ID: 1175761312

View in Genome Browser
Species Human (GRCh38)
Location 20:61563676-61563698
Sequence TGGAAGGGAGCTGCATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175761312_1175761321 14 Left 1175761312 20:61563676-61563698 CCTGCAAATGCAGCTCCCTTCCA 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1175761321 20:61563713-61563735 CACCCCTCATTGGGAACACAGGG 0: 1
1: 0
2: 0
3: 14
4: 122
1175761312_1175761313 -9 Left 1175761312 20:61563676-61563698 CCTGCAAATGCAGCTCCCTTCCA 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1175761313 20:61563690-61563712 TCCCTTCCAGCTGAAGTGCCTGG 0: 1
1: 0
2: 1
3: 22
4: 215
1175761312_1175761317 4 Left 1175761312 20:61563676-61563698 CCTGCAAATGCAGCTCCCTTCCA 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1175761317 20:61563703-61563725 AAGTGCCTGGCACCCCTCATTGG 0: 1
1: 0
2: 1
3: 9
4: 129
1175761312_1175761318 5 Left 1175761312 20:61563676-61563698 CCTGCAAATGCAGCTCCCTTCCA 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1175761318 20:61563704-61563726 AGTGCCTGGCACCCCTCATTGGG 0: 1
1: 0
2: 0
3: 15
4: 115
1175761312_1175761320 13 Left 1175761312 20:61563676-61563698 CCTGCAAATGCAGCTCCCTTCCA 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1175761320 20:61563712-61563734 GCACCCCTCATTGGGAACACAGG 0: 1
1: 0
2: 1
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175761312 Original CRISPR TGGAAGGGAGCTGCATTTGC AGG (reversed) Intronic
902578249 1:17392108-17392130 TGGCAGGGAGCTGCAGCTGCAGG + Exonic
902659492 1:17891316-17891338 TGGAAAGGAGGTGCAATCGCAGG + Intergenic
902668120 1:17953504-17953526 TGGATAGGAGCTGCAGCTGCAGG + Intergenic
902715612 1:18270544-18270566 GGGAAGGAAGCTGCATGTGTTGG - Intronic
903482057 1:23660928-23660950 TGGAAGGGAGCTGCATTAAGAGG - Intergenic
904326674 1:29731071-29731093 TGGAAATGAGCTGCTTTTGTAGG + Intergenic
904720821 1:32507245-32507267 TGAAAGGGAATGGCATTTGCAGG - Intronic
905245544 1:36610674-36610696 GGGAAGGGAGAAGCATTTGAAGG + Intergenic
909385603 1:75052643-75052665 TGGAAGGGAGCTGCTTTACGGGG - Intergenic
910369718 1:86503165-86503187 TTAAAGGGACCTGCATTTGTTGG + Intergenic
911075791 1:93873601-93873623 TGGGAGGGAGCTGGGTTTGGGGG - Intronic
915074078 1:153294675-153294697 AGGAAGGAAGGGGCATTTGCCGG + Intergenic
917432116 1:174981087-174981109 TTGAAGAGTGCTGCATTTGGTGG - Intronic
918203228 1:182286826-182286848 TGTAAGGGAGCTGCCACTGCAGG - Intergenic
918290294 1:183100872-183100894 TGGCACTGAGCTTCATTTGCAGG - Intronic
918352741 1:183674497-183674519 TGGAAGGAAGCTGAGTTTGGTGG + Intronic
920940358 1:210476536-210476558 TGTAAGAGAGCTGCATAGGCTGG - Intronic
921089009 1:211825063-211825085 TGGAAGGGAGCTGAAATGCCAGG - Intronic
921637415 1:217512634-217512656 TGGAGGCCAGCAGCATTTGCTGG + Intronic
922652948 1:227356705-227356727 TGGCAGGGAGTTTCATTTCCTGG - Intergenic
924797129 1:247300542-247300564 TGGAACGGCGCTTCATGTGCAGG + Exonic
1066059352 10:31708294-31708316 CAGAAGGGAGCAGCATCTGCTGG + Intergenic
