ID: 1175768238

View in Genome Browser
Species Human (GRCh38)
Location 20:61606042-61606064
Sequence CTCTGAGGACACATGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1026
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 986}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175768231_1175768238 12 Left 1175768231 20:61606007-61606029 CCTCTGGGCAATGCTGGGCAATG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1175768238 20:61606042-61606064 CTCTGAGGACACATGGGCCCAGG 0: 1
1: 0
2: 1
3: 38
4: 986
1175768229_1175768238 17 Left 1175768229 20:61606002-61606024 CCAAACCTCTGGGCAATGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1175768238 20:61606042-61606064 CTCTGAGGACACATGGGCCCAGG 0: 1
1: 0
2: 1
3: 38
4: 986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175768238 Original CRISPR CTCTGAGGACACATGGGCCC AGG Intronic
900074315 1:800697-800719 CAATGAGAACACATGGGCACAGG + Intergenic
900176383 1:1293219-1293241 CCCTGAGGACACAGGGACACAGG + Exonic
900226729 1:1536500-1536522 CACTGAGGACGAAAGGGCCCTGG - Intronic
900535959 1:3177721-3177743 CTGTGAGGAAACATGGTCCCTGG - Intronic
900574081 1:3374464-3374486 CTCTGGGGACACGTGTGTCCAGG - Intronic
900595418 1:3478114-3478136 CTCTGAGGTCAGAGGGGCTCAGG - Intronic
900737674 1:4309341-4309363 CAATGAGAACACATGGGCACAGG + Intergenic
900777821 1:4597999-4598021 CTATGAGAACACATGGACACAGG + Intergenic
901170703 1:7255084-7255106 CACTGAGAAGACATGGGCACAGG + Intronic
901272830 1:7966260-7966282 ATCTGAGGACAGCTCGGCCCAGG - Intronic
901528648 1:9840128-9840150 CTATGGGGAGACATGGCCCCTGG - Intergenic
903033856 1:20481842-20481864 CTCTGAGGACAGGGGGCCCCTGG + Intergenic
903140797 1:21338096-21338118 CTCTGAGGACATTTCAGCCCTGG + Intronic
903559026 1:24214167-24214189 CTGTGAGGCCCCATGGGACCTGG + Intergenic
904214840 1:28911081-28911103 CTGAGAGGGCAGATGGGCCCAGG + Intronic
904456984 1:30653771-30653793 CTCTGAGGTCAGATGGGGGCAGG - Intergenic
904905143 1:33891846-33891868 CACTGAGAACACATGGACACAGG + Intronic
905289228 1:36910235-36910257 CCCTGAGGACAAATGGAGCCTGG - Intronic
905462104 1:38128776-38128798 CTCTGAGGGCACTCTGGCCCTGG + Intergenic
905633367 1:39531469-39531491 CTCTGAAAACACCTGGGACCTGG + Intergenic
905688984 1:39928852-39928874 CTCTGAGGTGACGTGGGCCAGGG + Intergenic
905887409 1:41498850-41498872 CTCTGAGGACACAGGGTGACAGG + Intergenic
905983043 1:42248947-42248969 CAATGAGGACACATGGACACAGG - Intronic
906108264 1:43307379-43307401 CTCTGTGGGCCCCTGGGCCCAGG - Intronic
906332895 1:44902399-44902421 CTCTTAGACCACCTGGGCCCAGG + Intronic
906458009 1:46014369-46014391 CAATGAGGACACATGGACACAGG - Intronic
906514599 1:46431574-46431596 CTCTGAGGAGACCTAGGCCATGG + Intergenic
906531354 1:46525748-46525770 CTCTGGGGGCACAAGGGCCTCGG - Intergenic
906777400 1:48542035-48542057 CTATGAGAACACATGGACACAGG - Intronic
906881333 1:49594560-49594582 CAGTGAGGACACATGGACACAGG - Intronic
907003459 1:50886572-50886594 CAATGAGAACACATGGACCCAGG - Intronic
907020103 1:51059174-51059196 CCCTGAGGTCTCAGGGGCCCCGG + Intergenic
908658333 1:66412048-66412070 CAATGAGAACACATGGGCACAGG + Intergenic
908796451 1:67834456-67834478 AACTGAGGACAAGTGGGCCCTGG + Intergenic
909303855 1:74047389-74047411 CAATGAGAACACATGGGCACAGG + Intronic
909309007 1:74121777-74121799 CACTGAGAACACATGGACACAGG - Intronic
909427583 1:75545051-75545073 CAATGAGGACACATGGACACAGG - Intronic
909453399 1:75823670-75823692 CAATGAGAACACATGGGCACAGG - Intronic
909479705 1:76118183-76118205 CAATGAGAACACATGGGCACAGG - Intronic
910096667 1:83530493-83530515 CTATGAGAACACATGGACACAGG + Intergenic
910221559 1:84893510-84893532 CTCTGAGGACAGAGGGGCAGAGG - Intergenic
910740274 1:90508075-90508097 CAATGAGAACACATGGACCCAGG - Intergenic
910862838 1:91759551-91759573 CTCTTGGCACACATGAGCCCAGG + Intronic
911639327 1:100269880-100269902 CAATGAGAACACATGGGCACAGG - Intronic
911667406 1:100569152-100569174 CAATGAGAACACATGGGCACAGG + Intergenic
911811741 1:102291209-102291231 CAGTGAGGACACATGGACACAGG + Intergenic
911815446 1:102344053-102344075 CAATGAGAACACATGGACCCAGG + Intergenic
911836400 1:102624568-102624590 CAATGAGGACACATGGACACAGG - Intergenic
912093913 1:106115958-106115980 CAATGAGAACACATGGACCCAGG + Intergenic
912126945 1:106551086-106551108 CAATGAGAACACATGGGCACAGG - Intergenic
912630647 1:111243871-111243893 CTCTCAGTAAAGATGGGCCCAGG + Intergenic
912973862 1:114310308-114310330 CAATGAGGACACATGGACACAGG + Intergenic
913107277 1:115625926-115625948 CTATGAGAACACATGGACACAGG - Intergenic
913236691 1:116791135-116791157 CTGTGAGGACACAAAGGCACAGG + Intergenic
913284377 1:117213450-117213472 CTCATAGCACACATGTGCCCTGG + Intergenic
915003720 1:152617366-152617388 CAATGAGGACACATGGACACAGG + Intergenic
915420656 1:155778749-155778771 CAATGAGAACACATGGGCACAGG - Intronic
915470124 1:156120964-156120986 CTTTGAGGATGCATGGGCCCTGG + Intronic
915757554 1:158277345-158277367 CAATGAGGACACATGGACACAGG - Intergenic
915833079 1:159148923-159148945 CAATGAGGACATATGGGCACAGG - Intergenic
916245721 1:162686411-162686433 CAATGAGGACACATGGACACAGG - Intronic
916512006 1:165480709-165480731 CAATGAGGACACATGGACACAGG - Intergenic
916558011 1:165909785-165909807 TCCTGAGGACACAGGGCCCCTGG + Intronic
917365719 1:174230194-174230216 CTATGAGAACACATGGACACAGG + Intronic
917397504 1:174610249-174610271 CTATGAGAACACATGGACACAGG - Intronic
917964902 1:180172309-180172331 CTCGGAGGAGACATTGGCCTGGG + Intronic
918027163 1:180762068-180762090 CACTGAGAACACATGGACACAGG + Intronic
919042912 1:192414640-192414662 CAATGAGGACACATGGACACAGG + Intergenic
919289742 1:195614222-195614244 CAATGAGAACACATGGGCACAGG - Intergenic
919326299 1:196111207-196111229 CAATGAGAACACATGGACCCAGG + Intergenic
919454393 1:197804478-197804500 CTATGAGAACACATGGACACAGG + Intergenic
919519595 1:198571330-198571352 CACTGATGACACATGAGACCTGG - Intergenic
919937152 1:202261277-202261299 CACTGAGAACACATGGACACAGG - Intronic
920669809 1:207994920-207994942 CACTGAGAACACATGGACACAGG + Intergenic
921480084 1:215654384-215654406 CTATGAGAACACATGGACACAGG - Intronic
921551129 1:216536908-216536930 CTATGAGGGAAAATGGGCCCTGG + Intronic
921929295 1:220742117-220742139 CTCTGAACCCACATGGGGCCTGG - Intergenic
922198606 1:223381792-223381814 CAATGAGAACACATGGACCCAGG - Intergenic
922270164 1:224025601-224025623 CAATGAGAACACATGGGCACAGG + Intergenic
922451102 1:225737970-225737992 CTCTGAGAACACACAGGCCTGGG - Intergenic
922785552 1:228280762-228280784 CTCCGAGGAGACCCGGGCCCGGG + Exonic
922959605 1:229635249-229635271 CTCTGGGGGCACATGGACGCAGG + Exonic
923333517 1:232947212-232947234 CTCTGAGGAAGCATGTGACCCGG - Intergenic
924202341 1:241673134-241673156 CAATGAGGACACATGGACACAGG + Intronic
924559364 1:245144621-245144643 CAATGAGAACACATGGACCCAGG - Intergenic
924828495 1:247567371-247567393 CAATGAGAACACATGGGCACAGG - Intronic
1062908868 10:1199425-1199447 CTCTGAGGACATCTGGGCTGTGG + Intronic
1063000173 10:1910448-1910470 CAATGAGAACACATGGGCACAGG - Intergenic
1063056403 10:2509570-2509592 CTCTGATGACGCCTGGGTCCTGG - Intergenic
1063748557 10:8915216-8915238 CAATGAGGACACATGGACACAGG - Intergenic
1063957519 10:11280697-11280719 GACAGAGGACACATGGGCCACGG + Intronic
1064654753 10:17546095-17546117 CAATGAGGACACATGGACACAGG + Intergenic
1064975057 10:21105380-21105402 CAATGAGAACACATGGACCCAGG - Intronic
1065010967 10:21420379-21420401 CTCTGAAGACACAGGGTCACAGG - Intergenic
1065246546 10:23764741-23764763 CAGTGAGAACACATGGGCACAGG + Intronic
1065834732 10:29646422-29646444 CTTTGTGAACACATGGTCCCTGG - Intronic
1065860353 10:29867373-29867395 CTCTGGGGACACCTTGTCCCAGG - Intergenic
1065896918 10:30171100-30171122 CTCTGAAGACAAAAGAGCCCAGG - Intergenic
1065981999 10:30907472-30907494 CAGTGAGGACATATGGGCCTGGG + Intronic
1066519280 10:36197603-36197625 CAATGAGAACACATGGGCACGGG + Intergenic
1066588374 10:36963829-36963851 CACTGAGAACACATGGACACAGG + Intergenic
1066619779 10:37334382-37334404 CAATGAGAACACATGGACCCAGG - Intronic
1066746190 10:38605292-38605314 CTCTGAGTACCCTGGGGCCCCGG + Intergenic
1067213092 10:44278155-44278177 CAATGAGGACACATGGACACAGG + Intergenic
1067431839 10:46250441-46250463 CACTGTGGAGACCTGGGCCCTGG - Intergenic
1067441581 10:46311737-46311759 CACTGTGGAGACCTGGGCCCTGG + Intronic
1067562592 10:47314378-47314400 CTCTCAGGAGACATGGGCAAGGG + Intergenic
1067775569 10:49162714-49162736 CCCTGAGGCCACATGGTGCCAGG + Intronic
1067786304 10:49251422-49251444 CAATGAGAACACATGGACCCAGG + Intergenic
1067965727 10:50910465-50910487 CAATGAGAACACATGGACCCAGG - Intergenic
1068004280 10:51374287-51374309 CAATGAGAACACATGGGCACAGG - Intronic
1068369015 10:56090047-56090069 CAATGAGAACACATGGACCCAGG + Intergenic
1068382476 10:56274566-56274588 CTATGAGAACACATGGACACAGG - Intergenic
1068390622 10:56391693-56391715 CAATGAGAACACATGGACCCAGG + Intergenic
1068511142 10:57967470-57967492 CTATGAGAACACATGGACACAGG + Intergenic
1068516481 10:58031464-58031486 CAATGAGAACACATGGGCACAGG - Intergenic
1068728807 10:60333343-60333365 TTATGAGAACACATGGGCACAGG - Intronic
1068731622 10:60364490-60364512 CAATGAGAACACATGGACCCAGG + Intronic
1068847241 10:61691687-61691709 CAATGAGAACACATGGGCACAGG - Intronic
