ID: 1175759942

View in Genome Browser
Species Human (GRCh38)
Location 20:61555455-61555477
Sequence GATGAGACCCTGTCCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175759942_1175759947 8 Left 1175759942 20:61555455-61555477 CCCTCTGAGGACAGGGTCTCATC 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1175759947 20:61555486-61555508 GCCTCCCTCACTCTCCAGCCCGG 0: 1
1: 0
2: 5
3: 77
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175759942 Original CRISPR GATGAGACCCTGTCCTCAGA GGG (reversed) Intronic
900014264 1:137728-137750 GATGAGCTCCTGCCCTCCGATGG - Intergenic
900044127 1:492930-492952 GATGAGCTCCTGCCCTCCGATGG - Intergenic
900065536 1:727836-727858 GATGAGCTCCTGCCCTCCGATGG - Intergenic
900180452 1:1308835-1308857 GAAGCGGCCCTGGCCTCAGACGG + Intronic
900520040 1:3101002-3101024 GAGCAGCCCCTGTCCTCAGCCGG - Intronic
904132293 1:28283884-28283906 GAACAGACCCTTTCCTCACAGGG - Intergenic
904132443 1:28284962-28284984 GAACAGACCCTTTCCTCACACGG + Intergenic
904373836 1:30066986-30067008 GATGTGCCTCTGTCCTCAGGTGG - Intergenic
905143036 1:35864185-35864207 AATGAGACAAAGTCCTCAGAAGG - Intergenic
906855799 1:49302976-49302998 GATGAGATCATGTCCTTTGAAGG - Intronic
909373299 1:74912712-74912734 AATGAGACCCTGTCCTTTGCAGG - Intergenic
910609344 1:89124612-89124634 GACCAGACCCTGTCCGTAGAGGG - Intronic
910613805 1:89174627-89174649 GACCAGACCCTGCCCACAGAGGG - Intronic
912151628 1:106865753-106865775 GATGGGGTCCTGTCCTCAAAAGG + Intergenic
916889894 1:169105280-169105302 GCTGTGTCACTGTCCTCAGAGGG + Intergenic
917540014 1:175902914-175902936 GATAAGACCCTTTCCTCCAAGGG + Intergenic
918796396 1:188902561-188902583 GATTAGACCCTGGACTGAGATGG + Intergenic
922100321 1:222473385-222473407 GATGAGCTCCTGCCCTCCGATGG - Intergenic
922191289 1:223320775-223320797 GATGAGGCACTGTCCTGGGACGG - Intronic
922235226 1:223717631-223717653 GATGACACACTTTCCCCAGAGGG + Intronic
922734330 1:227971354-227971376 GATGAGCTCCTGCCCTCCGATGG + Intergenic
922734618 1:227972486-227972508 GATGAGCTCCTGCCCTCCGATGG + Intergenic
922802264 1:228369890-228369912 GATGAGGCCCTGACCGCAGATGG - Intronic
923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG + Intronic
1068630365 10:59291374-59291396 CAAGTGACGCTGTCCTCAGAGGG - Intronic
1068726698 10:60311252-60311274 AATGAAACTTTGTCCTCAGATGG + Intronic
1069646924 10:70006809-70006831 GGTGGGGCCCTGTCCTTAGAGGG - Intergenic
1071513448 10:86281837-86281859 GTTGAGACCCTGGCCTGGGAAGG + Intronic
1073215204 10:101832511-101832533 GATCAGGCCCTGTTCTCAGGAGG + Intronic
1073290653 10:102411706-102411728 CCTGAAGCCCTGTCCTCAGAGGG - Exonic
1073674572 10:105631241-105631263 AATGAGACCATGTCCTTTGAGGG - Intergenic
1075121532 10:119668187-119668209 GCTGAGACCCTGCCCTTGGAGGG - Intronic
1075998885 10:126899750-126899772 GATGAGATCATGTCCTCTGCAGG + Intergenic
