ID: 1175762545

View in Genome Browser
Species Human (GRCh38)
Location 20:61571394-61571416
Sequence CTTGATGCCCAGAGGGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175762541_1175762545 0 Left 1175762541 20:61571371-61571393 CCTTGACATCGGGTGAGCATCTC 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1175762538_1175762545 20 Left 1175762538 20:61571351-61571373 CCGAAGGTAGACAGTGCTGGCCT 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1175762536_1175762545 27 Left 1175762536 20:61571344-61571366 CCATGAGCCGAAGGTAGACAGTG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG 0: 1
1: 0
2: 0
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175762545 Original CRISPR CTTGATGCCCAGAGGGTACC TGG Intronic
900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG + Intronic
900144194 1:1150839-1150861 CTAGAGGCCCAGAGGGAATCTGG - Intergenic
900820014 1:4879397-4879419 CCTGTTGCCCCGAGAGTACCGGG - Intergenic
904455934 1:30648043-30648065 CTTGGTGCCCTGTGGGTACTTGG - Intergenic
905305480 1:37015072-37015094 CTTGATGCAGAGATGGGACCAGG - Intronic
912583230 1:110738370-110738392 CATCCTGCCCAGAGGGCACCTGG + Intergenic
917207262 1:172590233-172590255 CTTGATTCCCAGAGGGCTCATGG + Intronic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
919768816 1:201144225-201144247 CCTGATGCCGAGAGGCTCCCGGG + Intronic
920491650 1:206420303-206420325 CTTGATGACTGGAGGGAACCAGG + Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
1063968897 10:11367732-11367754 CTCGGTGCCCACAGGGCACCAGG + Intergenic
1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG + Intronic
1070731041 10:78828429-78828451 CTCGGTCCCCAGAGGGTATCTGG + Intergenic
1076031017 10:127158539-127158561 CTGAACGCCCAGAAGGTACCAGG - Intronic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG + Exonic
1078486143 11:11725178-11725200 CGTCATCCCCAGAAGGTACCAGG + Intergenic
1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG + Exonic
1083207345 11:61160796-61160818 CTTTGCGCCCAGAGGGTCCCGGG + Intronic
1083581272 11:63827021-63827043 CTTGGTGCCCTGGGGGTGCCTGG - Exonic
1084057525 11:66645843-66645865 CTTGAAGGCCAGAGAGTAACTGG - Intronic
1085732940 11:79014599-79014621 CTTCATGCACAGAGGCCACCAGG + Intronic
1087361871 11:97170915-97170937 CTTGAAGCCTAAATGGTACCAGG - Intergenic
1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG + Intronic
1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG + Exonic
1095532307 12:43202866-43202888 CTTCATGCCCAAAGTGCACCAGG + Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1098172290 12:67759150-67759172 CTTGATGCCCACGGTCTACCTGG + Intergenic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1105015589 12:132784961-132784983 CTTGCTGCCTCGATGGTACCAGG + Intronic
1106593761 13:31120007-31120029 CTTGATCTACCGAGGGTACCAGG - Intergenic
1109436657 13:62312292-62312314 CTTGATGCCCTCAGAATACCAGG + Intergenic
1113208151 13:107941630-107941652 CTTGTTGCCATGAGGATACCAGG + Intergenic
1118346410 14:64944378-64944400 CTGGAGGCCCAGAGAGTACTAGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1122043447 14:99007071-99007093 CTCGGGGCCCAGAGGGTTCCCGG + Intergenic
1122129851 14:99598637-99598659 CCTGCTGCCCAGAGAGTTCCAGG - Intronic
1122797356 14:104212680-104212702 CTGGAGGCCCAGAGAGGACCCGG + Intergenic
1124667581 15:31606726-31606748 TTTAATGCCTAGAGGGTATCTGG - Intronic
1128721889 15:69956133-69956155 CTTGATGCCCACAGTGTGCAAGG - Intergenic
1128801157 15:70497987-70498009 CTTGCTGCCCACAGGGAACTAGG + Intergenic
1133271707 16:4613738-4613760 TGTGCTGCCCAGAGGCTACCTGG - Intronic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1137559627 16:49494370-49494392 CTTGATGCCCCAAGGGGACCAGG + Intronic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1139343485 16:66287161-66287183 CTTGATTCCCTGATGGTTCCCGG - Intergenic
1139666492 16:68460541-68460563 ATGGATGCCCAGAGGGTTACAGG + Intergenic
1141291581 16:82722773-82722795 CAAGATGCTCACAGGGTACCAGG + Intronic
1141497006 16:84417152-84417174 GGTGATGCCCATAGGGTACTTGG + Intronic
1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG + Exonic
1143447009 17:7015591-7015613 CTTGAGGCCCTGCGGGAACCGGG - Intronic
1148344919 17:46896857-46896879 CTAGATGCCCTCAGGGTCCCAGG - Intergenic
1148997495 17:51723903-51723925 CTGGGTGCCCATGGGGTACCTGG + Intronic
1150490970 17:65574073-65574095 CCTGATGCCCAGGGAATACCTGG + Intronic
1150777717 17:68094902-68094924 AGTGTTGCCAAGAGGGTACCAGG + Intergenic
1153176669 18:2382184-2382206 CTTGAAGCCCAGTGGGTTTCAGG - Intergenic
1156456531 18:37297883-37297905 CTTGACGGCCAGAGGGCACAGGG - Intronic
1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG + Intronic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1161592159 19:5133758-5133780 CTGGCTGCCCACAGGGTCCCTGG - Intronic