1068952160 10:62788586-62788608 CAATGAGGACACATGGACACAGG + Intergenic
1069232452 10:66028542-66028564 CAATGAGGACACATGGACACAGG + Intronic
1070349831 10:75581731-75581753 CAATGAGAACACATGGGCACAGG + Intronic
1070756947 10:78999174-78999196 ATCTGAGCGCACATTGGCCCTGG - Intergenic
1070842845 10:79499860-79499882 CTCTGAGGCCACAAGGGGCCTGG + Intergenic
1071234507 10:83629117-83629139 CAATGAGAACACATGGGCACAGG + Intergenic
1072364472 10:94695336-94695358 CAATGAGAACACATGGGCACAGG - Intronic
1072625570 10:97108941-97108963 CTGAGATCACACATGGGCCCAGG + Intronic
1072666056 10:97393286-97393308 CACTGAGCACACATGGAACCAGG + Intronic
1072855616 10:98943028-98943050 CTATGAGAACACATGGACACAGG + Intronic
1073478043 10:103767252-103767274 GTGTGAGGACACTGGGGCCCTGG - Intronic
1073603823 10:104873239-104873261 CACTGAGGAAAAATGGGTCCTGG - Intronic
1073676947 10:105658700-105658722 CTTTGAGAACACATGGACACAGG - Intergenic
1073885398 10:108033890-108033912 CAATGAGGACACATGGACACAGG + Intergenic
1074034517 10:109724905-109724927 CAATGAGGACACATGGACACAGG + Intergenic
1074271460 10:111957699-111957721 CAATGAGAACACATGGGCACAGG - Intergenic
1074527794 10:114276969-114276991 CCCTGAGGGCACATGTGCACAGG - Intronic
1074661395 10:115661972-115661994 CAATGAGGACACATGGACACAGG - Intronic
1074849808 10:117430592-117430614 CACTGAGAACACATGGACACAGG - Intergenic
1075000959 10:118797342-118797364 CACTGAGAACACATGGACACAGG + Intergenic
1075174849 10:120149772-120149794 CAATGAGGACACATGGGCACAGG - Intergenic
1076047825 10:127308629-127308651 CAATGAGAACACATGGGCACAGG - Intronic
1076263541 10:129091153-129091175 CTCTGTGGAGACAGGGACCCTGG - Intergenic
1076625355 10:131818482-131818504 CTCTAAGGACACACAGGCACAGG + Intergenic
1076830460 10:132991874-132991896 CACTGAGGAAACAGGTGCCCAGG - Intergenic
1076870707 10:133191897-133191919 CTTTGAGGCCACCTGGGGCCAGG - Intronic
1077945032 11:6887772-6887794 CAATGAGGACACATGGACACAGG - Intergenic
1077969144 11:7169405-7169427 CAATGAGAACACATGGGCACAGG - Intergenic
1078098664 11:8315857-8315879 TTCTGAAGACAGATGGGCACGGG + Intergenic
1078794439 11:14578021-14578043 CAATGAGAACACATGGGCACAGG + Intronic
1079260102 11:18870408-18870430 CAATGAGAACACATGGGCACAGG + Intergenic
1079482144 11:20892614-20892636 CTGTGAAGACACATGCGGCCGGG + Intronic
1079923184 11:26457022-26457044 CTATGAGAACACATGGACACAGG + Intronic
1080068808 11:28053699-28053721 CTCGGAGAACACATGGACACAGG - Intronic
1080096043 11:28408103-28408125 CTATGAGAACACATGGACACAGG + Intergenic
1080221042 11:29904761-29904783 CAATGAGGACACATGGACACAGG + Intergenic
1080378028 11:31737265-31737287 CTATGAGAACACATGGACACAGG + Intronic
1080507941 11:32936232-32936254 CAATGAGAACACATGGGCACAGG - Intronic
1081020243 11:37937276-37937298 CAATGAGAACACATGGACCCAGG - Intergenic
1081251804 11:40845349-40845371 CAATGAGGACATATGGGCACTGG - Intronic
1081261283 11:40964564-40964586 CAATGAGAACACATGGACCCAGG - Intronic
1081295773 11:41387253-41387275 CTCTGAGGACAAATGGAGGCAGG + Intronic
1081423161 11:42896400-42896422 CACTGAGAACACATGGACACAGG - Intergenic
1081683155 11:45022925-45022947 CTGTGAGGCTACAGGGGCCCAGG + Intergenic
1082170920 11:49004130-49004152 CTATGAGAACACATGGACACAGG + Intergenic
1082940152 11:58696477-58696499 CTATGAGAACACATGGACACAGG - Intronic
1083511758 11:63215379-63215401 CAATGAGGACACATGGACACAGG + Intronic
1083723488 11:64615575-64615597 GTCTGAGCATACATGGGCCTGGG + Intronic
1084459265 11:69287077-69287099 CTCTGTGGGAACCTGGGCCCGGG - Intergenic
1085248537 11:75125255-75125277 CAATGAGAACACATGGACCCAGG + Intronic
1085323151 11:75587146-75587168 CTCTGAAGACTCAAGGTCCCAGG - Exonic
1085467460 11:76734000-76734022 CACTGAGAACACATGGACACAGG - Intergenic
1086220952 11:84442475-84442497 CAATGAGAACACATGGACCCAGG + Intronic
1086505588 11:87500545-87500567 CAGTGAGAACACATGGGCACAGG + Intergenic
1086582232 11:88412304-88412326 CAATGAGAACACATGGGCACAGG - Intergenic
1087052601 11:93901466-93901488 CAATGAGGACACATGGACACAGG + Intergenic
1087462589 11:98463722-98463744 CAATGAGGACACATGGACACAGG + Intergenic
1087552350 11:99667742-99667764 CAATGAGAACACATGGGCACAGG + Intronic
1088151625 11:106752555-106752577 CAATGAGAACACATGGGCACAGG - Intronic
1088436980 11:109824910-109824932 CTATGTGAACACTTGGGCCCTGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088726436 11:112640725-112640747 CTCTGAGTTCACATGAGACCTGG + Intergenic
1088733612 11:112706873-112706895 CTCTGAGGACTCATTTGCCAGGG + Intergenic
1089491330 11:118885980-118886002 TTCTGAGGGGACATTGGCCCTGG - Intronic
1089616289 11:119696658-119696680 TTCTGAGGACACAGGGACCAGGG + Intronic
1090166650 11:124555884-124555906 CAATGAGAACACATGGGCACAGG - Intergenic
1090419126 11:126561962-126561984 GAATGAGGAGACATGGGCCCTGG + Intronic
1090422882 11:126587895-126587917 CTCTAAGGAGAGCTGGGCCCTGG + Intronic
1091695898 12:2627861-2627883 CTCCTAGGACACATGGGTCACGG - Intronic
1092493350 12:8967132-8967154 CTATGAGAACACATGGACACAGG + Intronic
1093229406 12:16525337-16525359 CAATGAGAACACATGGGCACAGG - Intronic
1093394509 12:18664954-18664976 CAATGAGGACACATGGACACAGG + Intergenic
1093579902 12:20774887-20774909 CAATGAGAACACATGGACCCAGG + Intergenic
1093879646 12:24389150-24389172 CAATGAGAACACATGGGCACAGG - Intergenic
1094244471 12:28273033-28273055 CAATGAGAACACATGGGCACAGG - Intronic
1094393775 12:29982142-29982164 CTATGAGAACACATGGACACAGG - Intergenic
1094435866 12:30420051-30420073 CAATGAGGACACATGGACACAGG + Intergenic
1094767445 12:33613236-33613258 CAATGAGGACACATGGGCACAGG + Intergenic
1094862375 12:34482242-34482264 CAATGAGAACACATGGACCCTGG + Intergenic
1095868365 12:46997748-46997770 CAATGAGGACACATGGACACAGG + Intergenic
1096150736 12:49310191-49310213 CAATGAGAACACATGGGCACAGG - Intergenic
1096467544 12:51855771-51855793 CTCTGAGGAGCCAGGAGCCCAGG + Intergenic
1097250970 12:57632196-57632218 CTCTGAGGACGCGGGGGCCAAGG - Intronic
1097312537 12:58136216-58136238 CACTGAGAACACATGGACACAGG - Intergenic
1097425692 12:59441302-59441324 CTTTGAGAACACATGGACACAGG - Intergenic
1097427977 12:59470885-59470907 CAATGAGAACACATGGGCACAGG - Intergenic
1097759378 12:63444092-63444114 CACTGAGAACACATGGACCCAGG - Intergenic
1097772419 12:63603565-63603587 CAGTGAGAACACATGGACCCAGG - Intronic
1098112166 12:67134276-67134298 CAATGAGGACACATGGACACAGG + Intergenic
1098677295 12:73305858-73305880 CAATGAGAACACATGGACCCAGG + Intergenic
1098928178 12:76376969-76376991 CAATGAGAACACATGGGCACAGG - Intronic
1098939412 12:76517842-76517864 CTCTGAGTTCACATGAGACCTGG - Intronic
1099011127 12:77292482-77292504 CAATGAGAACACATGGGCACAGG + Intergenic
1099462026 12:82934423-82934445 CTATGAGAACACATGGACGCAGG - Intronic
1099575025 12:84368131-84368153 CAATGAGGACACATGGACACAGG + Intergenic
1099685247 12:85877685-85877707 CAATGAGAACACATGGGCACAGG - Intronic
1100071654 12:90727604-90727626 CAATGAGGACACATGGACACAGG - Intergenic
1100076633 12:90792780-90792802 CAATGAGAACACATGGGCACAGG - Intergenic
1100663305 12:96723872-96723894 CACTGAGAACACATGGACACAGG - Intronic
1101206073 12:102488681-102488703 CAATGAGAACACATGGGCACAGG - Intergenic
1101333592 12:103777189-103777211 CACTGAGGACAAAAGGGTCCAGG + Exonic
1101557818 12:105827223-105827245 CTATGAGAACACATGGACACAGG + Intergenic
1101576918 12:106006370-106006392 GTCTGAGGACACAGGGGCTCTGG - Intergenic
1101973378 12:109333381-109333403 CTCTGAGGACTCATGGTGCATGG + Intergenic
1102028967 12:109729137-109729159 CCCTCAGGACACATCAGCCCAGG + Intronic
1102097588 12:110252723-110252745 CTCTGAGGACCCAAGGCGCCAGG + Intergenic
1102177125 12:110884277-110884299 TGCTGTGGACACAGGGGCCCAGG - Intronic
1102568225 12:113811156-113811178 CAATGAGGACACATGGACACAGG - Intergenic
1102854164 12:116278147-116278169 CTCTGAGGACACATTCCCCAGGG - Intergenic
1104089312 12:125501573-125501595 CAATGAGAACACATGGGCACAGG - Intronic
1104239008 12:126968840-126968862 CAATGAGAACACATGGGCACAGG - Intergenic
1104903416 12:132201341-132201363 CTGTGAGGGCACTTGGTCCCTGG - Intronic
1106592636 13:31110634-31110656 CTCTGAGGTCAAATGGACCAAGG + Intergenic
1107244914 13:38282107-38282129 CAATGAGAACACATGGGCACAGG + Intergenic
1107289292 13:38834212-38834234 CAATGAGAACACATGGGCACAGG - Intronic
1109531361 13:63652841-63652863 CAATGAGAACACATGGGCACAGG - Intergenic
1109683130 13:65779029-65779051 CAATGAGGACACATGGACACAGG - Intergenic
1109738382 13:66518215-66518237 CTCTGAGTTCACATGGGATCTGG - Intronic
1109804334 13:67418363-67418385 CAATGAGAACACATGGACCCAGG - Intergenic
1109871638 13:68341046-68341068 CAATGAGAACACATGGACCCAGG + Intergenic
1110346659 13:74456158-74456180 CACTGAGAACACATGGACACAGG + Intergenic
1110968339 13:81729488-81729510 CTATGAGAACACATGGACACAGG - Intergenic
1111297840 13:86306621-86306643 CTATGAGAACACATGGACACAGG - Intergenic
1111921948 13:94421568-94421590 CTCTGATGAGACATCAGCCCTGG + Intergenic
1112305694 13:98271605-98271627 CAATGAGAACACATGGACCCAGG - Intronic
1112762452 13:102706501-102706523 CAATGAGGACACATGGACACGGG - Intergenic
1112945797 13:104925377-104925399 CAATGAGAACACATGGGCACAGG + Intergenic
1112978214 13:105347568-105347590 CAATGAGGACACATGGACACAGG + Intergenic
