ID: 1175762538

View in Genome Browser
Species Human (GRCh38)
Location 20:61571351-61571373
Sequence AGGCCAGCACTGTCTACCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175762538_1175762545 20 Left 1175762538 20:61571351-61571373 CCGAAGGTAGACAGTGCTGGCCT 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1175762538_1175762543 13 Left 1175762538 20:61571351-61571373 CCGAAGGTAGACAGTGCTGGCCT 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1175762543 20:61571387-61571409 GCATCTCCTTGATGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 160
1175762538_1175762542 12 Left 1175762538 20:61571351-61571373 CCGAAGGTAGACAGTGCTGGCCT 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1175762542 20:61571386-61571408 AGCATCTCCTTGATGCCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 191
1175762538_1175762549 28 Left 1175762538 20:61571351-61571373 CCGAAGGTAGACAGTGCTGGCCT 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1175762549 20:61571402-61571424 CCAGAGGGTACCTGGGCTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 227
1175762538_1175762546 21 Left 1175762538 20:61571351-61571373 CCGAAGGTAGACAGTGCTGGCCT 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1175762546 20:61571395-61571417 TTGATGCCCAGAGGGTACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175762538 Original CRISPR AGGCCAGCACTGTCTACCTT CGG (reversed) Intronic
901481819 1:9530407-9530429 AGGTCAGCACACTCTCCCTTAGG - Intergenic
903333259 1:22608397-22608419 AGGCCAGAACTGTCTCCACTTGG + Intergenic
903375573 1:22863700-22863722 GTCCCAGGACTGTCTACCTTGGG - Intronic
903679100 1:25085164-25085186 AGGCCTGCATTGTCTTGCTTGGG - Intergenic
904329724 1:29750607-29750629 AGGCCAGCACGATGTACATTTGG + Intergenic
911328443 1:96497457-96497479 AGTCCAGCACTCTCTACGTTGGG + Intergenic
912612543 1:111062721-111062743 AAGCCAGAAATGTCTTCCTTGGG + Intergenic
916316371 1:163452660-163452682 TAGTCAGCACTGTCTACCTATGG + Intergenic
917865678 1:179192204-179192226 ATGCCAGCCATATCTACCTTTGG - Intronic
917906211 1:179589005-179589027 AGGCCAGCACTGTGTTCCCATGG - Intergenic
922255073 1:223886617-223886639 AGGTCAGCACTGTTTCCTTTGGG + Intergenic
1067745299 10:48931285-48931307 AGGACAGCACTGGCTGCCTCAGG - Intronic
1068449007 10:57162718-57162740 AGGCCTGGACTGCCTGCCTTTGG - Intergenic
1072875943 10:99173439-99173461 AGGGCATCACTGTCTACCTTGGG - Intronic
1073536360 10:104280193-104280215 AGGCCTGAACTGCCTACCTCTGG - Intronic
1078634021 11:13032055-13032077 AGTCCTGGACTGTCTACCTCTGG + Intergenic
1080244766 11:30167420-30167442 TAGCCAACACTGTCTGCCTTGGG + Intergenic
1080277426 11:30518521-30518543 AGGTCAGCACTGTCTTTCTTGGG - Intronic
1081680736 11:45000670-45000692 GGATCAGCACTTTCTACCTTCGG + Intergenic
1081927508 11:46843098-46843120 AGACCAGCAGGGTCTCCCTTTGG - Intronic
1083956056 11:65983455-65983477 AGGCCAGAACTGTCTTCTTACGG + Intergenic
1084674892 11:70628589-70628611 AGGCCAGCTCTGCCTCCCATGGG - Intronic
1085306853 11:75491167-75491189 AGTCCAGCTCTGTCCACCTCTGG - Intronic
1087175712 11:95092959-95092981 AGGCAAGCACTGAGTTCCTTTGG - Intronic