1076970461 11:129405-129427 GATGAGCTCCTGCCCTCCGATGG - Intergenic
1077112123 11:866480-866502 GAGCAGTCCCTGTCCTCAGCAGG - Intronic
1077828858 11:5841370-5841392 GATGATACGATGTCCACAGAAGG + Exonic
1078192563 11:9104037-9104059 GATAGGGCCCTGTTCTCAGAAGG - Intronic
1079457460 11:20649424-20649446 GATGAAACCCTGTCCTTGGCTGG - Intronic
1080657622 11:34270224-34270246 GATGTAACACTGGCCTCAGAAGG + Intronic
1081570840 11:44289876-44289898 GATGAGACCCTGTCCCCGGCAGG + Intronic
1082625899 11:55485126-55485148 GGTGAGACCCTGTCTGCAAATGG - Intergenic
1085449859 11:76625259-76625281 GAGGAGGACCTGTCCTCAGGTGG - Intergenic
1086617388 11:88838315-88838337 GATGAGTCACTATCCCCAGAAGG - Intronic
1089642811 11:119858955-119858977 CATGAGACCCTGACCTGGGACGG - Intergenic
1091804770 12:3348003-3348025 GAGGGGACCCTGTCCCCAGGTGG + Intergenic
1095885394 12:47183751-47183773 GATGAGTCCCTGTCCTCACGTGG - Intronic
1096499095 12:52054689-52054711 GATGAGGCCCTGTCCTCCAGTGG + Exonic
1099979251 12:89580080-89580102 TATTAGACGCTGTCCTCAAAGGG + Intergenic
1100048889 12:90419789-90419811 GATGACACTCTGTCCTAGGAAGG - Intergenic
1101950993 12:109174849-109174871 GATGAGACCCTGTCTTTAAAAGG + Intronic
1102073529 12:110041792-110041814 GATGTGACCCTGACTTCAGGGGG + Exonic
1103977768 12:124714752-124714774 GACGAAACCCTGTTCTCAGCCGG + Intergenic
1104131410 12:125897867-125897889 GATGTGACACTGTCCTCAGCAGG + Intergenic
1104522467 12:129488046-129488068 GAGGACACCATGTCCTCACAAGG - Intronic
1104734265 12:131127482-131127504 GATGGGACCCTGAGCTCAGATGG + Intronic
1104734287 12:131127570-131127592 GATGGGACCCTGAGCTCAGGTGG + Intronic
1104734299 12:131127614-131127636 GATGGGACCCTGAGCTCAGGTGG + Intronic
1104734351 12:131127878-131127900 GATGGGACCCTGAGCTCAGGTGG + Intronic
1104734363 12:131127922-131127944 GATGGGACCCTGAGCTCAGGTGG + Intronic
1104734375 12:131127966-131127988 GATGGGACCCTGAGCTCAGGTGG + Intronic
1104734429 12:131128231-131128253 GATGGGACCCTGAGCTCAGGTGG + Intronic
1104734441 12:131128275-131128297 GATGGGACCCTGAGCTCAGGTGG + Intronic
1105372143 13:19811580-19811602 GATGAGACCATGTCCATATAAGG - Intergenic
1109810471 13:67507257-67507279 GACAAGACCCTGCCCTCATAGGG + Intergenic
1112478304 13:99752226-99752248 CATTAGCCTCTGTCCTCAGAGGG - Intronic
1113905807 13:113818701-113818723 GGGGAGGCCCTGGCCTCAGAGGG - Intergenic
1114260808 14:21034817-21034839 GATGAGCCCCTGTGCTAAGAGGG + Intronic
1117042492 14:51779608-51779630 GATGAGAACCCATCCGCAGAGGG + Intergenic
1118920613 14:70146316-70146338 GCTGAGTCCCTGTCTTCAAAAGG + Intronic
1120697549 14:87660349-87660371 GATGAGACCCAGTGCTCTGCTGG + Intergenic
1121442630 14:93958405-93958427 GATGCCACCCTGTCCTCTGAAGG + Intronic
1123105503 14:105839424-105839446 GGTCAGACACTGTCCTCAGAGGG + Intergenic