1113012726 13:105788659-105788681 CAATGAGGACACATGGACACAGG - Intergenic
1113298972 13:108995633-108995655 CAATGAGAACACATGGGCACAGG - Intronic
1113769610 13:112899665-112899687 GTGTGAGGACACCTGGGGCCAGG - Intronic
1113780433 13:112973713-112973735 CTCTGAGGACACTGGGGGGCCGG + Intronic
1113786407 13:113004175-113004197 CCCCGAGGACACTTGTGCCCCGG - Intronic
1114077056 14:19166862-19166884 CTATGTGGACACACAGGCCCTGG + Intergenic
1114085101 14:19232702-19232724 CTATGTGGACACACAGGCCCTGG - Intergenic
1115433900 14:33351844-33351866 CTATGAGAACACATGGACCCAGG + Intronic
1115801932 14:37004446-37004468 GTTTGAGGACACCTGGGCCAAGG + Intronic
1115866573 14:37754281-37754303 CTATGAGAACACATGGACACAGG - Intronic
1115963087 14:38857794-38857816 CAATGAGAACACATGGGCACAGG + Intergenic
1116041719 14:39693971-39693993 CAATGAGAACACATGGGCACAGG + Intergenic
1116197794 14:41751958-41751980 CAATGAGAACACATGGGCACAGG - Intronic
1116241795 14:42352715-42352737 CAATGAGAACACATGGGCACAGG + Intergenic
1116304242 14:43230050-43230072 CAATGAGAACACATGGGCACAGG - Intergenic
1116360868 14:43996377-43996399 CAATGAGAACACATGGGCACAGG + Intergenic
1116471924 14:45295547-45295569 CTATGAGAACACATGGACACAGG + Intergenic
1116714705 14:48412561-48412583 CAATGAGAACACATGGACCCAGG - Intergenic
1116871247 14:50070857-50070879 CCCTGAGGACAGACGGGCGCGGG + Intergenic
1117492887 14:56269829-56269851 CTTTGTGGACACCTGGTCCCAGG - Intronic
1117631426 14:57696865-57696887 CAATGAGAACACATGGGCACAGG + Intronic
1117631682 14:57699755-57699777 CTTTAAGGACACATAGACCCAGG + Intronic
1117944940 14:61009575-61009597 CAATGAGAACACATGGGCACAGG - Intronic
1118725313 14:68624743-68624765 CTCTCAGGAAACAGGGCCCCAGG + Intronic
1118841395 14:69515733-69515755 CTCTGAGTACACATGAGATCTGG - Intronic
1119689705 14:76662017-76662039 ATCTGAGGACACTGGGGACCAGG + Intergenic
1119896539 14:78224469-78224491 CAATGAGAACACATGGGCACAGG - Intergenic
1119987040 14:79149803-79149825 CAATGAGAACACATGGGCACAGG + Intronic
1120021626 14:79537484-79537506 CAATGAGAACACATGGGCACAGG - Intronic
1120733847 14:88031894-88031916 CAATGAGAACACATGGGCACAGG + Intergenic
1121382339 14:93483733-93483755 CACTGAGAACACCTGGACCCAGG - Intronic
1121952206 14:98181262-98181284 GGCTGAGGACACAGGGGCCTGGG + Intergenic
1122243228 14:100382962-100382984 CTCTGAGGAAACAAGGGCAAGGG - Intronic
1122739758 14:103865431-103865453 CAATGAGAACACATGGACCCAGG + Intergenic
1122920555 14:104878204-104878226 GCCTGAGGTCACATGGGGCCTGG + Intronic
1123076470 14:105669770-105669792 CTCTGAGGGCACAGCGGCCCTGG - Intergenic
1123096941 14:105771331-105771353 CTCTGGGGGCACAGCGGCCCTGG - Intergenic
1202896677 14_GL000194v1_random:14410-14432 CTATGTGGACACACAGGCCCCGG - Intergenic
1202869523 14_GL000225v1_random:147754-147776 CTATGAGAACACATGGACACAGG + Intergenic
1123400977 15:19986187-19986209 CACTGAGAACATATGGGCACAGG + Intergenic
1123502978 15:20908187-20908209 CAATGAGAACACATGGACCCAGG + Intergenic
1123560224 15:21481852-21481874 CAATGAGAACACATGGACCCAGG + Intergenic
1123596465 15:21919153-21919175 CAATGAGAACACATGGACCCAGG + Intergenic
1123952315 15:25292769-25292791 CAATGAGAACACATGGACCCAGG + Intergenic
1124050025 15:26188466-26188488 CAATGAGGACACATGGACACAGG + Intergenic
1124589692 15:31041998-31042020 CTCGGAGGACTCGTGGGCCATGG + Exonic
1124620568 15:31271722-31271744 CTCTGGGGCCACATGGGCTGAGG + Intergenic
1125289097 15:38125957-38125979 CAATGAGAACACATGGACCCAGG + Intergenic
1125739403 15:41951746-41951768 CTCTCAGGACAGAGTGGCCCAGG - Intronic
1126057464 15:44744253-44744275 CACTGAGAACACATGGACACAGG + Intronic
1127058966 15:55162522-55162544 CAATGAGGACACATGGACTCAGG + Intergenic
1127071017 15:55289031-55289053 CCCTGAGGCCATGTGGGCCCAGG + Intronic
1127258106 15:57308066-57308088 CGCTGAGGACACATGGGAAGGGG - Intergenic
1127258119 15:57308125-57308147 CGCTGAGGACACATGGGAAGGGG - Intergenic
1127258132 15:57308184-57308206 CGCTGAGGACACATGGGAAGGGG - Intergenic
1127329867 15:57928134-57928156 CAGTGAGGACACATGGACACAGG - Intergenic
1127367493 15:58305304-58305326 CTCTGAAGACAAAGGGACCCAGG + Intronic
1127744575 15:61953433-61953455 CAATGAGGACACATGGACACAGG - Intronic
1127836790 15:62796845-62796867 CTGTGAGGACACATGGGTTGGGG - Intronic
1128532844 15:68466353-68466375 CCCTGAGGTCAAATGGGCCTGGG + Intergenic
1128851964 15:70968181-70968203 CAATGAGAACACATGGGCACAGG - Intronic
1129263349 15:74381148-74381170 CTCTCAGGACACATGGGAGGGGG - Intergenic
1129504123 15:76066862-76066884 CACTGTTGACACATGGGGCCAGG + Intronic
1130187994 15:81703353-81703375 CAATGAGAACACATGGACCCAGG + Intergenic
1130221313 15:82021907-82021929 CTCTGAGAACACCTGCGCCTGGG + Intergenic
1130431334 15:83850252-83850274 CTCTGAGGACACAGAGGAGCTGG - Intronic
1131034260 15:89210838-89210860 CTCTGAGGTCACTGGGGCCATGG - Intronic
1131124765 15:89849871-89849893 CAATGAGAACACATGGGCACAGG - Intronic
1131390126 15:92040998-92041020 GTCTGAGGTCAGATGGGTCCAGG - Intronic
1132073335 15:98798731-98798753 CTATTAGATCACATGGGCCCTGG + Intronic
1132120173 15:99169265-99169287 CTCAGAGCGCACAGGGGCCCAGG + Intronic
1132341713 15:101083027-101083049 GGCTGAGGACACAGGGGCCAGGG - Intergenic
1202949820 15_KI270727v1_random:23608-23630 CAATGAGAACACATGGACCCAGG + Intergenic
1202968573 15_KI270727v1_random:209016-209038 CAATGAGAACACATGGACCCAGG + Intergenic
1132563724 16:610871-610893 CTCTGACCACACAGGGCCCCAGG - Intronic
1132598171 16:762585-762607 GCCTGGGGCCACATGGGCCCAGG - Intronic
1132616463 16:843337-843359 CCCTGAGGACAAACGGGCGCCGG + Intergenic
1132973749 16:2701442-2701464 CTGTGAGGACACAGGGGCTCCGG + Intronic
1132983075 16:2749202-2749224 CTGGGAGCACACATGGGGCCTGG + Intergenic
1133743244 16:8667499-8667521 CTGTGAGAACACATGGACACAGG - Intergenic
1133828126 16:9297188-9297210 CAATGAGAACACATGGGCACAGG - Intergenic
1133999303 16:10770192-10770214 CTCTTGGGGCACAGGGGCCCGGG - Intronic
1134467562 16:14492810-14492832 CTCTGAGGCCACACAGGCCTGGG + Intronic
1135212431 16:20534967-20534989 CAATGAGGACACATGGACACAGG + Intergenic
1135297444 16:21294546-21294568 CAGTGAGAACACATGGGCACAGG - Intronic
1135798513 16:25470145-25470167 CAATGAGAACACATGGGCACAGG + Intergenic
1135951879 16:26922029-26922051 CTATGAGAACACATGGACACAGG + Intergenic
1136060660 16:27724136-27724158 CTCTGAGCACACAAGAGGCCAGG - Intronic
1136066366 16:27761564-27761586 CTCTGACGACTCCCGGGCCCTGG + Exonic
1136453096 16:30365371-30365393 CACTGGGGATAGATGGGCCCTGG - Intronic
1137460826 16:48661629-48661651 CAATGAGAACACATGGGCACAGG - Intergenic
1138673767 16:58636215-58636237 CAATGAGAACACATGGGCACAGG + Intergenic
1138915517 16:61459074-61459096 CAATGAGAACACATGGGCACAGG - Intergenic
1138994206 16:62428651-62428673 CAATGAGAACACATGGGCACAGG + Intergenic
1139327239 16:66161890-66161912 TTCTGGAGACACATGGGCCTGGG + Intergenic
1139434502 16:66928258-66928280 ATCTGAGGACACAAGGGTACAGG - Intergenic
1139527550 16:67526166-67526188 CTCAGAGGACACAGGTTCCCTGG + Intronic
1139729180 16:68928098-68928120 CTGTAAAGACACATGGGCACAGG + Intronic
1139832355 16:69810292-69810314 CTCTGAGGGGACATTCGCCCTGG + Intronic
1140632437 16:76870324-76870346 CACTGAGAACACATGGACACAGG + Intergenic
1140890488 16:79280662-79280684 CCCTGAGCCCACAGGGGCCCTGG - Intergenic
1141616679 16:85213855-85213877 CCCTGAGGACAGAGGGCCCCAGG + Intergenic
1142207993 16:88793061-88793083 CAGTGACGTCACATGGGCCCTGG + Intergenic
1142640145 17:1280796-1280818 CTGGGAGGACACATGGGCGCTGG - Intronic
1142937460 17:3347438-3347460 CTATGAGAACACATGGACACAGG - Intergenic
1143525345 17:7468688-7468710 CTCTGAAGACACGTGGCCCACGG - Intronic
1143825340 17:9601209-9601231 CAATGAGAACACATGGACCCGGG + Intronic
1143825439 17:9602318-9602340 CAATGAGGACACATGGACACAGG - Intronic
1144397338 17:14857379-14857401 CAATGAGAACACATGGGCACAGG - Intergenic
1144622649 17:16828260-16828282 CAATGAGAACACATGGGCACAGG + Intergenic
1144750471 17:17644810-17644832 CACTGAGGGCACGGGGGCCCTGG - Intergenic
1144883781 17:18444452-18444474 CAATGAGAACACATGGGCACAGG - Intergenic
1144954146 17:19010774-19010796 CTCTGAGGACACTGGGGTCCAGG - Intronic
1145148451 17:20499926-20499948 CAATGAGAACACATGGGCACAGG + Intergenic
1145211233 17:21014849-21014871 CTCTGAGAACCCATGCGCTCAGG - Intronic
1145238448 17:21225406-21225428 CAATGAGGACACATGGACACAGG + Intergenic
1145981756 17:29016820-29016842 CTCTGTGCACACAGGTGCCCAGG + Intronic
1146874694 17:36399201-36399223 CAATGAGAACACATGGGCACAGG - Intronic
1146971111 17:37073193-37073215 CAATGAGAACACATGGACCCAGG + Intergenic
1147064689 17:37913680-37913702 CAATGAGAACACATGGGCACAGG + Intergenic
1147576982 17:41608197-41608219 CAATGAGAACACATGGGCACAGG + Intergenic
1147923213 17:43931378-43931400 TTCTGAGGCCACCTGGGGCCTGG + Intergenic
1148340494 17:46870626-46870648 TTCTGAGGGCACCTGGGGCCTGG + Intronic
1149174450 17:53853145-53853167 CACTGAGGAAACATGGGCCAGGG - Intergenic
1149376565 17:56049585-56049607 CTATGAGAACACATGGACACAGG - Intergenic
1149405418 17:56345087-56345109 CAATGAGAACACATGGGCACAGG - Intronic
1150060751 17:62065986-62066008 CCTTGAGGTCACGTGGGCCCGGG + Intergenic
1151073740 17:71247349-71247371 CAGTGAGAACACATGGGCACAGG - Intergenic