1066739706 10:38508970-38508992 TGGAATGGAACTGCATTTAATGG + Intergenic
1066768146 10:38821538-38821560 TGGAAGGGACCTGAATTTAATGG + Intergenic
1067557359 10:47282309-47282331 AGGAAGGGGGCTGCATTGGGAGG - Intergenic
1069791706 10:71026828-71026850 TGGAAAGGAGCTGCATGAGCAGG - Intergenic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1072303479 10:94084822-94084844 TTGAAGGAAGCCGCAATTGCTGG - Intronic
1072577855 10:96716939-96716961 TGAAAGAGAGGTGCCTTTGCAGG + Intronic
1074051393 10:109884032-109884054 TGGAAGGGAGTTCCAGATGCAGG + Intronic
1074545106 10:114396047-114396069 TGGAAGAGACCTGCCTTTGTGGG + Intronic
1077108288 11:851211-851233 TGGAGGGCAGCTGCAGTTGGGGG + Intronic
1078514175 11:12008749-12008771 TGTAGGGGAGCTGCGTTTTCAGG - Intronic
1078604837 11:12765945-12765967 AGAAAGGGAGCTGCATTTTCAGG - Intronic
1078999521 11:16739468-16739490 AGGAAGGGAACGGCATTTGATGG - Intronic
1079711016 11:23681222-23681244 TGGAAGGCAGCTGCAGCAGCAGG - Intergenic
1080108774 11:28541752-28541774 GGGAAGGGTAATGCATTTGCAGG + Intergenic
1080896963 11:36455371-36455393 TTGAAAGGAGCTGCTCTTGCTGG + Intronic
1088771235 11:113037873-113037895 AGGAAGAGAGCTGTATTTTCAGG - Intronic
1089674307 11:120079760-120079782 TGTCAGGGAGCTGGAGTTGCTGG + Intergenic
1089943291 11:122441511-122441533 TGGAAACGTGCTGCATCTGCGGG + Intergenic
1090382226 11:126335479-126335501 TGGCAGGGAGCTGCATCCACGGG - Intronic
1090450626 11:126802960-126802982 TGTAAGGGAGCTGTATTCCCTGG + Intronic
1090611237 11:128472751-128472773 TAGAATGGAGCTGCAGTTGAGGG + Intronic
1090920840 11:131204680-131204702 TGGAAGGGAGCGTCAATTGGAGG + Intergenic
1091026025 11:132141990-132142012 CAGAAGGGAGCTGGAGTTGCAGG + Intronic
1092388596 12:8055056-8055078 TGGAAGGGAGCTGGAATCTCAGG - Exonic
1093448533 12:19288374-19288396 TGGAAAGGAGTTACATTAGCAGG + Intronic
1093662695 12:21775009-21775031 TGGAAAGGAGCTGGCTCTGCAGG - Intronic
1094837958 12:34331038-34331060 TGGAAGGCACCTTCATCTGCGGG + Intergenic
1095367023 12:41419555-41419577 TGGAAAGCAGATGCATTGGCAGG + Intronic
1097154975 12:57006123-57006145 GGGAAGGGCGCTGCATCGGCTGG + Intronic
1100864187 12:98838636-98838658 TGGAAGGGAGTTCCAAATGCAGG - Intronic
1103519872 12:121531159-121531181 TGGAAGGGAACTGCACTTGGTGG - Intronic
1105669634 13:22598297-22598319 TGGAATAGAGAAGCATTTGCTGG - Intergenic
1106269591 13:28139418-28139440 TGGAAAGGGGCTGGGTTTGCAGG + Intronic
1106383477 13:29262892-29262914 TGAAAGAGAGCTGCTTCTGCTGG + Intronic
1108171639 13:47748086-47748108 TGGGAAGGAGCTGCACCTGCTGG - Intergenic
1108682297 13:52790641-52790663 AGGGAGGGAGCTGGCTTTGCAGG - Intergenic
1108894823 13:55312971-55312993 TGGAAGAGAAATGCATTTGTAGG - Intergenic
1109083057 13:57932127-57932149 TTGCAGGGAGCTGCTTTTACAGG - Intergenic
1109190004 13:59312845-59312867 GGGAAGTGCACTGCATTTGCAGG + Intergenic
1111020332 13:82439812-82439834 TGCATGGGAGGTGCAGTTGCTGG + Intergenic
1112412843 13:99178841-99178863 CAGAAAGCAGCTGCATTTGCTGG - Intergenic
