ID: 1175764542

View in Genome Browser
Species Human (GRCh38)
Location 20:61583283-61583305
Sequence CGGTTCTGCGGGGGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 2, 1: 0, 2: 3, 3: 6, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175764542 Original CRISPR CGGTTCTGCGGGGGGACAGA GGG Intronic
900531855 1:3157825-3157847 CGGTGCTGGGGGAGGCCAGATGG - Intronic
903807642 1:26016872-26016894 TGGGTCTGAGGAGGGACAGAAGG + Intergenic
911425943 1:97712686-97712708 TGGTTCTGCAGTGGGAGAGAGGG - Intronic
1069596796 10:69677239-69677261 GGGTTCTGCGTGGGCTCAGATGG - Intergenic
1073538087 10:104295877-104295899 GGGTTCTGGTGAGGGACAGAGGG - Intronic
1075591416 10:123694147-123694169 CAGTGCTGTGGGGGTACAGAGGG + Exonic
1076833475 10:133008399-133008421 CGGTGATGCGGAGGGAAAGAGGG + Intergenic
1077387260 11:2275946-2275968 CGGCTCCCCGGGGGGACAGCAGG - Intergenic
1077662767 11:4084286-4084308 CAGTTCAGCGGGAGGGCAGAAGG + Intronic
1083426750 11:62592003-62592025 CCGTTTTGCGGGAGGACAGGGGG - Intronic
1083721974 11:64607738-64607760 CGGGTTTGCGGGGTGACAGGAGG + Exonic
1084937764 11:72596140-72596162 AGATGCTGCGGAGGGACAGATGG - Intronic
1092280906 12:7097024-7097046 GGGCCCTGCTGGGGGACAGATGG - Exonic
1104636093 12:130438512-130438534 GGGTCCTGGGAGGGGACAGAAGG + Exonic
1112570784 13:100591018-100591040 AGATTCTGCAGGTGGACAGAGGG + Intergenic
1113418285 13:110148800-110148822 CAGCTCTCTGGGGGGACAGAGGG + Intergenic
1119264337 14:73255145-73255167 GGGTTCAGCGGGGGGAGACATGG - Intronic
1120471685 14:84933616-84933638 AGGTTATTCGGGGGTACAGATGG + Intergenic
1120704847 14:87735210-87735232 CGGTGCAGCGGGGGGGCTGAAGG + Intergenic
1125503890 15:40255735-40255757 AGGATCAGCGAGGGGACAGAGGG + Intronic
1129262771 15:74378044-74378066 CCGGTCTGTGGGGGGACAGAGGG + Intergenic
1131340577 15:91596987-91597009 CGGTCCTGAGGGGTTACAGAGGG + Intergenic
1131473342 15:92714882-92714904 CGGTTCTGCGGCGGGGCGGCTGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133329118 16:4960385-4960407 CAGTGCTGGGGTGGGACAGATGG - Intronic
1135306347 16:21370748-21370770 CGGTGCTGAGGGATGACAGATGG - Intergenic
1136303091 16:29349892-29349914 CGGTGCTGAGGGATGACAGATGG - Intergenic
1136506898 16:30710153-30710175 GGGTTCAGAGGGGGAACAGAGGG + Intronic
1144460896 17:15457895-15457917 GGGTCCTGTGGGGGAACAGAGGG - Intronic
1152808595 17:82370885-82370907 GGGTTCTGCTGGGGGAGAGGAGG - Intergenic
1154165915 18:12014355-12014377 CGGGTCTCCGGGGAGACAGGTGG + Exonic
1157248385 18:46072587-46072609 AGGCTCTGCGGGGTGATAGACGG + Intergenic
1158491675 18:57916023-57916045 CAGTTCTGCTGCTGGACAGATGG + Intergenic
1159961556 18:74559256-74559278 CTGCTCTGCGGGGGGAGCGAAGG - Intronic
1160461977 18:79046385-79046407 CGGTGCTGTGGGGGGAAGGAGGG + Intergenic
1161083782 19:2324384-2324406 CACGTCTGCGGGGGGCCAGATGG + Intronic
1161208321 19:3053778-3053800 AGGTTGGGAGGGGGGACAGAGGG - Exonic
1161288421 19:3480246-3480268 CGGTACTGCGGGGGTTGAGAAGG + Intronic
1161495806 19:4584978-4585000 CCGTTCTGGGGGGGGCCGGAGGG - Intergenic
1162777737 19:12990075-12990097 TGGGTCTGTGGGGGGACTGAGGG - Intergenic