1151256112 17:72878013-72878035 CAATGAGAACACATGGACCCAGG - Intronic
1153010266 18:532282-532304 CTCTGAGGAAACAGGAGCCCAGG - Intergenic
1153209152 18:2740127-2740149 CAATGAGAACACATGGACCCAGG - Intronic
1155549277 18:26948194-26948216 CAATGAGAACACATGGGCACAGG + Intronic
1155759915 18:29552544-29552566 CTATGAGAACACATGGACACAGG - Intergenic
1156473792 18:37393468-37393490 CCCTTTGGACACTTGGGCCCAGG + Intronic
1156482955 18:37447650-37447672 CTGTGATGCCACATGGGCCCTGG + Intronic
1156545274 18:37957759-37957781 GTCAGAGTACACAGGGGCCCAGG + Intergenic
1156569148 18:38233078-38233100 CTATGAGAACACATGGACACAGG + Intergenic
1156626388 18:38914910-38914932 CAATGAGAACACATGGGCACAGG - Intergenic
1156728284 18:40157461-40157483 CAATGAGAACACATGGACCCAGG - Intergenic
1156978809 18:43260763-43260785 CAATGAGGACACATGGACACAGG - Intergenic
1157072953 18:44431074-44431096 CAATGAGAACACATGGACCCTGG - Intergenic
1158053773 18:53255409-53255431 CAATGAGGACACATGGACACAGG - Intronic
1158099168 18:53810134-53810156 CAATGAGAACACATGGACCCAGG + Intergenic
1158174031 18:54633854-54633876 CAATGAGAACACATGGACCCAGG + Intergenic
1158180245 18:54707275-54707297 CAATGAGGACACATGGACACAGG - Intergenic
1159175020 18:64821265-64821287 CAATGAGAACACATGGACCCAGG - Intergenic
1159321727 18:66859960-66859982 CAATGAGAACACATGGGCACAGG + Intergenic
1159922389 18:74237720-74237742 CTCTGAGGTTGCCTGGGCCCTGG + Intergenic
1160731669 19:644097-644119 CTGTGAGGACACTGGGGCCCTGG - Intergenic
1161572024 19:5036013-5036035 CTGTGGGGACAGATGGGCTCAGG + Intronic
1161617755 19:5281654-5281676 GGCTGAGGACGCATGGCCCCGGG - Intronic
1161861615 19:6802137-6802159 CAATGAGAACACATGGGCACAGG + Intronic
1162020671 19:7867054-7867076 GTCTGAGGAGAAATGGGCTCTGG - Intergenic
1162541698 19:11300411-11300433 CTCTGAGCCCACATGCCCCCTGG - Intronic
1163404275 19:17112738-17112760 CTCTGAGGCCTGATGAGCCCTGG - Intronic
1163411907 19:17160224-17160246 TTCTGAGCCCACATGGGTCCAGG + Intronic
1163446268 19:17348243-17348265 CTCTCCAGACACATGGGCACAGG - Intergenic
1163730509 19:18946687-18946709 CTCTAGGGAAACATGGGCCCTGG - Intergenic
1163894026 19:20041422-20041444 CACTGAGCACACATGGAACCAGG - Intergenic
1163963357 19:20718833-20718855 CTATGAGAACACATGGACACAGG - Intronic
1163980310 19:20893150-20893172 CTATGAGAACACATGGACACAGG - Intergenic
1164735176 19:30536003-30536025 GCCTGAGGACAGATGGGCACAGG + Intronic
1164933400 19:32192565-32192587 CAATGAGAACACATGGACCCAGG - Intergenic
1165126865 19:33604197-33604219 CTATGAGAACACATGGACACAGG - Intergenic
1166046974 19:40235540-40235562 CAGTGAGGACACGTGGGTCCGGG - Intronic
1166308404 19:41948529-41948551 CTATGAGGTCACATGTTCCCTGG + Intergenic
1166347864 19:42177387-42177409 CTCTGAGCATCCTTGGGCCCGGG - Intronic
1166468537 19:43056677-43056699 CAATGAGAACACATGGGCACAGG - Intronic
1166474157 19:43106557-43106579 CACTGAGAACACATGGACACAGG + Intronic
1166733392 19:45071002-45071024 CTCTGCTGGCCCATGGGCCCTGG - Intergenic
1166795150 19:45421336-45421358 CACTGTGGACACCTCGGCCCAGG - Exonic
1166910680 19:46154031-46154053 CTGTGAGAACACATGGACACAGG - Intronic
1167175538 19:47861312-47861334 CTCTGAGGCCACAAGGCGCCTGG - Intergenic
1167726213 19:51214903-51214925 CTGTGAGATCACATGAGCCCAGG - Intergenic
1168359763 19:55729429-55729451 CAATGAGAACACATGGGCACAGG - Intronic
1168362840 19:55757170-55757192 CAATGAGAACACATGGGCACAGG + Intergenic
1168363797 19:55767168-55767190 CAATGAGAACACATGGGCACAGG + Intergenic
925467061 2:4115497-4115519 CAATGAGAACACATGGGCACAGG - Intergenic
925914730 2:8596491-8596513 CTCTGGTCACACATTGGCCCAGG - Intergenic
926403849 2:12527935-12527957 CACTGAGAACACATGGACACAGG + Intergenic
926440023 2:12878578-12878600 CAATGAGAACACATGGACCCAGG - Intergenic
926523457 2:13946689-13946711 CGATGAGAACACATGGGCACAGG - Intergenic
926651129 2:15346948-15346970 CTATGAGAACACATGGACCCAGG + Intronic
926752703 2:16210927-16210949 AGCTGAGGAGACATGGGGCCTGG - Intergenic
927044147 2:19260300-19260322 CAATGAGGACACATGGACACAGG + Intergenic
927297741 2:21474567-21474589 CAGTGAGAACACATGGGCACAGG - Intergenic
927298944 2:21488075-21488097 CAATGAGAACACATGGGCACAGG - Intergenic
927567913 2:24130006-24130028 CAATGAGAACACATGGACCCAGG - Intronic
927634255 2:24800520-24800542 CACTGAGAACACATGGACACAGG - Intronic
928472920 2:31591884-31591906 CAATGAGAACACATGGGCACAGG + Intergenic
929255583 2:39807891-39807913 CAATGAGAACACATGGGCACAGG - Intergenic
929488553 2:42376285-42376307 CTCTGAGGCCAAATGAGCCAGGG - Intronic
929617569 2:43324033-43324055 CTGTGAGGCCACATGGGAGCAGG - Intronic
929637774 2:43543068-43543090 CAATGAGAACACATGGGCACAGG - Intronic
929877222 2:45806848-45806870 CTCTGAGATCCCATGGGCCTGGG + Intronic
930573030 2:53110827-53110849 TTCAGAGGACACAATGGCCCTGG + Intergenic
930606945 2:53502555-53502577 CAATGAGGACACATGGACACAGG - Intergenic
930796225 2:55394605-55394627 CTTTGAGAACACATGGACACAGG + Intronic
931091418 2:58890619-58890641 CTATGAGAACACATGGACACAGG - Intergenic
931480963 2:62639509-62639531 CAATGAGAACACATGGGCACAGG + Intergenic
931930913 2:67132273-67132295 CAATGAGAACACATGGACCCAGG - Intergenic
932207124 2:69893152-69893174 CAATGAGAACACATGGGCACAGG + Intergenic
932462825 2:71894358-71894380 TTCTGAGGCCACCTGGGGCCAGG - Intergenic
933556734 2:83839379-83839401 CTATGAGAACACATGGACACAGG - Intergenic
933781392 2:85804393-85804415 CTCTGAGGAAACTGAGGCCCAGG + Intergenic
933985529 2:87589024-87589046 CACTGAGAACACATGGAACCAGG + Intergenic
934016925 2:87897669-87897691 CAATGAGAACACATGGGCACAGG - Intergenic
934188012 2:89763470-89763492 CTCTGAGTCCCCTTGGGCCCCGG - Intergenic
934617601 2:95784404-95784426 CAATGAGAACACATGGACCCAGG + Intergenic
934643292 2:96040155-96040177 CAATGAGAACACATGGACCCAGG - Intergenic
934750124 2:96788751-96788773 CTCTGAGATCCCAGGGGCCCAGG - Intronic
935339624 2:102048289-102048311 CAATGAGAACACATGGGCTCAGG + Intergenic
935429255 2:102957197-102957219 CTCTTAGGACATATGGTTCCTGG - Intergenic
935917144 2:107967373-107967395 CAATGAGGACACATGGACACAGG - Intergenic
935962089 2:108435915-108435937 CACTGAGAACACATGGACACAGG + Intergenic
936062095 2:109301596-109301618 CTCTGAGCCCACAGAGGCCCTGG - Intronic
936155169 2:110042444-110042466 CAGTGATGGCACATGGGCCCGGG - Intergenic
936189513 2:110328970-110328992 CAGTGATGGCACATGGGCCCGGG + Intergenic
936368897 2:111886023-111886045 CAATGAGAACACATGGACCCAGG + Intergenic
936644744 2:114355944-114355966 CAATGAGGACACATGGACGCAGG - Intergenic
936667516 2:114613915-114613937 CAATGAGAACACATGGACCCAGG + Intronic
936769005 2:115889233-115889255 CTATGAGAACACATGGACACAGG - Intergenic
937587570 2:123571777-123571799 CTATGAGAACACATGGACACAGG - Intergenic
937978270 2:127594415-127594437 CTCTGAGGACACATAAGGGCAGG - Intronic
938230528 2:129654976-129654998 CTCTGTGGACGCATGGGGACAGG - Intergenic
938230539 2:129655035-129655057 CTCTGTGGACGCATGGGGACAGG - Intergenic
938894233 2:135734818-135734840 CACTGAGGACACAAAGGCCTGGG - Intergenic
939298641 2:140303853-140303875 CAATGAGGACACTTGGGCACAGG - Intronic
939470902 2:142618121-142618143 CAATGAGGACACATGGACACAGG + Intergenic
939870007 2:147516234-147516256 CAATGAGAACACATGGGCACAGG - Intergenic
939876986 2:147588610-147588632 CTCTGGGGACACATCTCCCCTGG + Intergenic
940082657 2:149822060-149822082 CACTGAGAACACATGGACACAGG + Intergenic
940125406 2:150317404-150317426 CACTGAGAACACATGGACACAGG + Intergenic
940401345 2:153251664-153251686 CAATGAGAACACATGGACCCAGG - Intergenic
940475999 2:154163176-154163198 CAATGAGAACACATGGACCCAGG - Intronic
940603186 2:155886451-155886473 CAATGAGAACACATGGGCACGGG + Intergenic
941076933 2:161016235-161016257 CTATGAGAACACATGGGCACAGG + Intergenic
941205941 2:162572844-162572866 CACTGAGAACACATGGACACCGG + Intronic
941607951 2:167623549-167623571 CAATGAGAACACATGGGCACAGG + Intergenic
941659598 2:168182302-168182324 GTCTGAGGACACAGGGGACAAGG + Intronic
942052431 2:172152699-172152721 CAATGAGAACACATGGGCACAGG + Intergenic
942203957 2:173600714-173600736 CAATGAGGACACATGGACACAGG - Intergenic
942918955 2:181347605-181347627 CTATGAGAACACATGGACACAGG + Intergenic
943093573 2:183402503-183402525 CAATGAGAACACATGGGCACAGG - Intergenic
943163299 2:184283018-184283040 CAATGAGAACACATGGGCACAGG + Intergenic
943255855 2:185591984-185592006 CAATGAGGACACTTGGGCACAGG - Intergenic
943305271 2:186253632-186253654 CAATGAGGACACATGGACACAGG + Intergenic
944077612 2:195749779-195749801 CAATGAGGACACATGGACACAGG + Intronic
945349266 2:208758293-208758315 CAATGAGAACACATGGGCACAGG - Intronic
946064729 2:216976609-216976631 CAATGAGAACACATGGGCACAGG - Intergenic
946135659 2:217644775-217644797 GGGTGAGGAAACATGGGCCCAGG - Intronic
947043752 2:225953487-225953509 CAATGAGAACACATGGACCCAGG + Intergenic
947244988 2:228036830-228036852 CCATGAGAACACATGGGCACAGG + Intronic
947381357 2:229548539-229548561 CAATGAGGACACATGGACACAGG + Intronic
948239504 2:236417772-236417794 CAATGAGAACACATGGGCACAGG - Intronic
948391446 2:237614279-237614301 GTCTGACAACACATGGGCCCAGG - Intergenic
948846995 2:240687936-240687958 CTGTGAGGACACAGGGAGCCTGG + Intergenic
1169085042 20:2821185-2821207 CTGCGAGGACACCCGGGCCCAGG + Intergenic