1112733554 13:102394183-102394205 GGGAAGGGAGCTGGCGTTGCTGG - Intronic
1113046376 13:106159688-106159710 TGGAACAGGGCTGCATTTCCAGG - Intergenic
1113449292 13:110395241-110395263 TTGAAGGGAACTGGCTTTGCTGG - Intronic
1114200436 14:20515128-20515150 TGAATGGCAGCTGCATTTGGTGG + Intergenic
1116763704 14:49045507-49045529 TGGAAGGCAGCTGCGATTGTGGG + Intergenic
1117531290 14:56662830-56662852 TAGAAGGCAGTTGCATTGGCCGG + Intronic
1117895880 14:60485915-60485937 TGGAAGGGAGCTGCATGTGGCGG - Intronic
1118686055 14:68292176-68292198 TATAAGGGAGCTCCATTTGGAGG + Intronic
1119215212 14:72864232-72864254 TGGGAGGGAGAGGCATTTGTCGG - Intronic
1122860973 14:104582235-104582257 TGGGAGGGAGCAGCAGTGGCTGG + Intronic
1125350164 15:38758318-38758340 TGGAAGGTAGCTGCAAGAGCAGG + Intergenic
1126785226 15:52173211-52173233 TGAAAGGGAGCTGAAATTGTAGG + Intronic
1127543947 15:59972152-59972174 TTGAAGGCAGCTACATTTGGAGG - Intergenic
1127711186 15:61599889-61599911 TGGAAGGAAGCAGTATTTGTGGG + Intergenic
1127938368 15:63666406-63666428 AGCAAGGGAACTGCAATTGCTGG + Exonic
1128836543 15:70813417-70813439 TCGAAGGGAGCACCATTTGAAGG + Intergenic
1129600320 15:76994879-76994901 TGGAAGGGTGCTGGACTGGCTGG + Intronic
1131221197 15:90585745-90585767 AGGAAGGGAACTGGAGTTGCTGG - Intronic
1132358041 15:101187830-101187852 AGGAAGGGAGATGGCTTTGCTGG - Intronic
1132374762 15:101321690-101321712 AGGCAGGGAGCTGCTTTTGCAGG - Intronic
1133546330 16:6811192-6811214 TTGAAGAGACCTGCCTTTGCAGG + Intronic
1134684754 16:16150657-16150679 TGGCACGGAGCTGCAGATGCAGG - Exonic
1135487308 16:22877437-22877459 TAGAAGGAAGCTCCATTTCCCGG - Intronic
1135669867 16:24366087-24366109 GGAAAGGGAGCTGCATTTGAGGG - Intergenic
1138955075 16:61961653-61961675 TGGAAGAGAGCTACAGTTGTGGG - Intronic
1139205877 16:65027884-65027906 GGGAAGGGACTTGCATTTGAAGG + Intronic
1139297926 16:65919131-65919153 TGCAGGGGAGCTGCATCTCCCGG - Intergenic
1139933608 16:70550555-70550577 TGGAAGACTGCTGCATGTGCAGG - Intronic
1142113893 16:88346436-88346458 GGCATGGGAGCTGCATGTGCAGG - Intergenic
1143491483 17:7287634-7287656 TGGAAGGGTGCTGCATCCACAGG + Exonic
1143933378 17:10455658-10455680 TGGAAGGCATCCGCATCTGCAGG - Exonic
1143937822 17:10505856-10505878 TGGAAGGCATCCGCATCTGCAGG - Exonic
1144887060 17:18470501-18470523 TGGAAGGGAGGTGCAGATCCTGG - Intergenic
1145145156 17:20473794-20473816 TGGAAGGGAGGTGCAGATCCTGG + Intergenic
1146669202 17:34725149-34725171 TGGGAGGGAGGGGCAGTTGCAGG - Intergenic
1147455245 17:40533720-40533742 TGGAGGGGAGCTGCATGTGCTGG + Intergenic
1148646793 17:49223956-49223978 TGGAAGGCAGCAGTATTTCCTGG - Exonic
1150440292 17:65185878-65185900 CTGCAGGGAGCTGTATTTGCAGG - Intronic
1151612405 17:75184818-75184840 CTGGATGGAGCTGCATTTGCTGG + Intergenic
1153543958 18:6186699-6186721 CGGAAGGAAGGTGCGTTTGCTGG - Intronic
1154138310 18:11800508-11800530 TGTGTGGGAGCAGCATTTGCTGG + Intronic
1155225522 18:23726162-23726184 GGGAGGGGTGCTGCATTTCCCGG - Intronic
1157580999 18:48774102-48774124 TGGAAGGGAGGCGCTGTTGCAGG + Intronic
