ID: 1175762541

View in Genome Browser
Species Human (GRCh38)
Location 20:61571371-61571393
Sequence GAGATGCTCACCCGATGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 79}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175762541_1175762543 -7 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762543 20:61571387-61571409 GCATCTCCTTGATGCCCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 160
1175762541_1175762553 28 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762553 20:61571422-61571444 AGGTTTCCAGGCGCCATGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 147
1175762541_1175762545 0 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1175762541_1175762552 24 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762552 20:61571418-61571440 CTGTAGGTTTCCAGGCGCCATGG No data
1175762541_1175762554 29 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762554 20:61571423-61571445 GGTTTCCAGGCGCCATGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 152
1175762541_1175762549 8 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762549 20:61571402-61571424 CCAGAGGGTACCTGGGCTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 227
1175762541_1175762542 -8 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762542 20:61571386-61571408 AGCATCTCCTTGATGCCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 191
1175762541_1175762550 16 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762550 20:61571410-61571432 TACCTGGGCTGTAGGTTTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 122
1175762541_1175762546 1 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762546 20:61571395-61571417 TTGATGCCCAGAGGGTACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175762541 Original CRISPR GAGATGCTCACCCGATGTCA AGG (reversed) Intronic
900050820 1:594628-594650 GAAATGCTCACCCTTTGACAGGG - Intergenic
901961730 1:12831762-12831784 GAGTAGATCACCTGATGTCAGGG + Intergenic
901968338 1:12886553-12886575 GAGTAGATCACCTGATGTCAGGG + Intronic
901976422 1:12947923-12947945 GAGTAGATCACCTGATGTCAGGG + Intronic
901983739 1:13056820-13056842 GAGTAGATCACCTGATGTCAGGG + Intergenic
901984990 1:13068326-13068348 GAGTAGATCACCTGATGTCAGGG - Intronic
901996819 1:13158444-13158466 GAGTAGATCACCTGATGTCAGGG + Intergenic
901998075 1:13169952-13169974 GAGTAGATCACCTGATGTCAGGG - Intergenic
902008751 1:13253847-13253869 GAGTAGATCACCTGATGTCAGGG - Intergenic
902590371 1:17469599-17469621 GAGCAGATCACCTGATGTCAGGG + Intergenic
914380392 1:147110421-147110443 GAGATGCTCATCCAATGTCTGGG - Intergenic
1067301927 10:45019971-45019993 GGGATGCTCTCAAGATGTCAAGG - Intergenic
1070434891 10:76381602-76381624 GAGATGCTTACCGGATATGAGGG - Intronic
1070771887 10:79087392-79087414 GACATGGACACCCAATGTCACGG - Intronic
1074112839 10:110434533-110434555 AAGCTGCTCACCAGATGTTAGGG + Intergenic
1085386908 11:76162765-76162787 GAGATGCTTACCCGCTGCCCTGG + Intergenic
1086924191 11:92622541-92622563 CAGATGCTCCCCAGAAGTCAAGG - Intronic
1088484799 11:110330113-110330135 GGGAGGGTCACCCGAGGTCAGGG + Intergenic
1097548658 12:61037969-61037991 GAGCTCCCCACCCCATGTCAAGG + Intergenic
1098072802 12:66694229-66694251 GAAATGCTTAGCCCATGTCAGGG - Intronic
1103510249 12:121468589-121468611 GAGCTGATCACCTGATTTCATGG - Intronic
1106081781 13:26506419-26506441 GAGATGGACACGCGATCTCAGGG - Intergenic
1109275968 13:60304962-60304984 GGGATGATCACCTGAGGTCAGGG + Intergenic
1113131783 13:107045133-107045155 TAGATGCTCACCCTTTGTTATGG + Intergenic
1118289752 14:64508889-64508911 GAGATACTGCCCTGATGTCAAGG + Intronic
1118976096 14:70677767-70677789 GAGATGCTCAGCCTTTCTCAGGG - Intergenic
1121302405 14:92881831-92881853 GAGATCCTCGCCCTGTGTCAGGG + Intergenic
1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG + Intergenic
