ID: 1175762536

View in Genome Browser
Species Human (GRCh38)
Location 20:61571344-61571366
Sequence CACTGTCTACCTTCGGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175762536_1175762545 27 Left 1175762536 20:61571344-61571366 CCATGAGCCGAAGGTAGACAGTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1175762536_1175762539 -7 Left 1175762536 20:61571344-61571366 CCATGAGCCGAAGGTAGACAGTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1175762539 20:61571360-61571382 GACAGTGCTGGCCTTGACATCGG 0: 1
1: 0
2: 2
3: 17
4: 204
1175762536_1175762542 19 Left 1175762536 20:61571344-61571366 CCATGAGCCGAAGGTAGACAGTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1175762542 20:61571386-61571408 AGCATCTCCTTGATGCCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 191
1175762536_1175762546 28 Left 1175762536 20:61571344-61571366 CCATGAGCCGAAGGTAGACAGTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1175762546 20:61571395-61571417 TTGATGCCCAGAGGGTACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1175762536_1175762540 -6 Left 1175762536 20:61571344-61571366 CCATGAGCCGAAGGTAGACAGTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1175762540 20:61571361-61571383 ACAGTGCTGGCCTTGACATCGGG 0: 1
1: 0
2: 0
3: 11
4: 181
1175762536_1175762543 20 Left 1175762536 20:61571344-61571366 CCATGAGCCGAAGGTAGACAGTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1175762543 20:61571387-61571409 GCATCTCCTTGATGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175762536 Original CRISPR CACTGTCTACCTTCGGCTCA TGG (reversed) Intronic
900473583 1:2866071-2866093 CACTGTCTTCCCTCTGCACAGGG - Intergenic
902007903 1:13246641-13246663 CACTGTCTGCCTTTTACTCATGG - Intergenic
904206814 1:28860924-28860946 CACTGTCAGCCTTCAGCTTACGG + Intronic
906293908 1:44637338-44637360 CACTCTCCAGCTCCGGCTCAGGG - Intronic
907358532 1:53895963-53895985 TGCTCTCTCCCTTCGGCTCATGG + Intronic
910341277 1:86190875-86190897 CACTGTGGACCTTTGGCTTAAGG - Intergenic
917776348 1:178339481-178339503 CACTTTCTAGCTTGAGCTCATGG - Intronic
922465527 1:225843660-225843682 TCCTGTCTACCTCCTGCTCAGGG - Intronic
923689853 1:236181594-236181616 CACTGTCTAAATCCAGCTCAGGG - Intronic
1068580593 10:58735026-58735048 CACTGTCTACCTTTGTCAGAAGG - Intronic
1072485374 10:95849659-95849681 CACAGTCTACCCTCCCCTCAAGG + Intronic
1078340483 11:10495129-10495151 CTCTGTGTACCATCAGCTCAGGG + Intronic
1082067243 11:47910842-47910864 CACTGTCTACCTTGCGTTAAAGG - Intergenic
1091379947 12:51123-51145 CACTCTCTACCTTGGGATCATGG + Intergenic
1092844080 12:12567918-12567940 CACTGGCTTCCTTTGGCTCTGGG - Intergenic
1092984520 12:13833161-13833183 CTCTGTCTACTTTCAGTTCAGGG - Intronic
1093842092 12:23916478-23916500 GACTGTCTCCCCTCAGCTCATGG + Intronic
1094121224 12:26976797-26976819 CACTGTTTACATTGGGTTCATGG - Intronic