1158564771 18:58545448-58545470 TGGAAGGGAGCTCAAGGTGCTGG + Intronic
1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG + Intergenic
1161569450 19:5022559-5022581 TGGAAGTGGGCTCCAGTTGCTGG - Intronic
1161905413 19:7152818-7152840 TGGACAGGAGCAGCATTCGCCGG + Exonic
1163433865 19:17283608-17283630 TGGAAGCCAGCAGCATTTGGTGG - Exonic
1164684253 19:30156690-30156712 TGGAAGGGACCTGGACCTGCTGG + Intergenic
1166073588 19:40400707-40400729 TGGCACGGGCCTGCATTTGCAGG - Intronic
1166653852 19:44595836-44595858 GGAAAGGGAGCTGCCTTTGCGGG + Intergenic
1167405515 19:49305225-49305247 TGGAAGAGAGCAGCCCTTGCTGG + Intronic
925307402 2:2859001-2859023 AGGAAGGGAGATGGATTTGGGGG - Intergenic
929905394 2:46041506-46041528 TGGAAAGTTGCAGCATTTGCAGG + Intronic
930678260 2:54228093-54228115 AGGAATGTAGCTGTATTTGCAGG + Intronic
930758939 2:55010405-55010427 CCAAATGGAGCTGCATTTGCAGG + Intronic
930855710 2:56015781-56015803 AGGAAGGAAGCTGCCTTTGCTGG + Intergenic
934192390 2:89811713-89811735 TGGAATGGAACTGAATTTGATGG - Intergenic
934194352 2:89827219-89827241 TGGAATGGAACTGAATTTGATGG - Intergenic
936048782 2:109206989-109207011 TGGCTGAGCGCTGCATTTGCAGG + Intronic
936238529 2:110767330-110767352 TGGGAGGGAGCTGGATTGGTGGG + Intronic
936428246 2:112436988-112437010 TGGAGGGGAGCTGGGGTTGCGGG - Intergenic
937252971 2:120535610-120535632 TGGTGGGGAGCCGCATTTGGGGG - Intergenic
939666472 2:144958687-144958709 TGTATGTGAGCTTCATTTGCTGG + Intergenic
943089583 2:183357999-183358021 CGGAAGCAAGCTGCACTTGCTGG + Intergenic
946924065 2:224608968-224608990 TGGAAGGCAGCTGCGCTAGCAGG + Intergenic
948133585 2:235619629-235619651 GGGAAAAGAGCTGCATCTGCAGG - Intronic
948882471 2:240867175-240867197 TAAATGGGAGCTGCAGTTGCAGG - Intergenic
1169268319 20:4181144-4181166 AGGAAGGGAGATGCATTTCACGG - Intronic
1170551482 20:17480977-17480999 TGCAAGGGAGCTTCAGCTGCAGG + Intronic
1170940617 20:20845340-20845362 TCTAAGGGAGCTGCCTTTGGAGG - Intergenic
1173513187 20:43646353-43646375 TGGAAGGAAGCTGGCTGTGCCGG + Intronic
1175610625 20:60348133-60348155 TGGAATGGAGTTGAATCTGCAGG - Intergenic
1175761312 20:61563676-61563698 TGGAAGGGAGCTGCATTTGCAGG - Intronic
1175949750 20:62577019-62577041 TGGGAGTGAGCTGCAGCTGCTGG - Intergenic
1176075195 20:63245142-63245164 TAGAAAGGAGCTGGATTTCCAGG - Intronic
1176374006 21:6078223-6078245 TGGAGGGGAGCTGGGGTTGCGGG + Intergenic
1177270407 21:18840794-18840816 TTGATGGGAGCAGCATTTTCTGG + Intergenic
1179080725 21:38168592-38168614 TGGGAGGGAGCTGCCCTTGGGGG - Intronic
1179749471 21:43460020-43460042 TGGAGGGGAGCTGGGGTTGCGGG - Intergenic
1182632202 22:31695347-31695369 TGGAAGGGAGCTTCTCTTTCCGG + Intronic
1182687430 22:32132002-32132024 TTGAAGTGAGCTGCTGTTGCTGG + Intergenic
1182872348 22:33659096-33659118 TAGAAGGGAACTGCTTTTGAAGG - Intronic
1184501751 22:44878838-44878860 AGGGAGGGAGCTGCTGTTGCTGG + Intergenic
1184760793 22:46542878-46542900 GGCATGGGAGCTGCATTTGGGGG + Intergenic