1123187823 14:106537319-106537341 GAGAGGCTCACCCAGGGTCAGGG - Intergenic
1129520920 15:76185942-76185964 AAGAGGCTCACCCAAAGTCAGGG + Intronic
1132280394 15:100608934-100608956 GTGATGCTCACCCACCGTCAGGG + Intronic
1136694661 16:32066818-32066840 GAGAGGCTCACCCAGGGTCAGGG + Intergenic
1136795163 16:33010080-33010102 GAGAGGCTCACCCAGGGTCAGGG + Intergenic
1136870026 16:33798439-33798461 GAGAGGCTCACCCAGGGTCAGGG + Intergenic
1136874753 16:33844302-33844324 GAGAGGCTCACCCAGGGTCAGGG - Intergenic
1140252175 16:73303920-73303942 GTGATGCTCACCCAATCTGATGG + Intergenic
1140928598 16:79606499-79606521 GAGATGCTCCGAGGATGTCACGG - Intergenic
1141624979 16:85256497-85256519 GAGGTGCTCACTCGGGGTCAGGG + Intergenic
1203097418 16_KI270728v1_random:1271740-1271762 GAGAGGCTCACCCAGGGTCAGGG + Intergenic
1203102144 16_KI270728v1_random:1317615-1317637 GAGAGGCTCACCCAGGGTCAGGG - Intergenic
1143945946 17:10592119-10592141 GAGCAGCTCACCTGAGGTCAGGG + Intergenic
1159478715 18:68959622-68959644 GAGATGCTCTCCGGAAGCCAGGG + Intronic
1161160430 19:2758552-2758574 GAGCTGCTCACCTGTTTTCATGG - Intronic
1168274828 19:55271826-55271848 GAGGTGCTCACCTGAGGTCGGGG + Intronic
926933698 2:18065863-18065885 CAGATGTTCAACAGATGTCAAGG + Intronic
929764753 2:44834846-44834868 TAGATGTTCACCAGCTGTCAGGG - Intergenic
931441333 2:62292856-62292878 GAGGGACTCACCCGAAGTCATGG - Intergenic
931441716 2:62294736-62294758 GAGGGACTCACCCGAAGTCATGG + Intergenic
932356153 2:71069901-71069923 GAAATGCTGACCAGATGGCAGGG - Intronic
940920959 2:159306045-159306067 GGGCAGTTCACCCGATGTCAGGG - Intergenic
942501134 2:176592139-176592161 GAGAAGCTCCCCAGATGTGAGGG + Intergenic
944098335 2:195994873-195994895 GACATGCTGGCCCAATGTCAAGG - Intronic
947269455 2:228317849-228317871 GGGATGATCACCTGAGGTCAGGG + Intergenic
947713949 2:232330607-232330629 GAGGTGCTCAGCGGATGACAGGG + Intronic
1172890184 20:38258846-38258868 GAGTTGCTCACCCTTTGACAGGG + Intronic
1174672855 20:52324132-52324154 GAGATGCTCACCCTGTGGGAGGG + Intergenic
1175762541 20:61571371-61571393 GAGATGCTCACCCGATGTCAAGG - Intronic
950870944 3:16228412-16228434 GGGAGGATCACCTGATGTCAGGG + Exonic
952971904 3:38656634-38656656 GAGCTGCTCACCCAAGGTTATGG - Intergenic
964224851 3:154386397-154386419 GAGATTCATACCTGATGTCAAGG + Intronic
968509640 4:989836-989858 GAGATGTTCGCCCGCAGTCACGG - Exonic
969431377 4:7156799-7156821 GAGATGCTCTTCCCATCTCAAGG - Intergenic
977722197 4:100252413-100252435 GAGATCCTCACCCACTGGCATGG + Intergenic
991488467 5:67162690-67162712 GAGGCTCTCACCCGATGACAGGG - Exonic
997379367 5:133424304-133424326 GAGATGATCACCCAGTGTGATGG + Intronic
1000005778 5:157183508-157183530 TAGATGCTTACCAGATGACAGGG - Intronic
1002546273 5:179947459-179947481 GAGAAGCTCACCAAGTGTCAGGG - Intronic
1009878396 6:69534925-69534947 GAGATGCTCTGCCAATTTCAGGG - Intergenic
1014695750 6:124619230-124619252 AAGATGCTCAGCCTATGTCATGG + Intronic
1018523880 6:164685570-164685592 GAGATGCTTAGCCCATGTCCTGG - Intergenic
1018846582 6:167561058-167561080 GTGATGCTCACCCCTTGTGATGG - Intergenic
1022297121 7:29066675-29066697 GAACTGCTCACCAGATGACATGG + Intronic
1033338338 7:140472192-140472214 GAGTGGCTCACCTGAGGTCAGGG + Intronic
1035499367 8:79298-79320 GAAATGCTCACCCTTTGACAGGG - Exonic
1036622031 8:10430604-10430626 GAGATGCTCCTCGGATGTCCCGG + Intergenic
1043861235 8:85319659-85319681 GAGATGCTCATCTGATGTTCTGG + Intergenic
1047624940 8:126646987-126647009 GAGATGCACACCCCAGCTCAAGG + Intergenic
1049174782 8:141185166-141185188 AAGATGCTCACCCCAAGTTATGG + Exonic
1056032437 9:82567194-82567216 TAGATGTTCAGCCAATGTCAAGG + Intergenic
1060990337 9:127845333-127845355 GAGATGGTCACCCCTTGCCATGG + Intronic
1189184621 X:39042808-39042830 GAGTTGCTCACCCAGTTTCAAGG + Intergenic
1191755731 X:64590526-64590548 GAGTAGATCACCCGAGGTCAGGG - Intergenic