1088736877 11:112735019-112735041 AGGCCTGGACTGTCAACCGTTGG - Intergenic
1090876727 11:130796606-130796628 AGGCCAGCATTGTCCTCCTCTGG - Intergenic
1097811184 12:64020965-64020987 CGGCCTGCACTGTCAATCTTTGG - Intronic
1098454778 12:70659687-70659709 AAGCCAGTATTATCTACCTTTGG + Intronic
1099316530 12:81089905-81089927 AGTCCACCACTGTATAACTTCGG - Intronic
1100727903 12:97428813-97428835 ACTCCAGCACTGAATACCTTGGG + Intergenic
1100817264 12:98398225-98398247 ATGCAAGCACTGTATACTTTAGG + Intergenic
1102703810 12:114863979-114864001 AAGCCAGCACTGGCTGACTTTGG + Intergenic
1103581297 12:121917558-121917580 AGGCAAGCCCTGTGTTCCTTGGG + Exonic
1103985154 12:124762082-124762104 AGGCCAGCACGGACTGCCTGGGG - Intergenic
1104553798 12:129781540-129781562 AGGCCAGGACTCTCTACATGAGG - Intronic
1107902890 13:45035323-45035345 AGGCCAGCAGAGTAGACCTTTGG - Intronic
1110841656 13:80151062-80151084 AGCCCTGGACTGACTACCTTAGG - Intergenic
1112008089 13:95271362-95271384 AGGCCAGCAGTGACTGCCTTTGG - Intronic
1116814993 14:49575526-49575548 AAGCCAGAACTGGCTTCCTTTGG - Exonic
1117542874 14:56765431-56765453 AAGCCACCACTGACTACCTGGGG + Intergenic
1118153120 14:63211125-63211147 AGGTTATGACTGTCTACCTTGGG - Intronic
1118448953 14:65879877-65879899 TTGCCAGCTCTGTCTTCCTTGGG + Intergenic
1118618162 14:67590042-67590064 AGGCCAGCATTGTCTTCCATGGG - Exonic
1123063329 14:105604349-105604371 AGCCCAGCTCAGTCCACCTTAGG + Intergenic
1123087389 14:105723135-105723157 AGCCCAGCTCAGTCCACCTTAGG + Intergenic
1123156684 14:106234075-106234097 AGGCCAGCAGTATTGACCTTAGG + Intergenic
1123207460 14:106727170-106727192 AGGCCAGCAGTATTGACCTTAGG + Intergenic
1123212483 14:106774164-106774186 AGGCCAGCAGTATTGACCTTAGG + Intergenic
1127514378 15:59677337-59677359 AGGCCAGCATCGTCTTCCATGGG + Intronic
1130248074 15:82272373-82272395 AGTCTAGCACTGTCTATCATGGG - Intronic
1131023658 15:89121435-89121457 AGGCTGGCACTGTCTCCCTTTGG + Intronic
1134222190 16:12363437-12363459 GGGTCAGGACTGTCTACTTTAGG + Intronic
1134563028 16:15227106-15227128 AGGCCAGCCTTGCCTCCCTTTGG - Intergenic
1134923562 16:18138739-18138761 AGGCCAGCCTTGCCTCCCTTTGG - Intergenic
1135129239 16:19838574-19838596 AGGACAGCATTGCCTACCTGTGG + Intronic
1137723750 16:50643062-50643084 ATGCCAGCAGTGCCTTCCTTGGG + Intergenic
1138113084 16:54339980-54340002 AGGCCAGGACTGTCTCCTTTTGG + Intergenic
1139665479 16:68452419-68452441 AGGCCAGCACTGTGTTCCCCTGG - Intergenic
1141170457 16:81687422-81687444 AGGCGAGAACTGACTACCTCTGG + Intronic
1141232115 16:82177932-82177954 AGGCCAGCAATTTCTAACTATGG - Intergenic
1145062258 17:19740548-19740570 AGGCCAGCAGTGTCTGTCTTTGG + Intronic
1145284888 17:21498025-21498047 AGGGCAGCACTGTCTGAGTTGGG - Intergenic
1145392633 17:22467727-22467749 AGGGCAGCACTGTCTGAGTTGGG + Intergenic
1146461485 17:33049282-33049304 AGCCCCAAACTGTCTACCTTTGG - Intronic
1149423529 17:56533130-56533152 AGGGCAGCACTGTTTACTATGGG + Intergenic
1151996980 17:77615961-77615983 AGGCCAGAACTTTCTTGCTTTGG - Intergenic
1152031671 17:77846805-77846827 AGGCCTGGACTGTCTACCGCAGG + Intergenic
1152962030 18:85894-85916 AGGACAGCAGTGACTTCCTTTGG + Intergenic
