAAGTGCTGG + Intergenic
1190262380 X:48805537-48805559 CTGCCCTTCACCCAGAGTGTTGG - Intronic
1192539836 X:71958425-71958447 ATGGCCTTCTCCCAGAGTTGAGG - Intergenic
1192566797 X:72171171-72171193 GTGTCATTATACCAAAGTGAGGG - Intergenic
1192586090 X:72319267-72319289 GTGTCGGTCTCCCAAAGTGCTGG + Intergenic
1193222565 X:78944077-78944099 GTTTCCTTCTCGCAATGTGAAGG + Intergenic
1193945468 X:87728278-87728300 CTGTCCTTCTTCCGGAGGGACGG - Intergenic
1194284026 X:91987329-91987351 GCCTCATTCTCCCAGAGTGCTGG + Intronic
1195516666 X:105784640-105784662 GTCTCGTTCTCCCAAAGTGCTGG + Intergenic
1200601593 Y:5211886-5211908 GCCTCATTCTCCCAGAGTGCTGG + Intronic
1201391760 Y:13504984-13505006 GTCTCGGTCTCCCAGAGTGCTGG + Intergenic
1202595366 Y:26533767-26533789 GGGTGCTTCTAGCAGAGTGATGG - Intergenic