1169289725 20:4338717-4338739 CAATGAGAACACATGGACCCAGG - Intergenic
1169428433 20:5513991-5514013 CTCTGAGGAGAGGTGAGCCCTGG + Intergenic
1170145052 20:13164098-13164120 TTCTGAGAACACATGGACACAGG - Intronic
1170771053 20:19332786-19332808 CTCTGAGGACACAGAGGCTGTGG + Intronic
1170979043 20:21193802-21193824 CAATGAGAACACATGGACCCAGG + Intronic
1171775104 20:29358678-29358700 CAATGAGGACACATGGACACAGG + Intergenic
1171817120 20:29796292-29796314 CAATGAGGACACATGGACACAGG + Intergenic
1171901234 20:30859704-30859726 CAATGAGGACACATGGACACAGG - Intergenic
1171943273 20:31351543-31351565 TGGTGAGGACACATGGGCCATGG - Intergenic
1172316910 20:33962738-33962760 CTCTGTGGACATATAGGCCATGG - Intergenic
1172615100 20:36278097-36278119 CTCTGAGGGCACCTGGGGCTTGG + Intergenic
1172636806 20:36415611-36415633 CTTTGAGGACACTGGGGCTCAGG + Intronic
1173143108 20:40502146-40502168 CAATGAGAACACATGGGCACAGG + Intergenic
1173340837 20:42151345-42151367 CAATGAGGACACATGGACACGGG - Intronic
1174188323 20:48722641-48722663 CTCTGAGGAGAGATGGGCCCTGG - Intronic
1174414806 20:50359698-50359720 CTCTGTGGCCACAGGGCCCCTGG - Intergenic
1174452910 20:50630799-50630821 CCCTGGGGACACAGGGGCCGTGG - Exonic
1175026775 20:55910840-55910862 CAATGAGGACACATGGACACAGG + Intergenic
1175042212 20:56064261-56064283 CAATGAGGACACATGGACACAGG + Intergenic
1175555940 20:59856863-59856885 CAATGAGAACACATGGGCACAGG + Intergenic
1175591490 20:60195630-60195652 CAATGAGAACACATGGGCCCAGG - Intergenic
1175768238 20:61606042-61606064 CTCTGAGGACACATGGGCCCAGG + Intronic
1176032176 20:63017880-63017902 CTCTGAGGGCCCCTGAGCCCAGG + Intergenic
1176616365 21:9030406-9030428 CTATGTGGACACACAGGCCCCGG - Intergenic
1176708763 21:10133223-10133245 CTATGTGGACACACAGGCCCCGG + Intergenic
1177304684 21:19298086-19298108 CAATGAGAACACATGGACCCAGG + Intergenic
1177541526 21:22499421-22499443 CGATGAGAACACATGGGCACAGG + Intergenic
1177667636 21:24181473-24181495 CTATGAGAACACATGGACACAGG - Intergenic
1177842423 21:26249320-26249342 CAATGAGAACACATGGGCACAGG - Intergenic
1177867550 21:26530656-26530678 CAATGAGAACACATGGGCACAGG - Intronic
1178034038 21:28560910-28560932 CAATGAGGACACATGGACACAGG + Intergenic
1178687581 21:34723516-34723538 CTATGAGGACAGGTGGGCCCAGG - Intergenic
1179045068 21:37836686-37836708 CAATGAGAACACATGGGCACAGG + Intronic
1179057619 21:37950714-37950736 CAATGAGAACACATGGGCACAGG - Intergenic
1179090521 21:38261110-38261132 CTCTGAGGACCCAGGTGCCTGGG + Intronic
1179145398 21:38763614-38763636 CAATGAGAACACATGGGCACAGG - Intergenic
1179408228 21:41142692-41142714 CTCTGTGGCCACCTGGGCTCTGG - Intergenic
1179416138 21:41199986-41200008 CAATGAGAACACATGGGCACAGG + Intronic
1179729425 21:43359323-43359345 CTCTGAGGACACGGGGCCTCGGG - Intergenic
1179875981 21:44267722-44267744 GTCTGGGGACCCATGGGCCCTGG - Intergenic
1180160682 21:45997571-45997593 CTCTGAGGACTCTATGGCCCTGG + Intronic
1180196372 21:46196939-46196961 CTCTGAGCACACAGGGTCCTCGG - Intronic
1180261036 21:46668959-46668981 CGATGAGAACACATGGGCACAGG - Intergenic
1180292869 22:10860491-10860513 CTATGTGGACACACAGGCCCTGG + Intergenic
1180320452 22:11315060-11315082 CAATGAGGACACATGGACACAGG + Intergenic
1180334599 22:11565657-11565679 CAATGAGGACACATGGACACAGG - Intergenic
1180416128 22:12716034-12716056 CAATGAGAACACATGGGCACAGG - Intergenic
1180495676 22:15889913-15889935 CTATGTGGACACACAGGCCCTGG + Intergenic
1181984266 22:26788456-26788478 CAATGAGAACACATGGGCACAGG - Intergenic
1182361044 22:29746692-29746714 CACTGAGAACACAGGAGCCCTGG + Intronic
1182424499 22:30264972-30264994 CTCAGATGCCACAAGGGCCCAGG + Intronic
1182621707 22:31621992-31622014 CACGGAGGACACCAGGGCCCAGG + Intronic
1182921200 22:34081068-34081090 CAATGAGAACACATGGGCACAGG - Intergenic
1183534140 22:38386045-38386067 CAATGAGAACACATGGACCCAGG + Intronic
1183978370 22:41526075-41526097 CCCTAAGGCCACATGGGCTCAGG - Exonic
1184485350 22:44775266-44775288 CTCTGCTGACCCATAGGCCCAGG - Intronic
1184768932 22:46586849-46586871 CTCTGAGGGCACTTGGGACCTGG + Intronic
1185035649 22:48475277-48475299 CTCTGATCACACATGTGCCCAGG + Intergenic
949119009 3:362941-362963 CTCTGAGGACACATGCAAACCGG + Intronic
949142752 3:654704-654726 CTATGAGAACACATGGACACAGG + Intergenic
949183798 3:1166831-1166853 CTATGAGAACACATGGACACGGG + Intronic
949795986 3:7851466-7851488 CAATGAGAACACATGGGCACAGG - Intergenic
950058964 3:10053325-10053347 CAGTGAGAACACATGGGCACAGG + Intronic
950496135 3:13335648-13335670 TTTTGAGGACACAGGGGCCTGGG - Intronic
950619136 3:14188996-14189018 CAATGAGAACACATGGGCACAGG - Intronic
950841214 3:15970013-15970035 CTCTGAGAGCACATAGGCCCAGG - Intergenic
950904223 3:16523034-16523056 CTGTGAGGTCACATGAGACCTGG - Intergenic
951396694 3:22177777-22177799 CAGTGAGAACACATGGGCACAGG - Intronic
951433724 3:22637794-22637816 CAATGAGAACACATGGGCACAGG - Intergenic
951493224 3:23296502-23296524 CAATGAGAACACATGGGCACAGG - Intronic
951555531 3:23917242-23917264 CTCCGAGGACGCAGGGTCCCCGG - Intronic
951592863 3:24285379-24285401 CTATGAGAACACATGGACACAGG + Intronic
951687073 3:25356708-25356730 CAATGAGAACATATGGGCCCAGG - Intronic
951750348 3:26028107-26028129 CTCTGAGGACAGAAGGGACTAGG - Intergenic
951917382 3:27816170-27816192 CAATGAGGACACATGGACACAGG - Intergenic
952098099 3:29979630-29979652 CAATGAGAACACATGAGCCCAGG - Intronic
952238517 3:31505849-31505871 CACTGAGGCCACAGGGGACCTGG + Intergenic
952717943 3:36500392-36500414 CAATGAGAACACATGGACCCAGG + Intronic
953178669 3:40576223-40576245 CTCTGATGAGACCTGAGCCCTGG + Intergenic
953304359 3:41813101-41813123 CAATGAGAACACATGGACCCAGG + Intronic
953308197 3:41850005-41850027 CAATGAGGACACTTGGGCACAGG - Intronic
953440455 3:42911602-42911624 CTCAGAGGATACATAGTCCCTGG + Intronic
953500168 3:43425510-43425532 CTCTGAGGTCCCTTTGGCCCAGG - Intronic
953880003 3:46686620-46686642 GAATGAGGACACGTGGGCCCAGG - Intronic
953895458 3:46795858-46795880 CAATGAGGACATATGGGCACAGG + Intronic
954424664 3:50437080-50437102 CTCTGGGGCCAGCTGGGCCCAGG + Intronic
954474606 3:50732203-50732225 CACTGAGAACACATGGACTCAGG + Intronic
956006393 3:64783074-64783096 CAATGAGAACACATGGGCACAGG + Intergenic
956014568 3:64867971-64867993 CCCTGAAGACACATGGGACTTGG + Intergenic
956071780 3:65460742-65460764 CAATGAGGACATATGGGCACAGG - Intronic
956156787 3:66306700-66306722 CAATGAGAACACATGGACCCAGG - Intronic
957489960 3:80910921-80910943 CAATGAGAACACATGGGCACAGG + Intergenic
957700211 3:83700434-83700456 CAATGAGAACACATGGGCACAGG - Intergenic
957745307 3:84333313-84333335 CAATGAGAACACATGGACCCAGG - Intergenic
958066954 3:88555912-88555934 CAATGAGAACACATGGACCCAGG - Intergenic
958067407 3:88561092-88561114 CAATGAGAACACATGGACCCAGG + Intergenic
958414684 3:93859675-93859697 CTCTGAGAACACAGGGGCACTGG - Intergenic
959184491 3:103028849-103028871 CTATGAGAACACATGGACACAGG + Intergenic
959387328 3:105726746-105726768 CATTGAGAACACATGGACCCAGG - Intronic
959428133 3:106218601-106218623 CAATGAGAACACATGGGCACAGG - Intergenic
959843408 3:111004536-111004558 CAATGAGAACACATGGACCCTGG + Intergenic
960230088 3:115215896-115215918 CAATGAGAACACATGGACCCAGG - Intergenic
960392866 3:117100505-117100527 CAATGAGAACACATGGACCCAGG - Intronic
960538853 3:118843073-118843095 CTCTGAGGACATTAGGACCCAGG - Intergenic
960771531 3:121197698-121197720 CAATGAGAACACATGGACCCAGG - Intronic
961138411 3:124534320-124534342 CAATGAGAACACATGGGCACAGG + Intronic
961200848 3:125043954-125043976 CTGTGTGGACACCGGGGCCCGGG - Intronic
961828655 3:129612067-129612089 CTCAGGGGACTCATGGGCCGGGG + Intergenic
962466890 3:135668827-135668849 CAATGAGAACACATGGACCCAGG - Intergenic
962658811 3:137579597-137579619 CTATGAGAACACATGGACACAGG - Intergenic
962710999 3:138086054-138086076 CAATGAGAACACATGGACCCAGG + Intronic
963211609 3:142699048-142699070 CAATGAGGACACATGGACACAGG + Intronic
963221482 3:142817549-142817571 CTCTTAGGAGACATGTGCTCTGG + Intronic
964228391 3:154433775-154433797 CACTGAGAACACATGGACACAGG - Intergenic
964379275 3:156081491-156081513 CAATGAGAACACATGGGCACAGG + Intronic
964648543 3:158985790-158985812 CAATGAGAACACATGGGCACAGG - Intronic
964709169 3:159653534-159653556 CAATGAGAACACATGGACCCAGG + Intronic
964712678 3:159687794-159687816 CAATGAGGACATATGGGCACAGG - Intronic
965150671 3:164970645-164970667 CAATGAGAACACATGGGCACAGG - Intergenic
965332172 3:167389172-167389194 CAGTGAGAACACATGGGCACAGG - Intergenic
966049224 3:175593204-175593226 CAATGAGAACACATGGGCACAGG - Intronic
966231731 3:177659555-177659577 CAATGAGGACACATGGACACAGG - Intergenic
966573975 3:181478376-181478398 CAATGAGAACACATGGACCCAGG - Intergenic
967116259 3:186341963-186341985 CAATGAGGACACATGGACACAGG + Intronic
967960196 3:194914302-194914324 CAATGAGAACACATGGGCACAGG + Intergenic
968787110 4:2630878-2630900 ATCAGAGCACCCATGGGCCCTGG + Intronic
968860111 4:3161115-3161137 CAATGAGAACACATGGGCACAGG - Intronic
969670634 4:8588215-8588237 CTCTCTGGACACCTGGGCCCTGG - Intronic
969905266 4:10387830-10387852 CAATGAGAACACATGGGCACAGG + Intergenic
971042464 4:22769073-22769095 CATTGAGAACACATGGGCACAGG - Intergenic
971679536 4:29678839-29678861 CACTGAGAACACATGGACACAGG + Intergenic