1154198797 18:12285177-12285199 AGGCCAGCCCTGCCTCCCTGGGG - Intergenic
1156454080 18:37283055-37283077 AGGCCAGCACTGCCTCCTTGGGG - Intronic
1157125584 18:44952743-44952765 AGACTGGCACTGCCTACCTTGGG - Exonic
1158316077 18:56212571-56212593 AGTCCATCACTGTCTAGGTTGGG + Intergenic
1158341838 18:56474326-56474348 AGGACAGCAGTGTGTATCTTTGG - Intergenic
1164725254 19:30461672-30461694 AGGCCAGCACAGCCTGACTTGGG + Intronic
925416055 2:3671062-3671084 AGGGCAGCTCGGTCAACCTTGGG - Intronic
935171286 2:100612958-100612980 AGCCCAGCACTTTCTAGCCTGGG + Intergenic
936857627 2:116979682-116979704 AGGCCAGAAATGTCTTCCCTGGG - Intergenic
939558140 2:143701748-143701770 AGTCCTGCACTGTCTGCCTCTGG - Intronic
942450678 2:176106565-176106587 AGGCCAGCACTCGCACCCTTGGG + Intronic
942763150 2:179424099-179424121 AGGCCACCACTGGCTACATTGGG - Intergenic
942864442 2:180656184-180656206 AGAGCATTACTGTCTACCTTTGG + Intergenic
945929266 2:215839089-215839111 AGTCCAGGAGTTTCTACCTTTGG + Intergenic
946926357 2:224631105-224631127 TGGCAAGCACTGTCTGCCTTAGG - Intergenic
947642805 2:231716400-231716422 AGGCCAGCCCTGCCTGCCTCAGG + Intergenic
948505005 2:238422611-238422633 GGGCCAGCACTCTCTCCCTGGGG - Intergenic
1172653366 20:36521483-36521505 AGGTCCCCACTGTCTACCCTGGG + Intronic
1175575818 20:60060161-60060183 AGGCCATCACTGAGGACCTTGGG + Intronic
1175708752 20:61202380-61202402 GTGCCAGCTCTGTCTACCCTCGG + Intergenic
1175762538 20:61571351-61571373 AGGCCAGCACTGTCTACCTTCGG - Intronic
1178973096 21:37198464-37198486 AGGCAATCACGGTCTATCTTGGG - Intronic
1179137737 21:38695568-38695590 AATACAGCACTCTCTACCTTTGG - Intergenic
1179480981 21:41678524-41678546 ATGCCATCAGTGTGTACCTTAGG - Intergenic
1183429398 22:37756634-37756656 AGGCCAGGACTGCATACCTCGGG - Intronic
1184271547 22:43387319-43387341 AGGACAGCCCTGTCTCCCCTTGG - Intergenic
1184348387 22:43926808-43926830 AGACCAGTACTGTCTACTATGGG - Intronic
1184797546 22:46740782-46740804 AGGCCAGCCCTGGCTGCCTGAGG + Intergenic
953378809 3:42451021-42451043 CAGCCAGCAGTGTCTACATTAGG + Intergenic
953419977 3:42746961-42746983 AGGACAGCACTGTCCACCCAGGG - Intronic
954658789 3:52215260-52215282 TGGCCAGTTCTGTCTTCCTTTGG + Intergenic
955413498 3:58671284-58671306 AGGCAAGTACAGTCTCCCTTGGG + Intergenic
956186099 3:66563491-66563513 AAGCTAGCACTGTATATCTTAGG + Intergenic
956187488 3:66576469-66576491 ATGCCGGCACTGGCTTCCTTGGG - Intergenic
956484008 3:69702313-69702335 AGGAGAGCACTATCTGCCTTAGG + Intergenic
958942441 3:100331242-100331264 ATTCCAACACTGTCTACCTGAGG - Intergenic
960995230 3:123336146-123336168 ACGCCAGCATAGTCTACCTCTGG - Intronic
964040753 3:152258673-152258695 AGGAAAACACTGTCTACTTTGGG - Intronic
971171054 4:24233057-24233079 GGCCCAGCACTGCCTGCCTTGGG + Intergenic
972979739 4:44681826-44681848 AGGCCAGTACTGCCTACATAAGG - Intronic
974009895 4:56597097-56597119 AGGCCTTCACTGACTACCATAGG - Intronic
975691005 4:76963436-76963458 AGATCATCACTGTTTACCTTGGG - Intronic
977004671 4:91550046-91550068 AGGCTAGCACTGGCTACAGTTGG + Intronic
992123494 5:73617824-73617846 AGCCCAGGACTGTTTACCTCTGG + Intergenic
992414407 5:76539039-76539061 AGGACAGCAGTGTCCCCCTTTGG + Intronic