1098501591 12:71198767-71198789 CACTTTCTCCCTTAGGCTAAAGG + Intronic
1101214037 12:102563150-102563172 CACTGTTTACCTTTTCCTCAGGG - Intergenic
1106680954 13:32006921-32006943 CAGTTTCTGCCTTCTGCTCATGG + Intergenic
1118873625 14:69764669-69764691 CAGTTGCTACCTTCAGCTCATGG - Intronic
1121998193 14:98622972-98622994 CACTGATTACCTTTGGCTGATGG - Intergenic
1125478881 15:40066588-40066610 CACTTTCTTCCTTCAGTTCAGGG + Intergenic
1127678579 15:61270238-61270260 CACTGTATACTTTCTGCTCCAGG - Intergenic
1128398171 15:67250488-67250510 CACTTTCTACATTCCTCTCAAGG + Intronic
1128639189 15:69323359-69323381 CTCTTTATGCCTTCGGCTCAGGG + Intronic
1129477866 15:75798394-75798416 CACAGTCTATCTTTGACTCATGG + Intergenic
1131454540 15:92572779-92572801 CACCGGCATCCTTCGGCTCATGG - Intergenic
1132466531 16:79932-79954 CACTGTCTGCCCCCGGCTCTGGG + Intronic
1133625795 16:7569370-7569392 CACTGTCATTCTTGGGCTCATGG + Intronic
1133832805 16:9339759-9339781 GACTGTCTACATTCAGCTGAAGG + Intergenic
1134215638 16:12315118-12315140 CACTGTCTCCTTTTGTCTCAGGG + Intronic
1139778988 16:69335228-69335250 CATTGGCTACCTGCGGCGCATGG - Exonic
1142496286 17:307733-307755 CACTGCTGACCTTCAGCTCAGGG - Intronic
1159056149 18:63466156-63466178 CACTTTCTACCTTTGGGTTATGG - Intergenic
1160727946 19:626224-626246 CACTGTCAACCTCCGCCTCCCGG + Intronic
1163021835 19:14485574-14485596 CACTGCCAACCTTCGTCTCCTGG - Intronic
927325154 2:21796685-21796707 CATTGTCTACCTTTGGCCTAGGG + Intergenic
927333445 2:21892602-21892624 CACTGTCTACTTTTGACTCCAGG + Intergenic
928321592 2:30287603-30287625 CACAGACTACCTTCTGTTCAAGG + Intronic
931915583 2:66951456-66951478 CACTGTCACCCTTCTACTCACGG - Intergenic
932004016 2:67909919-67909941 CACTGTATTCCTAAGGCTCAAGG + Intergenic
936563925 2:113567721-113567743 CACTCTCTACCTTGGGATCATGG - Intergenic
937553558 2:123126614-123126636 CACTGTATTCCTCCTGCTCAAGG - Intergenic
941673918 2:168323993-168324015 CACTATCCACCTTTGGTTCAGGG + Intergenic
943053634 2:182947293-182947315 CACTGTCTAACTTCGGGGTAGGG - Intronic
943879847 2:193129263-193129285 CAGTGTCTACCATAGGCCCAGGG - Intergenic
945501482 2:210581012-210581034 CACTGTCTTCCTTCTGGTCATGG - Intronic
948786197 2:240354212-240354234 CACTGTCTTCCTTCTTCCCAGGG + Intergenic
1174302818 20:49594654-49594676 CACTGCCTCCCTTGGGATCAGGG - Intergenic
1174851756 20:54002191-54002213 CTCTGGCCACCTTGGGCTCAGGG + Intronic
1175089269 20:56488511-56488533 CACTGTCTACCTGCTTTTCATGG + Intronic
1175762536 20:61571344-61571366 CACTGTCTACCTTCGGCTCATGG - Intronic
1178130653 21:29569118-29569140 CAGTGTCTGCCTTCTGCTAAAGG - Intronic
1180022211 21:45135567-45135589 CTCTGTCTATCTACCGCTCACGG - Intronic
1183327400 22:37201910-37201932 CACTGCCTTCCTCCAGCTCAGGG + Intergenic
1183541990 22:38434729-38434751 CACTGTCTATCTGCAGCACATGG + Intronic