971904622 4:32710634-32710656 CAATGAGAACACATGGGCACAGG + Intergenic
971966072 4:33557685-33557707 CAATGAGAACACATGGACCCAGG - Intergenic
972091310 4:35288142-35288164 CAATGAGGACACATGGACACAGG - Intergenic
972319919 4:37964182-37964204 CTCTGCACACACATGGGCCAGGG + Intronic
972698976 4:41475660-41475682 CAGTGAGGACACATGGACACAGG + Intronic
973007502 4:45030840-45030862 CAATGAGAACACATGGGCACAGG + Intergenic
973016809 4:45150223-45150245 CTATGAGAACACATGGACACAGG + Intergenic
973118888 4:46492965-46492987 TTCTGAGGACAGACTGGCCCAGG - Intergenic
973870823 4:55164469-55164491 CAATGAGAACACATGGACCCTGG - Intergenic
974130987 4:57755636-57755658 CAATGAGAACACATGGGCACAGG + Intergenic
974271991 4:59661841-59661863 CAATGAGAACACATGGGCACAGG + Intergenic
974481394 4:62448314-62448336 CAATGAGAACACATGGACCCAGG + Intergenic
974498590 4:62666561-62666583 CAATGAGAACACATGGGCACAGG - Intergenic
974968521 4:68795826-68795848 CAATGAGGACACATGGACACAGG + Intergenic
975001850 4:69234231-69234253 CAATGAGGACACATGGACACAGG - Intergenic
975003592 4:69257860-69257882 CAATGAGGACACATGGACACAGG + Intergenic
975011952 4:69366474-69366496 CAATGAGGACACATGGACACAGG + Intronic
975057760 4:69956950-69956972 CTATGAGAACACATGGACACAGG + Intronic
975148847 4:70999214-70999236 CAATGAGAACACATGGGCACAGG - Intronic
975578970 4:75890088-75890110 CACTGAGGACAGATTCGCCCAGG - Exonic
975842803 4:78493602-78493624 CAATGAGAACACATGGACCCAGG + Intronic
976058790 4:81101513-81101535 CAATGAGAACACATGGACCCAGG + Intronic
976093903 4:81487306-81487328 CAATGAGAACACATGGACCCAGG - Intronic
976330277 4:83823592-83823614 CAATGAGAACACATGGACCCAGG - Intergenic
976533789 4:86187945-86187967 CAATGAGAACACATGGGCACAGG - Intronic
976890058 4:90035670-90035692 CCATGAGAACACATGGGCACAGG + Intergenic
976933028 4:90591981-90592003 CAATGAGAACACATGGGCACAGG + Intronic
977538720 4:98288225-98288247 CACTGAGAACACATGGACACAGG - Intronic
977677191 4:99760877-99760899 CAATGAGGACACATGGACACAGG - Intergenic
978011398 4:103689197-103689219 CAATGAGAACACATGGGCACAGG + Intronic
978036793 4:104004851-104004873 CAATGAGGACACATGGACACAGG + Intergenic
978210428 4:106129336-106129358 CAATGAGAACACATGGGCACAGG - Intronic
979900087 4:126204972-126204994 CAATGAGAACACATGGGCACAGG - Intergenic
979994147 4:127410380-127410402 CTCTGAGATCACTTGGCCCCAGG + Intergenic
980275293 4:130642933-130642955 CTATGAGAACACATGGACACAGG - Intergenic
980308308 4:131093937-131093959 CTATGAGAACACATGGACACAGG - Intergenic
980317113 4:131216605-131216627 CAATGAGAACACATGGGCACAGG - Intergenic
980424936 4:132616941-132616963 CAATGAGAACACATGGGCACAGG + Intergenic
980834824 4:138178176-138178198 CAATGAGGACACATGGACACAGG - Intronic
980860544 4:138494678-138494700 ACCTGAGGACACAAGGGCCAGGG + Intergenic
981963084 4:150565290-150565312 CTATGAGAACACATGGACACAGG + Intronic
983019401 4:162656409-162656431 CAGTGAGAACACATGGGCACAGG + Intergenic
983424614 4:167567525-167567547 CACTGAGAACACATGGACACAGG + Intergenic
983478481 4:168244051-168244073 CTATGAGAACACATGGACCCAGG + Intronic
983753911 4:171310181-171310203 CAATGAGAACACATGGGCACAGG - Intergenic
983965458 4:173804139-173804161 CAATGAGAACACATGGACCCAGG - Intergenic
984283694 4:177703217-177703239 CAATGAGGACACATGGACTCAGG + Intergenic
984686847 4:182679008-182679030 CAGTGAGGACACATGGACACAGG + Intronic
985419160 4:189765857-189765879 ATCTGAGGCCACATCAGCCCTGG - Intergenic
985532769 5:443521-443543 CTGTGGGGACACATGTGCCAAGG - Intronic
985534241 5:454404-454426 AGGTGAGGACACATGGTCCCAGG + Intronic
985853919 5:2410525-2410547 CGCTGAGCACACGTGTGCCCTGG + Intergenic
986007566 5:3680908-3680930 ATCTGAGGACACATGGTGCTGGG + Intergenic
986152895 5:5143927-5143949 CACTGAGAACATATGGGCACAGG + Intronic
986343992 5:6817444-6817466 CTCTGATGACACATCGGGACAGG + Intergenic
986437006 5:7744168-7744190 CAATGAGGACACATGGACACAGG + Intronic
986567043 5:9125539-9125561 CAATGAGAACACATGGGCACAGG - Intronic
986950263 5:13074334-13074356 CAATGAGAACACATGGGCACAGG - Intergenic
986955107 5:13140815-13140837 CAATGAGAACACATGGGCACAGG - Intergenic
987333917 5:16881739-16881761 CTATTAGAACACATGTGCCCAGG + Intronic
987503855 5:18745615-18745637 CTCTGAGGACATTAGGACCCAGG + Intergenic
987625295 5:20390931-20390953 CAATGAGAACACATGGACCCAGG + Intronic
987703469 5:21431672-21431694 CAATGAGAACACATGGGCACAGG + Intergenic
987852394 5:23373252-23373274 CTATGAGAACACATGGGCACAGG - Intergenic
987922763 5:24305459-24305481 CAATGAGAACATATGGGCCCAGG - Intergenic
987988025 5:25175308-25175330 CAATGAGGACACATGGACACAGG - Intergenic
988035795 5:25825371-25825393 CACTGAGAACACATGGACACAGG - Intergenic
988389583 5:30610367-30610389 CAATGAGAACACATGGGCACAGG + Intergenic
988420938 5:31005445-31005467 CAATGAGAACACATGGGCACAGG - Intergenic
989397232 5:40970802-40970824 CAATGAGAACACATGGGCACAGG - Intronic
989837276 5:46008513-46008535 CAATGAGAACACATGGGCACAGG + Intergenic
989978607 5:50614444-50614466 CAATGAGAACACATGGGCACAGG - Intergenic
989990164 5:50754377-50754399 CAATGAGAACACATGGGCACAGG - Intronic
990187585 5:53224399-53224421 CACTGAGAACACATGGACACAGG - Intergenic
990654708 5:57942199-57942221 CAATGAGAACACATGGGCACAGG - Intergenic
990691734 5:58371773-58371795 CTATGAGAACACATGGACACAGG - Intergenic
992023697 5:72650334-72650356 CAATGAGGACACATGGACACAGG - Intergenic
992514136 5:77474232-77474254 CAATGAGAACACATGGACCCAGG + Intronic
992855479 5:80856498-80856520 CAATGAGAACACATGGGCACAGG + Intronic
993064407 5:83079951-83079973 CACTGAGGACACCTGTGCACTGG - Intronic
993271101 5:85797117-85797139 CTATGAGAACACATGGACACAGG + Intergenic
993554321 5:89316611-89316633 CACTGAGAACACATGGACACAGG - Intergenic
994437544 5:99758086-99758108 CAATGAGAACATATGGGCCCAGG - Intergenic
994536719 5:101040302-101040324 CAATGAGAACACATGGGCACAGG + Intergenic
994887800 5:105587318-105587340 CTCTGAGGACTCAGGGGGCAAGG + Intergenic
995201389 5:109428666-109428688 CAATGAGGACACATGGACACAGG - Intergenic
995252477 5:110009408-110009430 CAATGAGAACACATGGACCCAGG - Intergenic
995276034 5:110278859-110278881 CAATGAGGACACATGGACACAGG - Intergenic
995386559 5:111595825-111595847 CTTTGGGCACACATGGGCACAGG + Intergenic
996171906 5:120303807-120303829 CAATGAGGACACATGGACACAGG + Intergenic
997546833 5:134715634-134715656 CAATGAGAACACATGGGCACAGG + Intronic
997800604 5:136857267-136857289 CAATGAGAACACATGGGCACAGG + Intergenic
998277680 5:140773606-140773628 CAATGAGAACACATGGGCACAGG - Intergenic
998426604 5:142034197-142034219 CAATGAGGACACATGGACACAGG + Intergenic
998542490 5:142995989-142996011 CAATGAGAACACATGGGCACAGG + Intronic
998674395 5:144390720-144390742 CAATGAGAACACATGGGCACAGG - Intronic
998752375 5:145336909-145336931 CAATGAGAACACATGGACCCAGG + Intergenic
998768741 5:145517938-145517960 CTATGAGAACACATGGACACAGG + Intronic
999033220 5:148317956-148317978 CAATGAGGACACATGGACACAGG - Intergenic
999303313 5:150504248-150504270 CCCTGAAGACTCCTGGGCCCTGG - Intronic
999943090 5:156565740-156565762 CTATGAGAACACATGGACACAGG - Intronic
1000193397 5:158935395-158935417 CTCTGGGGAGCCATGGGCACAGG + Intronic
1000387744 5:160691153-160691175 CTATGAGAACACATGGACACAGG + Intronic
1000495702 5:161981728-161981750 CAATGAGAACACATGGGCACAGG - Intergenic
1001360802 5:171084155-171084177 CTATGAGAACACATGGACACAGG - Intronic
1001966973 5:175916935-175916957 CAATGAGGACACATGGACACAGG - Intergenic
1002249969 5:177922278-177922300 CAATGAGGACACATGGACACAGG + Intergenic
1002413816 5:179106868-179106890 CAATGAGAACACATGGGCACAGG + Intergenic
1003004954 6:2372504-2372526 CAATGAGGACACATGGACACAGG + Intergenic
1003396281 6:5755383-5755405 CAATGAGAACACATGGACCCAGG - Intronic
1003803032 6:9693015-9693037 CACTGAGAACACATGGACACAGG - Intronic
1004015997 6:11732468-11732490 CTGTGAGGAGCCAGGGGCCCTGG + Intronic
1004738799 6:18435819-18435841 CAATGAGAACACATGGACCCAGG + Intronic
1006084866 6:31588513-31588535 CTCTGAGGAGCCCTGGGCCTGGG - Exonic
1007407667 6:41644282-41644304 CTCCGTGGAGCCATGGGCCCCGG + Intronic
1007721948 6:43890459-43890481 GACAGAGGACACAGGGGCCCCGG + Intergenic
1008469679 6:51869946-51869968 CTTGGAGGACTCATGGGCCAAGG - Intronic
1008722993 6:54379973-54379995 CAATGAGAACACATGGGCACAGG - Intronic
1008864482 6:56193113-56193135 CAATGAGAACACATGGACCCAGG + Intronic
1009486850 6:64235283-64235305 CAATGAGGACACATGGACACAGG - Intronic
1009820778 6:68798480-68798502 CTATGAGAACACATGGACACAGG + Intronic
1010601520 6:77833829-77833851 CAATGAGAACACATGGACCCAGG - Intronic
1010854933 6:80825934-80825956 CAATGAGGACACATGGACACAGG + Intergenic
1010907226 6:81506082-81506104 CAATGAGAACACATGGACCCAGG - Intronic
1010908341 6:81520924-81520946 CAATGAGAACACATGGACCCAGG - Intronic
1010948789 6:82010057-82010079 CAATGAGAACACATGGACCCAGG - Intergenic
1011305941 6:85926787-85926809 CAATGAGAACACATGGGCACAGG - Intergenic
1011355069 6:86465574-86465596 CAATGAGGACACATGGACACAGG + Intergenic
1011405835 6:87014751-87014773 CAATGAGAACACATGGGCACAGG + Intronic
1011705154 6:89993753-89993775 CTCCAAGGACACCAGGGCCCAGG + Intronic
1011851139 6:91630121-91630143 CAATGAGAACACATGGACCCAGG - Intergenic