995651943 5:114379180-114379202 AGGGCACCACTGTCCACCTGGGG + Intronic
1000191034 5:158910869-158910891 AGGACAGCAGTGTTTCCCTTTGG - Intronic
1000274830 5:159724931-159724953 AGGACACCACTGTCTATCATGGG + Intergenic
1001460976 5:171914060-171914082 ATGCCATCACTGTCCATCTTTGG + Intronic
1001688176 5:173611350-173611372 AGGCCTGCAGTGTCCACCTGGGG + Intronic
1002681002 5:180963828-180963850 AGGCCAGCACTGACAATCCTAGG - Intergenic
1003272419 6:4619306-4619328 AGGCCAGCATTGTCCAGCTCAGG + Intergenic
1003940215 6:11017083-11017105 AGGCTGAAACTGTCTACCTTAGG + Intronic
1007117106 6:39350573-39350595 AGGCCAGTGCTGTCTCCCTTGGG + Intronic
1010348265 6:74839141-74839163 AGGCCAGAACTGTCTTTCTAAGG + Intergenic
1012361586 6:98389150-98389172 AAGCCAGCACTGCATGCCTTTGG - Intergenic
1013615883 6:111842591-111842613 AGGCCAGCAGTGTTTACATGGGG - Intronic
1018101576 6:160445465-160445487 AGGCCAGCTCTGTCCACCTCAGG - Intronic
1018858087 6:167689676-167689698 AAGCCAGCACTGCCTTCCTTTGG - Intergenic
1019021152 6:168918778-168918800 AGGCCCCCACTGTCTGCCCTGGG + Intergenic
1019070548 6:169341356-169341378 GGGCGACCACTGGCTACCTTCGG + Intergenic
1019615435 7:1957432-1957454 AGGCCTGCACTGGCTGCCTCTGG - Intronic
1022209261 7:28192949-28192971 AGCCCAGCACTGCCTACTTCTGG + Intergenic
1022595316 7:31707899-31707921 AGACCAGCACTCTCTGCCTCTGG - Exonic
1023843035 7:44107381-44107403 AGGCCTGCTCTGACCACCTTGGG - Intronic
1024470352 7:49763539-49763561 TGGCCAGCATTGTCATCCTTTGG - Intergenic
1024832686 7:53480032-53480054 ATGCCAGCACTTTGTACTTTGGG - Intergenic
1026289095 7:68989851-68989873 AGGCCACCACTGCTAACCTTTGG - Intergenic
1026962330 7:74416798-74416820 AGGCCAGTACTGTGAACCTTGGG - Intergenic
1035075612 7:156175390-156175412 GGCCCAGCACTGCCCACCTTGGG - Intergenic
1039190578 8:34969552-34969574 AGTCCAGCACTATCTACCTGAGG - Intergenic
1042128245 8:65560410-65560432 GGGCCGGGACTGTCTGCCTTCGG - Intergenic
1048311750 8:133328126-133328148 AGACTAGCAATGTCTACCCTAGG + Intergenic
1049248053 8:141573187-141573209 AGGACAGCACTGTCTCCCATAGG + Intergenic
1053612890 9:39733155-39733177 AGTCCAGCACTGTCTGCAATTGG - Intergenic
1053789858 9:41679397-41679419 AGGCCAGATGTGTCTCCCTTGGG + Intergenic
1053870930 9:42491097-42491119 AGTCCAGCACTGTCTGCAATTGG - Intergenic
1054240625 9:62609247-62609269 AGTCCAGCACTGTCTGCAATTGG + Intergenic
1054554759 9:66643769-66643791 AGTCCAGCACTGTCTGCAATTGG + Intergenic
1057874223 9:98741476-98741498 AGGCCAACATTGTTCACCTTTGG - Intronic
1060266851 9:122116645-122116667 AGGCCAGCACTGTCTGTCTGGGG - Intergenic
1060984372 9:127811054-127811076 AAGCCCCCACTGTCTACCTCAGG - Intronic
1061875561 9:133541839-133541861 GGGACAGCACTTTCTACTTTTGG + Intronic
1062248199 9:135580852-135580874 AGCTCAGCACTGTCAACCATGGG + Intergenic
1062736112 9:138138223-138138245 AGGACAGCAGTGACTTCCTTTGG - Intergenic
1191615262 X:63163272-63163294 AGCCCACCACTGTCTACACTGGG + Intergenic
1191621036 X:63215651-63215673 AGCCCACCACTGTCTACACTGGG - Intergenic
1195925772 X:110023157-110023179 GGGCCAGCACTGGTTACCTCTGG + Intronic
1200154648 X:153969101-153969123 AAACCAGCACTTTCTGCCTTGGG + Intronic