1183579684 22:38716500-38716522 CACTGTGCTCCTCCGGCTCAAGG + Intronic
1183674977 22:39294155-39294177 CACTGTCTACCTGCTGCTTAAGG - Intergenic
953045131 3:39288316-39288338 GCCTGCCTACCTTCTGCTCAGGG + Intergenic
957182050 3:76891748-76891770 AACTGTCTTCCTTGAGCTCAAGG - Intronic
957681036 3:83435439-83435461 CACTGTCTTCCTGCAGCTCCTGG - Intergenic
962757741 3:138479648-138479670 CACAGTTTACCCTTGGCTCATGG + Intronic
962950773 3:140216424-140216446 CACTGTCTACCCTCTGCTGGAGG + Intronic
964122772 3:153203615-153203637 CACTGTCTCCCTAGGGGTCATGG + Intergenic
969096655 4:4737495-4737517 CACTTTCTACCTTCAGCTTATGG - Intergenic
974293937 4:59970058-59970080 CACTGAATACCTTCAGTTCAAGG + Intergenic
976222699 4:82770811-82770833 CTCTGTCCACCATTGGCTCATGG - Intronic
976567812 4:86572200-86572222 CACTCTCTACCTTTGACTTATGG + Intronic
979503168 4:121462986-121463008 CACTGGCACCCTTTGGCTCAGGG + Intergenic
985065960 4:186122165-186122187 TACTGTCTACATTCATCTCATGG - Intronic
986077300 5:4351143-4351165 CACTGTGTTGCTGCGGCTCATGG + Intergenic
993323228 5:86501668-86501690 CACTGTCTTCCTTCTGTTCTTGG - Intergenic
994953131 5:106490920-106490942 CAATGTCTTCCTTCAGCTCTTGG - Intergenic
996544135 5:124659779-124659801 CACTGTCTCCTTACAGCTCAAGG - Intronic
996717817 5:126601536-126601558 CTCAGTCTCCCTTCGGCTCAGGG - Intronic
1001026682 5:168230554-168230576 CAATGGGTACCTTCGGCTTAGGG - Intronic
1003771399 6:9306252-9306274 CTATGTCTAACTTTGGCTCATGG + Intergenic
1011499679 6:87974144-87974166 CACTTCCTAGCTTTGGCTCATGG - Intergenic
1014281768 6:119449390-119449412 CACTGCCTGCCTTGGCCTCATGG + Intergenic
1018024478 6:159793321-159793343 CACAATCTACCTTTGGCCCACGG - Intronic
1023143838 7:37129555-37129577 CACTGTCTACCTCCCACTCAAGG + Intronic
1029197654 7:98817223-98817245 CACTGACTCCATTCGGCTCTAGG - Intergenic
1032552325 7:132796047-132796069 CTCTGCCTACCTACGGCTTATGG + Intronic
1032571251 7:133001214-133001236 CACTGACTACCTTCATTTCAGGG + Intronic
1033686517 7:143645867-143645889 CACTGTCTAGTTCCAGCTCATGG - Intronic
1033689220 7:143721440-143721462 CACTGTCTAGTTCCAGCTCATGG + Intronic
1033698095 7:143811748-143811770 CACTGTCTAGTTCCAGCTCATGG + Intergenic
1034055577 7:148031737-148031759 CACTGTGTAAATTCGGCACATGG - Intronic
1036952944 8:13159087-13159109 CACTCTCCACCTTGGGCTCATGG - Intronic
1048845720 8:138602360-138602382 CACTGTCCACCTTTGACTGATGG + Intronic
1049180131 8:141217955-141217977 CTCTGCCCACCTGCGGCTCACGG - Intronic
1051964941 9:22816370-22816392 CACTGCCTAGCATCGCCTCAAGG + Intergenic
1053371597 9:37566019-37566041 AACTGTTTACCTTTGGCTAAGGG - Intronic
1056707748 9:88966419-88966441 CACAGTCTACCTTCTGCAAAAGG + Intergenic
1058642362 9:107099886-107099908 CACTGTCCAACTTCGGGTCTTGG + Intergenic
1061990843 9:134157733-134157755 CACTGCCCACCTTCGACACAGGG - Intronic
1200134622 X:153868872-153868894 CACTGCCTACCTTCTGTGCAAGG - Exonic