1012105984 6:95159091-95159113 CTATGAGAACACATGGACACAGG + Intergenic
1012156556 6:95826238-95826260 CAATGAGAACACATGGACCCAGG - Intergenic
1012161068 6:95886555-95886577 CAATGAGAACACATGGGCACAGG - Intergenic
1012633088 6:101498061-101498083 CAATGAGAACACATGGGCACAGG - Intronic
1012822369 6:104102338-104102360 CAATGAGGACACATGGACACAGG + Intergenic
1013382958 6:109595798-109595820 CTATGAGAACACATGGACACAGG + Intronic
1013651611 6:112200829-112200851 CAATGAGAACACATGGGCACAGG + Intronic
1013854554 6:114556215-114556237 CACTGAGAACACATGGACACAGG + Intergenic
1013888402 6:114998791-114998813 CTCTGAGGACATTAGGACCCAGG - Intergenic
1014377558 6:120694552-120694574 CTATGAGAACACATGGACACAGG + Intergenic
1014590130 6:123256133-123256155 CAATGAGAACACATGGGCACAGG - Intronic
1015195912 6:130524636-130524658 ATCTGAGGGCAAAGGGGCCCAGG - Intergenic
1015376049 6:132512087-132512109 CTCTGAGCACACCTGGGCAGAGG - Intronic
1015774537 6:136800450-136800472 CTCTGAGTCCACATATGCCCAGG - Intergenic
1015892703 6:137984358-137984380 CAATGAGAACACATGGGCACAGG - Intergenic
1016148013 6:140700729-140700751 CAATGAGAACACATGGGCACAGG - Intergenic
1016487800 6:144562398-144562420 CAATGAGAACACATGGACCCAGG - Intronic
1016734511 6:147462105-147462127 CAATGAGAACACATGGGCACAGG + Intergenic
1017047437 6:150360282-150360304 CAATGAGAACACATGGACCCAGG - Intergenic
1017412041 6:154178086-154178108 CAATGAGGACACATGGACACAGG + Intronic
1017581429 6:155868692-155868714 CAATGAGGACACATGGACACAGG - Intergenic
1017764640 6:157596600-157596622 CTCTGAGAACACACAGGCCAGGG + Intronic
1018460490 6:163994307-163994329 CAATGAGAACACATGGGCACAGG + Intergenic
1018592440 6:165442337-165442359 CAATGAGGACACATGGACACAGG - Intronic
1018839236 6:167506863-167506885 TTCTGGGGACACAGGGACCCAGG + Intergenic
1019128663 6:169858459-169858481 ATCTGAGGACAGACGGGCCCTGG + Intergenic
1019289187 7:242044-242066 CTCTGGGGACACTGAGGCCCAGG - Intronic
1020517466 7:9140784-9140806 CAATGAGAACACATGGGCACAGG - Intergenic
1020949601 7:14659114-14659136 CAATGAGAACACATGGGCACAGG - Intronic
1021060327 7:16103251-16103273 CAATGAGGACACATGGACACAGG + Intronic
1021301561 7:18979802-18979824 CTCTGAGCTCACATGGGATCTGG - Intronic
1022582009 7:31564828-31564850 CCCTGAAGACACCTGGGCCGGGG + Intronic
1022806397 7:33826780-33826802 CACTGAGAACACATGGACACAGG - Intergenic
1022948902 7:35316828-35316850 CTCTGGGAACACAAGGGGCCTGG - Intergenic
1023099675 7:36703588-36703610 CAATGAGAACACATGGGCACAGG - Intronic
1023395488 7:39748057-39748079 CTTTAAGGACACATGTGCACTGG + Intergenic
1023688340 7:42760253-42760275 CTCTTAGGACATGGGGGCCCAGG - Intergenic
1023697162 7:42859337-42859359 CAATGAGGACACATGGGAACAGG - Intergenic
1023862494 7:44224877-44224899 CCCTGGGGGCACCTGGGCCCAGG - Intronic
1024893031 7:54225103-54225125 CAATGAGAACACATGGACCCAGG + Intergenic
1024897116 7:54273031-54273053 CCGTGAGAACACATGGACCCAGG + Intergenic
1024900887 7:54317284-54317306 CAATGAGAACACATGGACCCAGG - Intergenic
1025545033 7:62154679-62154701 CAATGAGGACACATGGACACAGG + Intergenic
1026187748 7:68095637-68095659 CTATGAGAACACATGGACACAGG + Intergenic
1027336983 7:77161584-77161606 CAATGAGAACACATGGACCCAGG + Intronic
1027615781 7:80422350-80422372 CAATGAGAACACATGGACCCGGG + Intronic
1027746050 7:82075056-82075078 CAATGAGGACACATGGACACAGG - Intronic
1027864051 7:83623918-83623940 CAATGAGAACACATGGGCACAGG - Intronic
1027910205 7:84240799-84240821 CAATGAGAACACATGGACCCAGG - Intronic
1028080097 7:86565121-86565143 CACTGAGAACACATGGACACAGG - Intergenic
1028275746 7:88854798-88854820 CACTGAGAACACATGGACACAGG - Intronic
1028531101 7:91839631-91839653 CAATGAGAACACATGGGCACAGG - Intronic
1028886970 7:95944820-95944842 CAATGAGGACACATGGACACCGG + Intronic
1029594108 7:101527791-101527813 CTCCGAGAACACACTGGCCCTGG - Intronic
1030876274 7:114817358-114817380 CGATGAGAACACATGGGCACAGG + Intergenic
1030979976 7:116174686-116174708 CTATGAGAACACATGGACACGGG - Intergenic
1031555194 7:123166588-123166610 CAATGAGAACACATGGGCACAGG - Intronic
1031778243 7:125928899-125928921 CAATGAGAACACATGGGCACAGG + Intergenic
1032084273 7:128875663-128875685 CTCTGGGAAGACATGGTCCCGGG + Intronic
1032166827 7:129552145-129552167 CTCTGCGGCCACATGTGGCCAGG + Intergenic
1032445435 7:131978539-131978561 CACTGAGAACACATGGACACAGG - Intergenic
1032661980 7:133994158-133994180 CAGTGAGAACACATGGGCACAGG - Intronic
1032752339 7:134853906-134853928 CAATGAGAACACATGGGCACAGG - Intronic
1034108957 7:148517572-148517594 CAATGAGAACACATGGACCCAGG - Intergenic
1034348045 7:150398954-150398976 CTCTGAGCACACACAGACCCGGG - Intronic
1034879811 7:154754923-154754945 CAATGAGAACACATGGACCCAGG + Intronic
1034957683 7:155344802-155344824 CACTAAGGACACACGGGCGCAGG - Intergenic
1035021307 7:155802730-155802752 CTCTAAGGAAACAAGGACCCCGG - Exonic
1035182584 7:157100047-157100069 CAATGAGAACACATGGGCACAGG - Intergenic
1035541325 8:440781-440803 CAATGAGAACACATGGGCACAGG - Intronic
1035906023 8:3511177-3511199 CAATGAGGACACAAGGGCACAGG + Intronic
1036916548 8:12809716-12809738 CTATGAGAACACATGGGCACAGG + Intergenic
1037079963 8:14772622-14772644 CAGTGAGAACACATGGACCCAGG - Intronic
1037195314 8:16181596-16181618 CAATGAGAACACATGGACCCAGG + Intronic
1037884996 8:22591300-22591322 CACTGAGCACAGATGGCCCCAGG + Intronic
1038167163 8:25097078-25097100 CAATGAGAACACATGGACCCCGG + Intergenic
1038357865 8:26847016-26847038 CACTGAGAACACATGGACACAGG + Intronic
1038705577 8:29890366-29890388 CAATGAGAACACATGGGCACAGG - Intergenic
1038966061 8:32573846-32573868 CAATGAGAACACATGGGCACAGG - Intronic
1039004543 8:33019379-33019401 CTATGAGAACACATGGACACAGG - Intergenic
1039265730 8:35821924-35821946 CAATGAGAACACATGGGCACAGG + Intergenic
1039285335 8:36034010-36034032 CTATGAGAACACATGGACACAGG + Intergenic
1039346728 8:36713090-36713112 CAATGAGGACACATGGACACAGG + Intergenic
1039582693 8:38680012-38680034 CTCTGAAGATACATGGCTCCTGG + Intergenic
1039978303 8:42385520-42385542 CTCTGGGGACACATGGGGAGTGG + Intergenic
1040024193 8:42766685-42766707 CAATGAGGACACATGGACACAGG + Intronic
1040371319 8:46778667-46778689 CAATGAGAACACATGGGCACAGG - Intergenic
1040747913 8:50668694-50668716 CTATGAGAACACATGGACACAGG - Intronic
1041008585 8:53519520-53519542 CAATGAGGACACATGGACACAGG + Intergenic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1041152977 8:54955512-54955534 CTCAGAGGACAACTGGGCCTTGG + Intergenic
1041155506 8:54981623-54981645 CAATGAGAACACATGGGCACAGG + Intergenic
1041404928 8:57487901-57487923 CAATGAGAACACATGGGCACAGG + Intergenic
1041743659 8:61183093-61183115 CAATGAGAACACATGGGCACAGG + Intronic
1041891067 8:62869369-62869391 CAATGAGAACACATGGACCCCGG - Intronic
1042095859 8:65215152-65215174 CTATGAGAACACATGGACACAGG + Intergenic
1042116116 8:65433210-65433232 CTATGAGAACACATGGACACAGG - Intergenic
1042799208 8:72700142-72700164 CAATGAGAACACATGGGCACAGG + Intronic
1042843088 8:73144417-73144439 CAATGAGAACACATGGACCCAGG + Intergenic
1043165964 8:76902731-76902753 CACTGAGAACACATGGACACAGG - Intergenic
1044200580 8:89430613-89430635 CAATGAGAACACATGGACCCAGG + Intergenic
1044268380 8:90210108-90210130 CAATGAGGACATATGAGCCCAGG + Intergenic
1044299284 8:90565001-90565023 CTCTGAGGCCACACATGCCCAGG + Intergenic
1044454845 8:92381614-92381636 CAATGAGAACACATGGACCCAGG - Intergenic
1044619319 8:94173338-94173360 CTCTGAGTTCACATGAGACCTGG + Intronic
1045733313 8:105266772-105266794 CTCTGAACACACGTGGGGCCTGG - Intronic
1045855644 8:106762610-106762632 CTATGAGAACACATGGACACAGG + Intronic
1046119677 8:109829721-109829743 CAATGAGAACACATGGACCCAGG + Intergenic
1046122581 8:109864565-109864587 CAATGAGAACACATGGACCCAGG + Intergenic
1046165506 8:110429294-110429316 CAATGAGAACACATGGGCACAGG + Intergenic
1046327120 8:112663433-112663455 CGCTGAGAACACATGGACACAGG + Intronic
1046698978 8:117378255-117378277 CAATGAGAACACATGGGCACAGG + Intergenic
1046725870 8:117673185-117673207 CAATGAGGACACATGGACACAGG - Intergenic
1046775657 8:118160987-118161009 CAATGAGAACACATGGGCACAGG - Intergenic
1047146278 8:122203000-122203022 CAATGAGAACACATGGACCCAGG + Intergenic
1047269854 8:123346085-123346107 CCCTGAAGAAACATGTGCCCAGG - Exonic
1047324308 8:123821602-123821624 CAATGAGGACACATGGACACAGG + Intergenic
1047808341 8:128381474-128381496 CTCTGAGGACATTAGGACCCAGG + Intergenic
1047837254 8:128707636-128707658 CTATGAGAACACATGGACACAGG - Intergenic
1048055656 8:130860834-130860856 CAATGAGAACACATGGGCACAGG - Intronic
1048144846 8:131831393-131831415 CTATGAGAACACATGGACACAGG + Intergenic
1048624279 8:136167679-136167701 CAATGAGGACACATGGACACAGG + Intergenic
1048881973 8:138878432-138878454 CTCTCATGACCCAAGGGCCCTGG + Intronic
1049471497 8:142776939-142776961 CTCTCACGACACATTTGCCCAGG + Intronic
1049607774 8:143537620-143537642 CCCTGGGGACACATGGACCCTGG + Intronic
1049684345 8:143933393-143933415 CTCTGACCTCACAGGGGCCCCGG + Intronic
1050132981 9:2431756-2431778 CAATGAGAACACATGGGCACAGG - Intergenic
1050656648 9:7835920-7835942 CAATGAGGACACATGGACACAGG - Intronic
1050842996 9:10176640-10176662 CTCTGAGGTGACAGGGGCCTAGG + Intronic
1050922587 9:11223860-11223882 CAATGAGAACACATGGACCCAGG + Intergenic
