ID: 1175764034

View in Genome Browser
Species Human (GRCh38)
Location 20:61580904-61580926
Sequence TCGGGTCCTGCTGTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175764034_1175764042 29 Left 1175764034 20:61580904-61580926 CCCCAACAAACAGCAGGACCCGA 0: 1
1: 0
2: 4
3: 9
4: 109
Right 1175764042 20:61580956-61580978 AGAGAGTCCGTCCTGAAGCATGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175764034 Original CRISPR TCGGGTCCTGCTGTTTGTTG GGG (reversed) Intronic
900208276 1:1440795-1440817 TCGGCGGCTGCTGTTTGTGGAGG - Exonic
901171139 1:7258513-7258535 TCAGTCCCTGCTGTGTGTTGGGG - Intronic
912746179 1:112247422-112247444 TCCTGACCTGCTGTTTGTTCTGG - Intergenic
915117290 1:153608850-153608872 TTGGGTCCTGCTGTGTATTTAGG - Intronic
917770373 1:178270793-178270815 CCTGGACCTGCTGTTTGTCGGGG + Intronic
921143428 1:212328116-212328138 TTGGTTCCTGCTTTTAGTTGAGG + Intronic
921465679 1:215484223-215484245 TCCTGTCCTGCTCTTTGTTCTGG - Intergenic
922347962 1:224712376-224712398 TCTTGTCCTGCTGTGTGTTGTGG + Intronic
924740289 1:246790914-246790936 TCGGGGCCTCCTGTGTGCTGTGG + Intergenic
1068886334 10:62100987-62101009 TCTGGACCTGGTGTTTTTTGTGG - Intergenic
1072088242 10:92101419-92101441 TGGGGTGCTGCTTCTTGTTGGGG - Intronic
1074470632 10:113723414-113723436 CCAGCTCCTGCTGTTTCTTGGGG + Intronic
1078124710 11:8549608-8549630 TTGGGTCCTGAGCTTTGTTGGGG + Intronic
1082762999 11:57144824-57144846 TCCGCTCTTGCTGTTTATTGTGG - Intergenic
1083166553 11:60891656-60891678 TCTGGTCCTGCTCTGTGTTAGGG - Intronic
1084093599 11:66895277-66895299 TCTGGGCAGGCTGTTTGTTGGGG - Intronic
1085023583 11:73223814-73223836 TGGGGTCCTGCTCTATGTTGGGG + Intronic
1088641693 11:111879102-111879124 TCGGCGCCTCCTGTTGGTTGGGG - Exonic
1091635888 12:2196207-2196229 TGGGGTCCTTCTGTTGGTTTAGG + Intronic
1092086723 12:5768756-5768778 CAGGGTCCTGCTGTTGGTTTTGG - Intronic
1092757578 12:11777975-11777997 CCGAGTCCTGCTGTGTGCTGGGG - Intronic
1093590231 12:20894074-20894096 TCATGACCTGCTGTTTCTTGAGG - Intronic
1094812947 12:34159526-34159548 TGGGGTCTTGTTGTTTGTTTTGG - Intergenic
1096741392 12:53696366-53696388 TCGGGTCCTGGAGATTGATGCGG - Intergenic
1101580605 12:106038187-106038209 TCACCTCCTGCTGTTTTTTGAGG + Intergenic
1103325377 12:120116747-120116769 TCAGTTCCGGCTGTTTGTTCGGG - Exonic
1110305604 13:73983807-73983829 TCAGTTACTGCTGTCTGTTGTGG - Intronic
1114842174 14:26277442-26277464 TCAGTTCCTGCTGTTTGATTTGG - Intergenic
1115077716 14:29412042-29412064 TCGGGGCCTGTTGTGGGTTGGGG - Intergenic
1119228538 14:72962284-72962306 TGGGGTCCTGCTGATAGCTGGGG - Intergenic
1125063244 15:35450186-35450208 TAGGGTACTGGTTTTTGTTGGGG - Intronic
1130738103 15:86571312-86571334 TCGGGACCTGCTGAATGGTGAGG - Intronic
1132478997 16:156737-156759 TCTGCTCCTGCTGTCTGCTGTGG - Intronic
1136109593 16:28056456-28056478 CCGGGGCCTGCTGTTGGGTGGGG + Intronic
1136188189 16:28600544-28600566 TCGGATCCAGCTGTTTGTTGAGG - Intergenic
1136190661 16:28613538-28613560 TCGGATCCAGCTGTTTGTTGAGG - Intronic