1124218409 15:27828379-27828401 GAGGAGCCCCTGCCCTCAGAGGG - Intronic
1124625674 15:31306340-31306362 CATGAGATGCTGTCCTCAGCCGG + Intergenic
1126360039 15:47836752-47836774 GATGCACCTCTGTCCTCAGAGGG - Intergenic
1127627520 15:60794932-60794954 GCTGAGATTCTGCCCTCAGAGGG + Intronic
1127707520 15:61561917-61561939 GATGAGTTCCTGTCCTCTGCAGG - Intergenic
1128811762 15:70578232-70578254 GATGAGGCTCTTTCTTCAGAGGG - Intergenic
1128966894 15:72068501-72068523 AATGAGACCCTGTCCCAAAAAGG - Intronic
1129762968 15:78142258-78142280 GATGAGGCCCTCTGCTGAGATGG + Intronic
1129888696 15:79056826-79056848 GATGGGGCCCTATGCTCAGAAGG + Intronic
1132915047 16:2339763-2339785 GATGAAGCCATGTCCTCAGGGGG - Intronic
1133518007 16:6528630-6528652 GATGAGCCCCTGCCCACAGCTGG - Intronic
1134135020 16:11672094-11672116 GAGGAGACCCTGTTCTCAGGGGG - Intronic
1137920700 16:52485751-52485773 GATGAGAGCATGACCCCAGATGG + Intronic
1141812637 16:86385708-86385730 GCTGAGACCCTGATCTCAAATGG + Intergenic
1141830515 16:86507734-86507756 GAGGAGACCCTGGCCTCCGGAGG - Intergenic
1142220304 16:88851023-88851045 CCTGGGACGCTGTCCTCAGAAGG - Intronic
1142314869 16:89337329-89337351 AATGAGACCCAGTGCTCAGCTGG - Intronic
1142449788 16:90168077-90168099 GATGAGCTCCTGCCCTCCGATGG + Intergenic
1142595040 17:1025803-1025825 GACGAGACCCTGTCTGCAGGAGG - Intronic
1143099020 17:4494787-4494809 GATGAGGCCCTGTCTAGAGATGG + Intergenic
1143186816 17:5014954-5014976 GATGTGGCCTTGTCCTCAGAGGG + Intronic
1144246790 17:13374198-13374220 GATAAGCCTCTGCCCTCAGAAGG - Intergenic
1144669758 17:17126384-17126406 GCTGAGATCCTGGTCTCAGAAGG - Intronic
1146666800 17:34710509-34710531 GATGAGACCCAGGCTTCTGAAGG - Intergenic
1146741207 17:35285291-35285313 GATCAGACCATGTCCACAGAAGG - Intergenic
1147584135 17:41643322-41643344 GATGAGAACCTCTGCTCTGAGGG - Intergenic
1147914055 17:43876322-43876344 GGGGGGAGCCTGTCCTCAGAGGG - Intronic
1148434656 17:47673669-47673691 GATCAGAAGCTGTTCTCAGAAGG + Intronic
1150660548 17:67072408-67072430 CAGGAGTCCCTGTCCTAAGATGG - Exonic
1151281911 17:73082685-73082707 GATGTGATCCTGTCCTTTGAAGG - Intronic
1151667953 17:75556353-75556375 GATGCGACCCTGTCCTTTGCAGG + Intronic
1152294927 17:79461554-79461576 GCCGAGACCCTGTGCTCAGCAGG - Intronic
1152339222 17:79715219-79715241 CATGAGATCCTGTCCCCTGATGG + Intergenic
1156776378 18:40793818-40793840 GATGAGTTCCTGTCCTTTGAAGG - Intergenic
1159067412 18:63585730-63585752 GATGAGAATCTGTCACCAGATGG + Intergenic
1159369757 18:67516075-67516097 GCCGAGTCCCTGTCCTCAGGTGG + Intronic
1159546197 18:69841756-69841778 GGACAGACCCTGTGCTCAGATGG - Exonic
1160409883 18:78668059-78668081 GATGAGAGCCTGTCCTTACACGG - Intergenic
1160647657 19:200874-200896 GATGAGCTCCTGCCCTCCGATGG - Intergenic
1161959712 19:7516641-7516663 CAGGAGGCCCTGTCCTCAAAAGG + Intronic