1185076469 22:48685879-48685901 GGGAAGGCATCTGCATTTCCAGG - Intronic
949788884 3:7771377-7771399 TGTAATGGAGATGAATTTGCAGG - Intergenic
951984076 3:28598451-28598473 TGGAAAGGAGCAGGATTTGGGGG + Intergenic
952297964 3:32077649-32077671 AAGGAGGGCGCTGCATTTGCGGG + Intergenic
953094257 3:39759304-39759326 AGGAAGAGAGCTGCAGTTGAGGG + Intergenic
953613794 3:44471481-44471503 TGGAAGGGGTCAGCATTTTCAGG - Intronic
953812813 3:46129263-46129285 GGGAAGGGAGCTGGCTTTGGAGG + Intergenic
954417038 3:50398304-50398326 TGGGAGGGAGCAGCATGTGCAGG - Intronic
954642348 3:52108662-52108684 TGGAGGGCTGCTGCTTTTGCGGG - Intronic
956872692 3:73433751-73433773 TGTAAGGGAGCTGCTTTTCCCGG - Intronic
957517458 3:81274354-81274376 TACTAGGGAGCTGCATTTTCTGG - Intergenic
961003594 3:123390181-123390203 TGGCTGTGAGCTGCATCTGCTGG - Intronic
961095861 3:124156083-124156105 TGGAAGGAAGCTGTATTCTCTGG - Intronic
961448547 3:126992232-126992254 TGGAGGGGAGCTGCCTGGGCTGG + Intronic
965621159 3:170643507-170643529 TTAAAGGTAGCTGCTTTTGCAGG + Intronic
966883469 3:184362227-184362249 GGGAAGGGAGCTCCAGGTGCCGG + Intronic
968538595 4:1150723-1150745 TGGAAAGGAGCTGCCCCTGCGGG - Intergenic
968706009 4:2078061-2078083 TGCAAGGGAGCTGCCCCTGCAGG - Intronic
969495920 4:7526068-7526090 GGGAAGAGTGCTGCAGTTGCAGG - Intronic
969928421 4:10607432-10607454 TTGCAGGAAGCTTCATTTGCTGG + Intronic
972050860 4:34731745-34731767 TGGAAGACAGCTGCATTTGGGGG - Intergenic
972668913 4:41195272-41195294 TGGAATGGAGCTGGTTTTGGTGG - Intronic
972852695 4:43070692-43070714 TGGCAGGGGGCGGCCTTTGCTGG - Intergenic
975322065 4:73019779-73019801 TGGAAAAGAGCTACATTTGCTGG - Intergenic
975464422 4:74693297-74693319 TGGAAGGGAGGCAGATTTGCTGG - Intergenic
975785841 4:77887247-77887269 GAAAATGGAGCTGCATTTGCAGG + Exonic
976198155 4:82552902-82552924 TGGAAGGGTGCTGCATCTTAGGG + Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
984844942 4:184100944-184100966 AGGAAGGGGGCTGCAGCTGCTGG + Intronic
984920014 4:184755323-184755345 AGCAAGGAAGCTGCATTTTCAGG + Intergenic
985159083 4:187025299-187025321 TGGAAAGCATCTGCATTTGGGGG - Intergenic
986854861 5:11856691-11856713 TCGAAGGGAGATGTATTTTCTGG - Intronic
988120000 5:26949187-26949209 GGTAATGGAGCTGCATTTACTGG - Intronic
989279126 5:39621531-39621553 TGAAAAGGAGCTGCCATTGCAGG - Intergenic
990955721 5:61336294-61336316 TGGAAGGGAGCTGCCTCTATAGG + Intronic
993904304 5:93605673-93605695 GGGCAGGGAGGTGCATCTGCGGG - Intergenic
995632739 5:114151386-114151408 AGGAAGGGAGCTGGAGTGGCAGG - Intergenic
996485181 5:124025458-124025480 TGGAGGGGAGCGGCATAAGCAGG - Intergenic
997092811 5:130877306-130877328 TGGAAGGGAACAGGATTTTCTGG + Intergenic
1000157745 5:158568453-158568475 TGGCAGGAAGATGCATTTGTAGG - Intergenic
1001132776 5:169078516-169078538 AGGAAGGGTGCTGGGTTTGCGGG - Intronic
1004906114 6:20238745-20238767 TTGAAGGGTGCTGAATGTGCAGG + Intergenic
1005849885 6:29813405-29813427 TGGGGTGGAGCTGCATTTCCAGG - Intergenic
1006130822 6:31868486-31868508 AGGAATGGAGCTGCATGTGGTGG + Intronic