1136316237 16:29455931-29455953 TCGGATCCAGCTCTTTCTTGAGG + Intronic
1136430814 16:30195273-30195295 TCGGATCCAGCTCTTTCTTGAGG + Intronic
1139613600 16:68075832-68075854 TAGGGTCCTGCTGTTGTTTGAGG - Intronic
1142343482 16:89538801-89538823 TCGGGTCCTGCGGCAAGTTGAGG + Intronic
1146359244 17:32160421-32160443 TCGGGACCTGCTGAATGGTGGGG + Intronic
1148890461 17:50803368-50803390 TCGGGGCCTGTTGTTTGGTTTGG - Intergenic
1152403761 17:80084949-80084971 TCCGCTCCAGCTGCTTGTTGAGG - Exonic
1152797580 17:82315697-82315719 TCGGTCCCTGCTGTTTGTCTGGG - Intronic
1152934953 17:83131135-83131157 TAGGGTCCTGCTGGTGGCTGGGG + Intergenic
1153079087 18:1199819-1199841 TCTGGCCCTGCTGTTTTTTCGGG + Intergenic
1154422885 18:14250770-14250792 TCAGGCCCTGCGGTTTGTTTTGG - Intergenic
1155521093 18:26669818-26669840 TGGGGTCTTGCTGTTTGTCCAGG - Intergenic
1157542769 18:48523859-48523881 TCGGGTCCTGTTGGGGGTTGGGG + Intergenic
1160065968 18:75574612-75574634 TCTGCTCCTGCTGTCTGTTATGG - Intergenic
1160420782 18:78742461-78742483 TCGGGTCTTGCTGTTAGGTTGGG - Intergenic
928714250 2:34042416-34042438 TTGGCTACTGCTGTTTGCTGGGG + Intergenic
928794912 2:35006434-35006456 TCTGATCATGCTGTTTGTTCAGG - Intergenic
934710153 2:96509090-96509112 TTAGGTCCTGCTGATGGTTGTGG - Intergenic
934937426 2:98475663-98475685 TAGTCTCCTGCTGTTTGCTGGGG + Intronic
935204939 2:100889359-100889381 ACGGGGCTTTCTGTTTGTTGAGG + Intronic
936145002 2:109974991-109975013 TCGGCTCCTGCTGTATATTTGGG + Intergenic
936181688 2:110272954-110272976 TCGGCTCCTGCTGTATATTTGGG + Intergenic
936199684 2:110396476-110396498 TCGGCTCCTGCTGTATATTTGGG - Intergenic
936230878 2:110698726-110698748 TCGGCTCCTGCTGTATATTTGGG - Intergenic
936617130 2:114059477-114059499 TCGGGTCCTGTTGTGGGGTGGGG + Intergenic
940389901 2:153120237-153120259 TGGGGTCCTTGTGTGTGTTGAGG - Intergenic
945053827 2:205850524-205850546 TAGGGGCCTGCTCTTTGTTGGGG - Intergenic
946833128 2:223745253-223745275 CAGGGTCCTGCTGTTTCTTTTGG - Intergenic
948656023 2:239477043-239477065 GTGGGTCCTGGTGGTTGTTGGGG + Intergenic
1169537966 20:6566616-6566638 TGGGGTCTTGCTCCTTGTTGAGG - Intergenic
1173142439 20:40495890-40495912 TGGGCTCCTTCTGTGTGTTGAGG - Intergenic
1173964601 20:47102551-47102573 TGGGGACTTGCTGTTTTTTGGGG + Intronic
1175467045 20:59196482-59196504 ACAGGGCCTCCTGTTTGTTGGGG - Intronic
1175764034 20:61580904-61580926 TCGGGTCCTGCTGTTTGTTGGGG - Intronic
1177817854 21:25997772-25997794 TCGGCTCTGGCTGTTTGCTGAGG + Intronic
1178725696 21:35049559-35049581 TCGGCTCCTGTTGTTATTTGTGG + Intronic
1179408470 21:41144057-41144079 GCAGGTCCTGCTGCCTGTTGAGG - Intergenic
1181018440 22:20084991-20085013 TCGGCTCCAGCTGTCTCTTGTGG + Intronic
1182620137 22:31614366-31614388 TCGGGTAGTGCTGGTTGCTGTGG - Intronic
1183134010 22:35869198-35869220 TGGGGTTTTGTTGTTTGTTGTGG + Intronic
1183728838 22:39605699-39605721 TGGGGTCCTGCTTTTGATTGGGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951545235 3:23818140-23818162 TCGGGTTCTTCTGGGTGTTGGGG + Intronic
952723632 3:36558996-36559018 TCTGTTTCTGCTGTTTGGTGTGG - Intergenic