1162269774 19:9604730-9604752 GATGAAACCCTCTGCTCTGACGG + Intronic
1162716556 19:12638093-12638115 GCTGCGATCCTGTCCTCAGGAGG + Intronic
1164856434 19:31528213-31528235 GAAGAGACCCTGCCCTCATGAGG + Intergenic
1164942304 19:32260545-32260567 GATGAGATCCTGTCCTTTGCAGG + Intergenic
925473581 2:4188748-4188770 GATCAGGCCATGTCCTCACATGG - Intergenic
926213666 2:10890311-10890333 GGTGAGAGCCAGTGCTCAGATGG + Intergenic
927623535 2:24688067-24688089 AATGAGACCATGTCCTCTGCAGG - Intronic
928170965 2:29002726-29002748 GTTGAGACCCGGTGCTCAGGAGG + Exonic
935349342 2:102140403-102140425 ACTGAGACCCTGTCCCCTGAGGG - Intronic
936140090 2:109932078-109932100 GGAGAGACACTGCCCTCAGAGGG - Intergenic
936176779 2:110230023-110230045 GGAGAGACACTGCCCTCAGAGGG - Intergenic
936204606 2:110439408-110439430 GGAGAGACACTGCCCTCAGAGGG + Intronic
937750719 2:125473532-125473554 CAAGTGACCCTGTGCTCAGAGGG + Intergenic
937964089 2:127487931-127487953 GATGAGACCGTGGCTTCAGAAGG - Intronic
938947894 2:136230314-136230336 GAAGAGACTCTGTCTTCAGTCGG + Intergenic
940999903 2:160190737-160190759 AATGAGACCCTGTCCTTAATCGG - Intronic
941408174 2:165118598-165118620 AATGAGACCCTGTCCCAAGGGGG - Intronic
945266388 2:207895342-207895364 GATCAGTCCCTGTCCCCAGCAGG + Intronic
948534248 2:238634446-238634468 GATGAGACCCTCGGCTCAGAGGG + Intergenic
1169171019 20:3465423-3465445 GATGAAACCCTGTCCAAAAATGG - Intergenic
1171363730 20:24609525-24609547 GATGAGTCCCTGGACTCAGCTGG + Intronic
1175759942 20:61555455-61555477 GATGAGACCCTGTCCTCAGAGGG - Intronic
1177250234 21:18582896-18582918 GCTGAGAACCTGTCCTGGGAAGG - Intergenic
1177964120 21:27705638-27705660 AATGAGATCCTGTCCTCTGTGGG - Intergenic
1179532917 21:42032342-42032364 GGTGCCACGCTGTCCTCAGAGGG + Intergenic
1180148761 21:45936895-45936917 GAAGAGACCCACTTCTCAGAAGG + Intronic
1181150995 22:20883465-20883487 ACTTAGACCCTGTCCCCAGAGGG + Exonic
1181939481 22:26464238-26464260 GAGCAGACCCTCTCCCCAGAAGG - Exonic
1182483956 22:30628021-30628043 GAAGAGGTCCTGTCCTCAGTGGG + Intergenic
1183520999 22:38295962-38295984 GATGTGACTCTGCCCGCAGAAGG - Intronic
952550063 3:34466632-34466654 GATGAGTCCATGTCCTTTGAAGG - Intergenic
954145886 3:48634108-48634130 GATGAGACCCTCCCCTCTAAGGG + Intronic
954198152 3:49008155-49008177 GCTGAGACCCCCTCCTGAGATGG + Intronic
954426272 3:50444802-50444824 GATGAGCCCATGTCCTCTCATGG + Intronic
954812000 3:53254442-53254464 TAAGACACCCTGTTCTCAGAAGG - Intronic
956833169 3:73073298-73073320 GATGAGGCCCTTACCTCACAGGG + Intergenic
958471266 3:94523855-94523877 GATGAGACCCAGCACTGAGAAGG + Intergenic
959914508 3:111801253-111801275 AATGTGGCCCTGTGCTCAGAGGG - Intronic
961051098 3:123747744-123747766 GAGGAGATCCAGACCTCAGATGG - Intronic
961494167 3:127278694-127278716 GATGACCCCCTGCCCTCAGGTGG - Intergenic