1051519699 9:17972357-17972379 CAATGAGGACACATGGACACAGG - Intergenic
1052118347 9:24676636-24676658 CAATGAGAACACATGGGCACAGG + Intergenic
1053010875 9:34632392-34632414 ATCAGAGGAAACATGGGCCTTGG + Intergenic
1053192783 9:36087438-36087460 CTATGAGAACACATGGACACAGG + Intronic
1053645741 9:40118721-40118743 CTATGTGGACACACAGGCCCCGG + Intergenic
1053759968 9:41344788-41344810 CTATGTGGACACAGAGGCCCTGG - Intergenic
1054326754 9:63716622-63716644 CTATGTGGACACACAGGCCCTGG + Intergenic
1054538830 9:66257251-66257273 CTATGTGGACACACAGGCCCCGG - Intergenic
1054932147 9:70646515-70646537 CAATGAGAACACATGGGCACAGG + Intronic
1055614771 9:78060156-78060178 CTATGAGAACACATGGACACAGG + Intergenic
1055629597 9:78210144-78210166 CAATGAGAACACATGGACCCAGG - Intergenic
1055851931 9:80642290-80642312 CAATGAGAACACATGGACCCAGG + Intergenic
1055852777 9:80652295-80652317 CAATGAGGACACATGGACACGGG - Intergenic
1056416091 9:86377658-86377680 CAATGAGGACACATGGACACAGG - Intergenic
1056683606 9:88741434-88741456 CTGTGAGGAAAAATGGGCTCAGG - Intergenic
1056808218 9:89744821-89744843 CTCACAGAACACATGAGCCCAGG - Intergenic
1056891403 9:90497024-90497046 CTATGAGAACACATGGACACAGG + Intergenic
1057069292 9:92082433-92082455 CACTGAGAACACATGGACACAGG - Intronic
1057180385 9:93026684-93026706 CTCTGAGGACCAGTGGGACCGGG - Intronic
1057516598 9:95727238-95727260 ATCTGAGGATATAGGGGCCCAGG - Intergenic
1057984471 9:99697635-99697657 CAATGAGAACACATGGGCACAGG + Intergenic
1058904279 9:109469080-109469102 CTCTGGTGTCTCATGGGCCCAGG - Intronic
1058917219 9:109579208-109579230 CCCTGAGGAAACTTGGGGCCAGG + Intergenic
1059526998 9:115001147-115001169 CAATGAGAACACATGGGCACAGG - Intergenic
1059600146 9:115768279-115768301 CAATGAGAACACATGGACCCAGG - Intergenic
1059996953 9:119920052-119920074 CAATGAGAACACATGGACCCAGG - Intergenic
1060015292 9:120081344-120081366 CTCTGAGGATCCATGTGGCCAGG + Intergenic
1060547903 9:124471407-124471429 CTTGGAGGACACATGGACCCTGG - Intronic
1060597877 9:124858878-124858900 TTCTGAGGTCACAGGGCCCCAGG + Intronic
1061890273 9:133615655-133615677 CCCTGAGGACACTTGGACCCTGG + Intergenic
1062125357 9:134857767-134857789 CAATGAGAACACATGGGCACAGG + Intergenic
1202793524 9_KI270719v1_random:102193-102215 CTATGTGGACACACAGGCCCCGG + Intergenic
1203368662 Un_KI270442v1:280806-280828 CAATGAGGACACATGGACACAGG + Intergenic
1185518562 X:719167-719189 CAATGAGAACACATGGACCCAGG - Intergenic
1185822533 X:3219292-3219314 CTCTGAGGGCAGATGGGGGCAGG + Intergenic
1185835421 X:3342187-3342209 CATTGAGAACACATGGGCACAGG + Intronic
1186110170 X:6247006-6247028 CAATGAGGACACATGGACACAGG - Intergenic
1186480757 X:9894912-9894934 CTCTGAGAACACAGGGCCCTGGG - Exonic
1186900208 X:14046367-14046389 CAATGAGGACACATGGACACAGG - Intergenic
1187140811 X:16591839-16591861 CTCTGAAGACACAGGATCCCAGG + Intronic
1187247830 X:17568859-17568881 CTATGAGAACACATGGTCACAGG - Intronic
1187308118 X:18115492-18115514 CTTTGAGCACTCATGGGGCCTGG - Intergenic
1187784875 X:22872640-22872662 CTATGAGAACACATGGACACAGG + Intergenic
1187994275 X:24908432-24908454 CAATGAGGACACATGGACACAGG - Intronic
1188174858 X:26976828-26976850 CAATGAGAACACATGGACCCAGG + Intergenic
1188202238 X:27305458-27305480 CAATGAGAACACATGGGCACAGG + Intergenic
1189067108 X:37821853-37821875 CAATGAGAACACATGGGCACAGG + Intronic
1189105070 X:38227147-38227169 CTCTGAGAACGCATGGACACCGG + Intronic
1189133178 X:38521493-38521515 CAATGAGAACACATGGGCACAGG - Intronic
1189814162 X:44808105-44808127 CAATGAGAACACATGGGCACAGG - Intergenic
1189924065 X:45934419-45934441 CAATGAGAACACATGGGCACAGG + Intergenic
1190507353 X:51139263-51139285 CAGTGAGGACACACGGGTCCAGG + Intergenic
1190591583 X:52007932-52007954 CAATGAGAACACATGGGCACAGG - Intergenic
1190963219 X:55272719-55272741 CAATGAGGACACATGGACACAGG + Intronic
1191040285 X:56070609-56070631 CAATGAGAACACATGGACCCAGG + Intergenic
1191115953 X:56853059-56853081 CTATGAGAACACATGGGCACAGG + Intergenic
1191120823 X:56902664-56902686 CGATGAGGACACATGGGCATAGG + Intergenic
1191751904 X:64551813-64551835 CAATGAGAACACATGGACCCAGG - Intergenic
1191775097 X:64805043-64805065 CTATGAGTACACATGGACACAGG + Intergenic
1191808926 X:65165473-65165495 CAATGAGAACACATGGGCACAGG - Intergenic
1191946035 X:66536392-66536414 CAATGAGAACACATGGGCACAGG + Intergenic
1191973622 X:66845383-66845405 CAATGAGAACACATGGGCACAGG + Intergenic
1191997224 X:67108414-67108436 CAATGAGAACACATGGGCACAGG - Intergenic
1192702263 X:73487339-73487361 CATTGAGAACACATGGGCACAGG + Intergenic
1192723364 X:73723758-73723780 CAATGAGAACACATGGGCACAGG + Intergenic
1192850300 X:74948766-74948788 CACTGAGAACACATGGACACAGG - Intergenic
1193030076 X:76888136-76888158 CAATGAGAACACATGGGCACAGG + Intergenic
1193055051 X:77141198-77141220 CAATGAGAACACATGGGCACAGG + Intergenic
1193075790 X:77354227-77354249 CAATGAGAACACATGGGCACAGG + Intergenic
1193113214 X:77750723-77750745 CAGTGAGAACACATGGGCACAGG - Intronic
1193181733 X:78466417-78466439 CAATGAGAACACATGGGCACAGG - Intergenic
1193210608 X:78802569-78802591 CAATGAGGACACATGGACACAGG - Intergenic
1193265796 X:79467829-79467851 CACTGAGAACACATGGACACAGG + Intergenic
1193324297 X:80161545-80161567 CAATGAGAACACATGGGCACAGG - Intergenic
1193367879 X:80656514-80656536 CTATGAGAACACATGGACACAGG + Intergenic
1193393684 X:80959061-80959083 CTATGAGAACACATGGACACAGG - Intergenic
1193400147 X:81032770-81032792 CAATGAGAACACATGGGCACAGG + Intergenic
1193415794 X:81222366-81222388 CTATGAGAACACATGGACACAGG - Intronic
1193624391 X:83798708-83798730 CAATGAGGACACATGGACACAGG + Intergenic
1193755313 X:85402207-85402229 CAATGAGAACACATGGGCACAGG - Intergenic
1194030342 X:88805605-88805627 CAATGAGGACATATGGGCACAGG + Intergenic
1194139582 X:90193278-90193300 CACTGAGAACACATGGACACAGG - Intergenic
1194263456 X:91727310-91727332 CAATGAGAACACATGGACCCAGG - Intergenic
1194286307 X:92014832-92014854 CAATGAGAACACATGGGCACAGG + Intronic
1194655766 X:96571315-96571337 CAATGAGAACACATGGGCACAGG + Intergenic
1194811800 X:98396622-98396644 CAATGAGAACACATGGGCACAGG + Intergenic
1194913936 X:99681975-99681997 CAATGAGAACACATGGGCACAGG + Intergenic
1194958534 X:100209001-100209023 CAGTGAGAACACATGGGCACAGG - Intergenic
1195026190 X:100880107-100880129 CAATGAGAACACATGGGCACAGG + Intergenic
1195395320 X:104404316-104404338 CAATGAGAACACATGGGCACAGG - Intergenic
1195422610 X:104692545-104692567 CACTGAGAACACATGGACACAGG - Intronic
1195607979 X:106830742-106830764 CTATGAGAACACATGGACACAGG + Intronic
1195820401 X:108939109-108939131 CACTGAGGACACATGGACACAGG - Intergenic
1195860775 X:109380585-109380607 CTCTGATGCCACATTGGGCCTGG - Intronic
1196106721 X:111904580-111904602 CTATGAGAACACATGGACACAGG + Intronic
1196243728 X:113373735-113373757 CAATGAGAACACATGGGCACAGG + Intergenic
1196407847 X:115384050-115384072 CAATGAGGACACATGGCCACAGG - Intergenic
1196621313 X:117827642-117827664 CAATGAGAACACATGGTCCCAGG - Intergenic
1196945598 X:120822100-120822122 CAATGAGGACACATGGACACAGG + Intergenic
1197417646 X:126194498-126194520 CAATGAGAACACATGGGCACAGG + Intergenic
1197434829 X:126414053-126414075 CAATGAGAACACATGGGCACAGG + Intergenic
1197449337 X:126592519-126592541 CAATGAGAACACATGGACCCAGG - Intergenic
1198192768 X:134326676-134326698 CACTGAGAACACATGGACACAGG + Intergenic
1198358068 X:135869797-135869819 CAATGAGAACACATGGGCGCGGG + Intergenic
1198359982 X:135887076-135887098 CAATGAGAACACATGGGCGCGGG + Intronic
1198395819 X:136218411-136218433 ATTTGAGGACTGATGGGCCCAGG + Exonic
1198487999 X:137107743-137107765 CTATGAGAACACATGGACACAGG + Intergenic
1198679180 X:139163339-139163361 CACTGAGAACACATGGACACAGG + Intronic
1198757712 X:139998235-139998257 CAATGAGAACACATGGGCACAGG - Intergenic
1198824674 X:140686829-140686851 CAATGAGAACACATGGGCACAGG + Intergenic
1198833548 X:140777087-140777109 CAATGAGGACACATGGACACTGG + Intergenic
1198842219 X:140870019-140870041 CTCTGAGTACACATGGACACAGG + Intergenic
1199127558 X:144140876-144140898 CAATGAGAACACATGGGCACAGG + Intergenic
1199510538 X:148616767-148616789 CAATGAGAACACATGGGCACAGG - Intronic
1199788275 X:151125720-151125742 CAATGAGAACACATGGGCACAGG + Intergenic
1199901203 X:152173984-152174006 CAATGAGAACACATGGGCACAGG - Intronic
1200088837 X:153625017-153625039 CTCAGAGGATGCCTGGGCCCAGG + Intergenic
1200134143 X:153866791-153866813 CTCAGGGGACACGAGGGCCCTGG - Exonic
1200355141 X:155541239-155541261 CAATGAGGACACATGGACACAGG - Intronic
1200603854 Y:5239372-5239394 CAATGAGAACACATGGGCACAGG + Intronic
1200816196 Y:7535430-7535452 ATCAGAGGAGAAATGGGCCCTGG + Intergenic
1200909594 Y:8518033-8518055 CAATGAGGACACATGGACACAGG + Intergenic
1201069909 Y:10137661-10137683 CAATGAGGACACATGGACACAGG - Intergenic
1201472032 Y:14344268-14344290 CTCTGAGGACATTAGGACCCAGG + Intergenic
1201543443 Y:15133895-15133917 CAATGAGAACACATGGACCCAGG - Intergenic
1201599446 Y:15712221-15712243 CAATGAGAACACATGGACCCAGG - Intergenic
1201734185 Y:17239599-17239621 CAATGAGAACACATGGGCACAGG - Intergenic
1201941274 Y:19462873-19462895 CAATGAGAACACATGGGCACAGG + Intergenic
1202591811 Y:26492967-26492989 CAATGAGAACACATGGACCCAGG - Intergenic