952978037 3:38712949-38712971 TCGGGTCCTAGTGTTTGTAAAGG + Intronic
955943371 3:64167876-64167898 TCAGGTCCTGCTGTTAGTCCAGG + Intronic
956007153 3:64792321-64792343 TCTGGTCCTGCTTTTTGTGAAGG - Intergenic
961861389 3:129919199-129919221 CCTGGTCCTGCTCTTTATTGGGG - Intergenic
962404557 3:135089739-135089761 TCGTGTCCTGCTGTTTGCTTTGG + Intronic
962900933 3:139760891-139760913 CCAGGTCCTGCTGTGTGATGTGG + Intergenic
968507459 4:977566-977588 GTGGGTCCAGCTGCTTGTTGGGG + Intronic
969848434 4:9937737-9937759 TCAGGCCCTGCTGTCTGTGGTGG - Intronic
971503054 4:27337141-27337163 TTGGGTGCTGCTGTTTATAGGGG + Intergenic
973916152 4:55636433-55636455 TCGGGTCCTGCTGCAGGGTGGGG - Intronic
974342016 4:60626406-60626428 TCGGGGCCTGCTGTGGGTTGCGG - Intergenic
976373195 4:84314102-84314124 CCGGGTCCTGTTGTGGGTTGGGG - Intergenic
981346133 4:143678378-143678400 CCGGGGCCTGTTGTTGGTTGGGG + Intronic
982196471 4:152920611-152920633 TGGGTTCCAACTGTTTGTTGTGG - Intergenic
984548310 4:181132504-181132526 TGGGGTCCGGCTCTGTGTTGAGG + Intergenic
987001247 5:13662249-13662271 TGGGGTCCTGCAGTTTGTGATGG - Intergenic
990736965 5:58875134-58875156 CCTGGTCCTGCTGCTGGTTGGGG - Intergenic
1003021930 6:2517294-2517316 TCGGGGCCTGCTGTTTGCTGAGG + Intergenic
1006123525 6:31822239-31822261 TCGGGTGGCGCAGTTTGTTGGGG - Intergenic
1008621384 6:53274783-53274805 TCTGGTCCTTCTGTATGGTGTGG - Intronic
1018798497 6:167205472-167205494 TGGGGTAGTGCTGTGTGTTGAGG + Intergenic
1020633688 7:10671663-10671685 TGGGCTGCTGCAGTTTGTTGGGG + Intergenic
1024607413 7:51033941-51033963 TGGGCTCCTGCTGTTTCTAGAGG - Intronic
1024729924 7:52242671-52242693 TGGGGTCCTGCAGTGTTTTGGGG + Intergenic
1024958878 7:54954520-54954542 TGGGGTCTTGCTGTTTCATGTGG - Intergenic
1028435055 7:90793748-90793770 TTGGGGCCTGCTGTCTGTTTTGG + Intronic
1028658087 7:93233730-93233752 TTGGGTCCTGCTGTATCCTGTGG + Intronic
1032427087 7:131830917-131830939 TCGGGTCCTCCTGCTTAGTGCGG + Intergenic
1035599391 8:888640-888662 TGGGGTGCTGCAGTTTGCTGGGG + Intergenic
1040091918 8:43407870-43407892 AGGGGTGCTGCAGTTTGTTGGGG + Intergenic
1040434858 8:47380429-47380451 GCGGGGCCTGCTGTTTGCTGTGG + Intronic
1040515491 8:48130924-48130946 CCAGGTCCTACTGTGTGTTGGGG - Intergenic
1055489085 9:76786408-76786430 TTGGGTCCTGCTGTTGGTTGTGG - Intronic
1055842206 9:80519051-80519073 AGGGATCCTGCTGTTTGCTGGGG + Intergenic
1061846363 9:133390720-133390742 TCAGGTCCTGCAGTTTGCAGTGG - Exonic
1186437862 X:9558567-9558589 TTGGTTTTTGCTGTTTGTTGCGG + Intronic
1187038275 X:15565508-15565530 TTCGCTCCTGCTGTCTGTTGTGG + Intronic
1189752306 X:44234826-44234848 TCTGGTCCTTCTGTCTGTTGAGG - Intronic
1190442459 X:50488776-50488798 TCGGGACCTGTTGTTGGGTGGGG - Intergenic
1191983234 X:66949085-66949107 TCGGGTCCTGTTGTGGGGTGGGG + Intergenic
1192816204 X:74595150-74595172 TCTGGCCCTGCTGTTTGGTGTGG - Intronic
1198828011 X:140719266-140719288 TCGGGTATTGCTGTGTGTTTTGG - Intergenic
1202013665 Y:20377064-20377086 TCTGGTCTTGCTGTTTGTAAAGG + Intergenic