968045128 3:195619698-195619720 GCCGAGACCCTGTCCACAGCCGG + Intergenic
968060983 3:195726035-195726057 GCCGAGACCCTGTCCACAGCCGG + Exonic
968370190 3:198219241-198219263 GATGAGCTCCTGCCCTCCGATGG + Intergenic
968477408 4:818543-818565 GATGAGACGCTGACCTGAGCTGG + Intronic
968647468 4:1747883-1747905 GATGAGACCCCGCCGTCCGAGGG + Intergenic
969530530 4:7727945-7727967 GATGAGAGGCTGACCTCATAGGG + Intronic
970419651 4:15893473-15893495 GATGGGACCCTGACCTGACAGGG + Intergenic
971343859 4:25794884-25794906 AATGAGATCATGTCCTCTGAAGG + Intronic
971989685 4:33876051-33876073 AATGAGACCCTGTCCTTTGTAGG - Intergenic
972670749 4:41212586-41212608 GTTGAGATCCTTTCCACAGAAGG - Intronic
983202040 4:164871745-164871767 GATTAGCTCCTGCCCTCAGATGG - Intergenic
983423165 4:167546803-167546825 AATGAGACCATGTCCTTTGAAGG - Intergenic
984064082 4:175026544-175026566 GATCAGACCATGTCCACATAAGG - Intergenic
986288563 5:6378991-6379013 GGTGAGACCCTGACCTACGAAGG - Intergenic
990865469 5:60375229-60375251 GATATGTCCCTGTCCTCATAGGG - Intronic
994140867 5:96339746-96339768 GAAGAGTTCCTGTCCTCAGCAGG - Intergenic
995174662 5:109161553-109161575 AATGAGATCCTGTCCTTTGAAGG - Intronic
1000080127 5:157837359-157837381 AGTGAGACCCTGTCCAAAGAAGG + Intronic
1001457396 5:171874930-171874952 AGTGAGACCCTGTCTTCAAAAGG + Intronic
1002299212 5:178248030-178248052 GGTGAGACTCTGTTCTCAGAGGG + Intronic
1002729716 5:181325999-181326021 GATGAGCTCCTGCCCTCCGATGG + Intergenic
1004444080 6:15681706-15681728 AATGAAACCCTTTTCTCAGAAGG - Intergenic
1004901217 6:20196012-20196034 GATGAGGCCCTCCCCACAGAGGG + Intronic
1005847618 6:29793419-29793441 GATGGCACCCATTCCTCAGAGGG - Intergenic
1005867822 6:29949391-29949413 GATGGCACCCATTCCTCAGAGGG - Intergenic
1006360487 6:33584491-33584513 GGTGGGTCCCTGTCCTCACAGGG - Intergenic
1007357888 6:41334184-41334206 AAGGCGGCCCTGTCCTCAGATGG - Intergenic
1007749787 6:44064840-44064862 GCTCAGCCCCTGCCCTCAGAGGG + Intergenic
1007857097 6:44869070-44869092 GATGAGACTCTGTGCTCACATGG + Intronic
1009273458 6:61645141-61645163 AATGAGATCCTGTCCTATGAAGG + Intergenic
1012063569 6:94517381-94517403 AATGAGACCATGTCCTTTGAAGG + Intergenic
1012379718 6:98605660-98605682 GAGAATACCCTGTCCTCCGATGG + Intergenic
1017812034 6:157990410-157990432 GGTGAGGCCCTGTCCTCAGGGGG - Intronic
1018760487 6:166890666-166890688 GATGAGTTCATGTCCTCTGAGGG + Intronic
1019527198 7:1485819-1485841 AATGAGACCCTGTCTTAAAAAGG - Intronic
1019636075 7:2076378-2076400 GACCAGCCCCTGTCCTCACAGGG - Intronic
1022386577 7:29904955-29904977 GATGAGACCCTGTCATGTGCAGG - Intronic
1026530715 7:71194917-71194939 GATGAGAAGCTGTGGTCAGATGG - Intronic
1027721190 7:81743653-81743675 GATGATACTCTGTCCTTAGTGGG - Intronic
1029532118 7:101132340-101132362 GATGAGACCCTGGAGTCAGGTGG - Intronic