1161949407 19:7459529-7459551 CTTGATTCCCGGAGGCTTCCTGG + Intronic
1167490740 19:49791640-49791662 CTGGGTGCCCATGGGGTACCAGG - Intronic
926103524 2:10136244-10136266 GTTGAGGCCCAGATGATACCAGG + Intergenic
927455818 2:23248394-23248416 CTTAATGCCCAGAGGTGGCCAGG - Intergenic
932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG + Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
934655023 2:96112841-96112863 CTTGTTGCCCAAAGGCTGCCTGG - Intergenic
934732793 2:96669937-96669959 CTCAATGCCCAGAGGTTTCCCGG + Intergenic
934845802 2:97660724-97660746 ATAGTCGCCCAGAGGGTACCTGG + Intronic
935205128 2:100890509-100890531 CCTGATGACCTGAGGGTACAGGG - Intronic
935349011 2:102137572-102137594 CTTGATGCCCAGAGCTTGCCAGG - Intronic
935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG + Intergenic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
942950981 2:181721267-181721289 CTTGATCTCCAGATGGCACCTGG - Intergenic
947422399 2:229952753-229952775 AGTGTTGCCAAGAGGGTACCAGG + Intronic
948450502 2:238067588-238067610 CATGTCGCCCACAGGGTACCTGG - Intronic
948483778 2:238267314-238267336 CTTGAAGCTCAGAGGTTACAAGG - Intronic
949034155 2:241808911-241808933 CCTGATGCTCAGAGGGTAACTGG - Intronic
1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG + Intronic
1170894830 20:20403630-20403652 CTGCATGCCCAGATGTTACCTGG + Intronic
1172719245 20:36986727-36986749 CTTGATGTCCAGAAGGTGACAGG - Intergenic
1173948260 20:46968747-46968769 TTTGCTGCCCAGAGGACACCTGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1178140112 21:29673078-29673100 CTTTATTCCCAGAGGGCAGCTGG + Exonic
1182284008 22:29233428-29233450 CTGGAGGCCCAGTGGGTCCCTGG - Exonic
1182384938 22:29930253-29930275 ATTAATGGCCAAAGGGTACCTGG - Intronic
1182472123 22:30555112-30555134 CTTGGTGCCCAGCGGCTGCCAGG + Exonic
1183254661 22:36754573-36754595 AATGATGCCTAGAGGGTGCCAGG + Intergenic
1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG + Intronic
1185011667 22:48317944-48317966 ACCGATACCCAGAGGGTACCAGG + Intergenic
954539846 3:51386000-51386022 TTTGATGCCCTGGGTGTACCAGG + Intronic
956202233 3:66718609-66718631 CTTGATGCCCAGACCACACCCGG + Intergenic
961554356 3:127688099-127688121 CCTGCTTCCCAGAGGGTCCCTGG - Intergenic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
973784166 4:54319510-54319532 CTTTCTGCCCAAAGGCTACCTGG - Intergenic
978490374 4:109305280-109305302 CTTGATGCAGAGAGTCTACCAGG - Intergenic
978878738 4:113674490-113674512 CTTGATGCCCACAGTTTACAAGG + Intronic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
987383541 5:17308303-17308325 CTTTATTACCAGTGGGTACCTGG + Intergenic
990361767 5:55027956-55027978 TTTTCTGCCCACAGGGTACCTGG - Intronic
990852718 5:60225030-60225052 CTTGCTTCCCAGGTGGTACCTGG - Intronic
997948549 5:138223641-138223663 CTTGCTGCCCTGAAGGAACCAGG + Intergenic
999691260 5:154147833-154147855 TATGATGCACAGAGGGTTCCAGG - Intronic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG + Intronic
1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG + Intergenic
1020098436 7:5381129-5381151 CTTGAGGCCCTGAGGGTGGCAGG - Intronic
1023142710 7:37118208-37118230 CTTAATGCACAGAGGCTACTTGG + Intronic
1024105404 7:46079588-46079610 CTTTATACCCTGAGGGTAACTGG + Intergenic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG + Intergenic
1035531579 8:356398-356420 CTAGAGGCACAGAGGCTACCTGG + Intergenic
1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG + Intronic
1037915436 8:22770124-22770146 GTGGAAGCCCACAGGGTACCAGG + Intronic
1043496793 8:80810148-80810170 CCTCATGCCCACAGGGTACCAGG + Intronic
1043872244 8:85446469-85446491 CTTGGCCCCCAAAGGGTACCAGG + Intronic
1044998658 8:97861073-97861095 CTTGATGCCCAGCTCATACCTGG - Intergenic
1047625042 8:126647726-126647748 CTTCATGCCCAGAGGATACATGG - Intergenic
1048439288 8:134448041-134448063 CATGATGCCCAGAGGGTCTCTGG - Intergenic
1049696798 8:143987993-143988015 CCTGATGCTCAGAGGGCTCCAGG + Intronic
1053289872 9:36872860-36872882 CCTCATGCCCAGAGGTTTCCAGG + Intronic
1055565489 9:77564430-77564452 ATTGATACCCAGAGACTACCAGG + Intronic
1057825219 9:98368017-98368039 CTTCATGCACAGAGGGGATCAGG - Intronic
1060719792 9:125969281-125969303 CTTGATGCAGAAAAGGTACCTGG - Intergenic
1061118476 9:128628994-128629016 CCTGGTGCCCGGCGGGTACCTGG - Intronic
1062221731 9:135419682-135419704 CTTGATGCCCAGTAGGGAGCCGG - Intergenic
1187045669 X:15646232-15646254 CTTGGTGGCCAGACCGTACCCGG + Intronic
1188243322 X:27813953-27813975 CTTGATTCTCAGAAGGTCCCTGG - Intronic
1191914600 X:66188048-66188070 CTTGAAGACCAGAGGGTGGCAGG + Intronic
1198729027 X:139707475-139707497 CTTGGTCCCCAGAAGGTAGCCGG - Intronic