1166411978 19:42561596-42561618 GGACTCTGAGGGGGGACAGAGGG - Intergenic
1166423260 19:42654341-42654363 GGGCTCTGAGAGGGGACAGAGGG + Intronic
1166944494 19:46388535-46388557 CCGTTCTGAGGGTGGGCAGAAGG - Exonic
1167497910 19:49830195-49830217 TGGTACTGCGGGGGGACGGGGGG - Exonic
926801635 2:16665224-16665246 GGGTTCTGGGGGAGGAGAGAGGG + Intronic
926911679 2:17857496-17857518 AGGTGCTGCAGGGAGACAGATGG + Intergenic
927555067 2:24025362-24025384 GGCTTCTGCGGCAGGACAGAGGG + Intronic
931817544 2:65919688-65919710 CGGTTCACCGCAGGGACAGAGGG + Intergenic
937577807 2:123445294-123445316 CGGTTCAGAGTGGGGAAAGAAGG + Intergenic
947739021 2:232476474-232476496 AGGTTCTGCGGGGGGAGATTGGG - Intergenic
1174411881 20:50341618-50341640 CAGCTCTGATGGGGGACAGAAGG - Intergenic
1175402025 20:58706476-58706498 CTGTTCTGGGGGGCGACAGGTGG + Intronic
1175764493 20:61583122-61583144 AGGCTCTGCGGGGGGACAGAGGG + Intronic
1175764498 20:61583142-61583164 GGGCTCTGCGGAGGGACAGAGGG + Intronic
1175764511 20:61583183-61583205 GGGCTCTGCGGAGGGACAGAGGG + Intronic
1175764517 20:61583203-61583225 GGGCTCTGCGGGGGGACAGACGG + Intronic
1175764524 20:61583223-61583245 CGGTTCTGCGGGGGGACAGAGGG + Intronic
1175764529 20:61583243-61583265 GGGCTCTGAGGAGGGACAGAGGG + Intronic
1175764535 20:61583263-61583285 GGGCTCTGCGGGGGGACAGACGG + Intronic
1175764542 20:61583283-61583305 CGGTTCTGCGGGGGGACAGAGGG + Intronic
1175764549 20:61583303-61583325 GGGCTCTGTGGGGGGACAGAGGG + Intronic
1184226569 22:43132303-43132325 CGGGTCTGCGGGGCGCCAGAGGG - Exonic
1184491950 22:44814899-44814921 GGGGTCTGCGGGGGGTCACAAGG + Intronic
950944319 3:16928910-16928932 CATTTCAGCGGAGGGACAGATGG + Intronic
952838833 3:37627442-37627464 CGGGGCTGCGGGGGGAGAGGAGG - Intronic
954303898 3:49715557-49715579 GGGCTCTGCAGGGGGACAGGAGG - Exonic
961818388 3:129562939-129562961 AGGTTCTGCAGGGGGAGAGTGGG + Exonic
980850754 4:138378482-138378504 CTGTTGGGTGGGGGGACAGAAGG + Intergenic
997587216 5:135050578-135050600 CGGTTCTCCGGTGGCACAGCGGG - Intronic
997630138 5:135361131-135361153 GGGGTCTGCAGGGAGACAGATGG - Intronic
997864986 5:137453809-137453831 CTGTTCTGTGGGGGTACAGGGGG + Intronic
1002575811 5:180173020-180173042 AGGTCCTGCCAGGGGACAGAAGG - Intronic
1003216387 6:4117081-4117103 CATTTCTGTGTGGGGACAGAGGG - Intronic
1007337374 6:41163240-41163262 CGGTGCAGGGTGGGGACAGAGGG + Intergenic
1010542027 6:77103414-77103436 GGGTTCTCTAGGGGGACAGATGG - Intergenic
1029345534 7:99975950-99975972 TGGTTCTCCTGGGGGACAGCAGG + Exonic
1029694148 7:102202070-102202092 GGGGTCAGCGGGGGGACCGAGGG - Exonic
1030240444 7:107317261-107317283 CTGTTCTGGGAGGGGATAGAAGG - Intronic
1033138503 7:138804286-138804308 TGGATGTGCTGGGGGACAGATGG - Exonic
1034983110 7:155490936-155490958 GGGTGCTGCAGGGGGGCAGAGGG - Intronic
1035112632 7:156496020-156496042 GGGGGCTGCGGGGAGACAGACGG - Intergenic
1040551070 8:48437993-48438015 CGGAACTGCAGGGGAACAGAAGG - Intergenic
1043039261 8:75240429-75240451 TGGTTCTGCAGGGAGACAGAGGG - Intergenic
1062396924 9:136356324-136356346 CTGGGCTGCGGGGGGCCAGAGGG - Exonic
1062629771 9:137458545-137458567 CTGCTCTGAGGGTGGACAGAGGG + Exonic