1032051435 7:128653120-128653142 GATGAGCTCCTGCCCTCCGATGG + Intergenic
1032555160 7:132825098-132825120 TTTGAGTCCCTGCCCTCAGAGGG - Intronic
1035152521 7:156886451-156886473 AATGAGGCCCTGTAGTCAGATGG + Intronic
1035662605 8:1359273-1359295 GGGAAGACCCTGTCCTCAGGCGG + Intergenic
1036505335 8:9349692-9349714 GATGAGACCATTTACTCACACGG - Intergenic
1037892073 8:22628771-22628793 GAGCAGACCCTGCCCACAGAGGG - Intronic
1038396001 8:27245845-27245867 GATAGGACCCTGTGCTCAGGGGG + Intronic
1041981527 8:63866650-63866672 CATAAGGCCCTGTCCTAAGAAGG - Intergenic
1042169758 8:65980093-65980115 GTTCAGACCATGTCTTCAGATGG + Intergenic
1047415630 8:124662576-124662598 GTCTAGACCCTGTCTTCAGAGGG - Intronic
1048294697 8:133205740-133205762 GATGAGCCCCAGCCCCCAGAAGG + Intronic
1050439147 9:5642347-5642369 GATGAGACCCAGTGCTCTGCTGG - Intronic
1051108673 9:13610153-13610175 GATGGGACCGTTTCCTCAAAAGG - Intergenic
1052478259 9:28989992-28990014 GATGAACCCGTTTCCTCAGATGG - Intergenic
1056113234 9:83416926-83416948 GATGAAACAGTGTGCTCAGATGG - Intronic
1057281956 9:93719798-93719820 GATGAGGCCAAGTCATCAGAAGG - Intergenic
1057503802 9:95616460-95616482 GATGAGATGCTGTCCTTTGAGGG - Intergenic
1060599518 9:124868898-124868920 GAGGAGCCCCTGGCCTCAGCGGG - Exonic
1062278245 9:135740642-135740664 GCTGAGACCCTCTCCTGGGAGGG + Intronic
1062441566 9:136571956-136571978 CAGGAGACCCCGTCCTGAGAAGG - Intergenic
1062583157 9:137237126-137237148 AATGAGACCCTGTCCCGGGAAGG + Intergenic
1062754130 9:138278511-138278533 GATGAGCTCCTGCCCTCCGATGG + Intergenic
1203577688 Un_KI270745v1:21268-21290 GATGAGCTCCTGCCCTCCGATGG + Intergenic
1185972817 X:4683555-4683577 GAAGAAACGCTGTCCTCAGAAGG + Intergenic
1187247843 X:17568977-17568999 GATGAGTTCCTGTCCTTTGAAGG - Intronic
1187762942 X:22607961-22607983 AATGAGATCATGTCCTCTGAAGG + Intergenic
1192210345 X:69123797-69123819 GATGAGACCCTGGTCTCTGGTGG + Intergenic
1192390368 X:70720198-70720220 GATGAGTCCCTGTCCTATGTAGG + Intronic
1192495098 X:71611164-71611186 GATGAGGGCCTGTCCTTGGATGG - Intronic
1192863980 X:75110123-75110145 GATTAGACCCTTTCCTTAAATGG + Intronic
1192964884 X:76166751-76166773 AATGAGACCCTGTTCTAAAATGG + Intergenic
1193655300 X:84189961-84189983 GATGAGACCCAGCGCTCAAAAGG - Intergenic
1194503829 X:94708660-94708682 GCTCAGACCCTGGCTTCAGAGGG - Intergenic
1194766932 X:97852383-97852405 GATGATACCCTGTCCTGGGTTGG + Intergenic
1195704332 X:107728061-107728083 GATAAGCCCCTGCCCTCACAAGG - Intronic
1196126271 X:112103248-112103270 AATGAGACCCTGTCCTTTGCAGG + Intergenic
1196260160 X:113569549-113569571 GATGAGATCCTGTCCTTTGCAGG - Intergenic
1196973096 X:121130970-121130992 GATGAAACCCTTTCCAGAGAAGG + Intergenic
1196984444 X:121253255-121253277 GATGAGACCCTGTGCTATGATGG - Intergenic
1197894033 X:131292023-131292045 GATCTGACACAGTCCTCAGATGG - Intronic