1006660521 6:35638887-35638909 TGGAAGGAATCTGCATTTCTAGG + Intronic
1007077517 6:39077388-39077410 TGGCAGGAAGCCGCAGTTGCTGG + Intronic
1009603608 6:65837093-65837115 TGGAAAGGAACTGCCTTTGGAGG - Intergenic
1010062300 6:71636724-71636746 TGGAGAGGGGCAGCATTTGCTGG + Intergenic
1011610992 6:89150380-89150402 TAGAAGGGGCCTGCATATGCAGG + Intronic
1014729002 6:125008603-125008625 CGGAAGGCTGCTACATTTGCAGG - Intronic
1015264427 6:131276300-131276322 AGGAGGGGAGCTGTATTTGCAGG + Intronic
1015856581 6:137631463-137631485 TGGAAGGAAGCTGGAGTTGCAGG + Intergenic
1016217046 6:141617188-141617210 TGCAAGGGAGCATAATTTGCAGG - Intergenic
1017482638 6:154872774-154872796 TGGAAGTGAAGTGCATTTGCAGG + Intronic
1017639190 6:156474384-156474406 TGCCAGGGAGCTTCTTTTGCTGG - Intergenic
1018349423 6:162941336-162941358 TGGAAGGGAACGTCATGTGCTGG - Intronic
1018450378 6:163901728-163901750 TGCTAGGTAGCTGCATTTGGCGG - Intergenic
1018884171 6:167918797-167918819 TGGAAGGGAAGTGCAGTTGGAGG + Exonic
1018939621 6:168300413-168300435 AGGATGGAAGATGCATTTGCAGG + Intronic
1019360182 7:600790-600812 TGGAAGGGAGCTACGTTCCCAGG + Intronic
1024222625 7:47300471-47300493 TGGAAGGTACCTGCCCTTGCTGG - Intronic
1024981205 7:55159042-55159064 GGAAAGAGATCTGCATTTGCAGG - Intronic
1026123756 7:67561116-67561138 TGGAATTGAGCTGAATTTGTGGG + Intergenic
1026647532 7:72185274-72185296 TGAAAGGAAGGAGCATTTGCTGG + Intronic
1029041563 7:97580966-97580988 TGCCAGGCTGCTGCATTTGCTGG - Intergenic
1031178152 7:118378881-118378903 AGGAAGGGGGCTGCATCTCCTGG + Intergenic
1033017159 7:137683016-137683038 GGGAAGAGGCCTGCATTTGCTGG - Intronic
1034843122 7:154418054-154418076 TAGATAGGACCTGCATTTGCAGG + Intronic
1035340441 7:158157345-158157367 TGTAAGCCAGCTGCATTTGCTGG - Intronic
1036750841 8:11443050-11443072 TGGAAGGCAGCTGCCCTTGATGG + Intronic
1038921015 8:32084353-32084375 TGGAAAGGATCAGCATTTGCTGG - Intronic
1041658681 8:60379410-60379432 TGCAAGGGTTCTGCATTTTCTGG - Intergenic
1045398153 8:101782894-101782916 TGGATGGCATCTGCATTTGAGGG - Intronic
1045508753 8:102797127-102797149 GGGAAGAGAGCAGCAGTTGCTGG - Intergenic
1047762458 8:127964169-127964191 TGGAGAGGAGCAGCATCTGCTGG + Intergenic
1051347554 9:16165902-16165924 TAGAAGGCAGCTGCATGTGAAGG + Intergenic
1057082775 9:92185208-92185230 GGGAAGGGTGCTGGAATTGCAGG + Intergenic
1057173190 9:92976121-92976143 TGCCTGGGAGCTGCATTTGGGGG + Intronic
1057431139 9:94995304-94995326 AGGAAGGGATTTGCATTTACTGG + Intronic
1059219469 9:112600016-112600038 TAGAATGTAGCTGCATTTGCCGG - Intronic
1060678551 9:125539813-125539835 TGGAATGTACCTGCATTGGCAGG - Intronic
1186805898 X:13139767-13139789 TGGAAAGGAGCTGCTCCTGCAGG + Intergenic
1188010760 X:25053384-25053406 TGGAATCCGGCTGCATTTGCAGG + Intergenic
1197013392 X:121594213-121594235 TGGAAGGGAGATGGAGTGGCTGG + Intergenic
1199601445 X:149543717-149543739 TGGAAGGGAGGTGGACTTGGTGG + Intronic
1199648931 X:149935767-149935789 TGGAAGGGAGGTGGACTTGGTGG - Intronic