ID: 1175768275

View in Genome Browser
Species Human (GRCh38)
Location 20:61606208-61606230
Sequence GTGGCCAAGCAGACAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 385}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175768269_1175768275 17 Left 1175768269 20:61606168-61606190 CCCTGTGGCTCAATGTCCACGCA 0: 1
1: 0
2: 1
3: 3
4: 95
Right 1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG 0: 1
1: 0
2: 1
3: 39
4: 385
1175768266_1175768275 22 Left 1175768266 20:61606163-61606185 CCTCCCCCTGTGGCTCAATGTCC 0: 1
1: 0
2: 1
3: 13
4: 251
Right 1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG 0: 1
1: 0
2: 1
3: 39
4: 385
1175768268_1175768275 18 Left 1175768268 20:61606167-61606189 CCCCTGTGGCTCAATGTCCACGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG 0: 1
1: 0
2: 1
3: 39
4: 385
1175768272_1175768275 1 Left 1175768272 20:61606184-61606206 CCACGCAGCAGATGTGGATAGAA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG 0: 1
1: 0
2: 1
3: 39
4: 385
1175768267_1175768275 19 Left 1175768267 20:61606166-61606188 CCCCCTGTGGCTCAATGTCCACG 0: 1
1: 0
2: 0
3: 18
4: 128
Right 1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG 0: 1
1: 0
2: 1
3: 39
4: 385
1175768270_1175768275 16 Left 1175768270 20:61606169-61606191 CCTGTGGCTCAATGTCCACGCAG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG 0: 1
1: 0
2: 1
3: 39
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175768275 Original CRISPR GTGGCCAAGCAGACAGAGAA TGG Intronic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
901444340 1:9298680-9298702 GTGGCCCACTAGTCAGAGAAGGG + Intronic
901920291 1:12531454-12531476 GTGGCCAGGCCTCCAGAGAATGG - Intergenic
902135395 1:14300688-14300710 GTGGCCATGTTAACAGAGAAAGG + Intergenic
902448987 1:16484860-16484882 GTGGCCCTGGAGACAGAGGACGG - Intergenic
902488529 1:16763999-16764021 GAGGCAAGGCAGAGAGAGAAAGG - Intronic
902657592 1:17880067-17880089 TTGGCCATGCAGCCAGAGAGTGG + Intergenic
902766773 1:18621846-18621868 GTGGCCATGGAGGCAGAGACTGG - Intergenic
903120555 1:21214258-21214280 GTGGCCAAGCAGACCAGGCACGG - Intergenic
904603867 1:31688572-31688594 GTGTCCAACCAGAAACAGAACGG + Intronic
905604368 1:39284375-39284397 CTGGCCAAGGAGAGAGAAAAAGG + Exonic
905892001 1:41523594-41523616 GGGGCCAAGCAGCAAGAGCACGG + Intronic
906170956 1:43724769-43724791 GTGGCAAAGAAGGCAGAGAAAGG + Intronic
906612632 1:47213912-47213934 GTGGGAAAGCAGACAAGGAAAGG + Intergenic
906670664 1:47652079-47652101 GTGGCAAAGGAAACAGACAAAGG + Intergenic
906835427 1:49078664-49078686 GTGGCCCAGAAGAAAGAAAATGG - Intronic
907060447 1:51417656-51417678 GTGGACCAAGAGACAGAGAAGGG + Intronic
907315573 1:53568717-53568739 GTGGAGCAGGAGACAGAGAAGGG - Intronic
907583500 1:55593316-55593338 GTGGCCATGCACAAAGAGATGGG + Intergenic
908412726 1:63883434-63883456 GTGGCCCAGAAAACAGAGGAAGG - Intronic
910864968 1:91779989-91780011 GTGACCATGCAGGCAGAGATTGG - Intronic
911064612 1:93777056-93777078 GTGACCATGGAGGCAGAGAAGGG + Intronic
913411946 1:118561903-118561925 GTGACCATGGAGACAGAGATTGG + Intergenic
914963466 1:152228627-152228649 GTGGGATAGCAGATAGAGAAGGG + Intergenic
915259217 1:154664222-154664244 GGGGCCAAGGAGAGGGAGAAAGG - Intergenic
915340272 1:155173531-155173553 ATGGCAAAGAAGACAGAGATGGG - Intronic
916491726 1:165307998-165308020 GAGGTCAAGCAGCCAGAGAAGGG + Intronic
917790525 1:178496253-178496275 GTCGGCAGGCAGGCAGAGAAGGG - Intergenic
918863356 1:189861041-189861063 GTGGCCCAGCATAGTGAGAAGGG - Intergenic
920193414 1:204210292-204210314 CTGGCAGAGGAGACAGAGAAAGG - Intronic
921964359 1:221072369-221072391 GTGTGCAAGCAGACAGCAAAAGG - Intergenic
923531908 1:234818517-234818539 GAGGCAAGGCAGAGAGAGAAAGG + Intergenic
924621224 1:245662802-245662824 GTGTTCAAGCAGACAGAGTGAGG - Intronic
1063214220 10:3909497-3909519 AGGGCCAAGCAGGCAGAGAACGG + Intergenic
1064111764 10:12545828-12545850 TTTGCCAAGCAGAAAGAAAAAGG + Intronic
1065607939 10:27440257-27440279 GTGGACAACCAGCCAGAAAAAGG - Intergenic
1066491705 10:35900853-35900875 GTGGCCAGGCAGCCACAGGAAGG - Intergenic
1066622674 10:37374745-37374767 GTGGGGGAGCAGACAGTGAATGG - Intronic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067367512 10:45647491-45647513 TTTGCCAAGCAGACAAAGCAAGG - Intronic
1068263853 10:54621796-54621818 GTGGGCAGGAAGAAAGAGAAGGG + Intronic
1069209602 10:65739361-65739383 ATAGCCAAACAAACAGAGAAAGG - Intergenic
1069861880 10:71476562-71476584 TTGGCCAAGAGGACAGAGGATGG + Intronic
1070561106 10:77567101-77567123 CTGACCAAGGAGACAGAGCACGG + Intronic
1070698465 10:78580862-78580884 GCAGCCCAGCAGCCAGAGAAAGG - Intergenic
1071296289 10:84222443-84222465 GTTGTCAAGCAGACAGTGCATGG - Exonic
1072276586 10:93829265-93829287 GTGGCCAAACAGATAGAGACAGG - Intergenic
1072539557 10:96387952-96387974 GTGGCCTACCAGAGCGAGAAAGG + Intronic
1072816558 10:98515125-98515147 GTGGTCAAGCCGACTGAGAGTGG + Intronic
1073082464 10:100868668-100868690 GGGGCCCAGGAGACAGAGCAGGG - Intergenic
1074161185 10:110837527-110837549 TTGGGCAGGCAGACTGAGAAGGG + Exonic
1074278134 10:112024200-112024222 GTGGCCAAGAAGATGGAGGAAGG - Intergenic
1074566521 10:114583969-114583991 GTGGGGAAGCAGGCAGGGAAAGG + Intronic
1074654875 10:115573359-115573381 GGAGGCAAGCAGACAGACAATGG - Intronic
1074953614 10:118365445-118365467 GAAGCCAAGCAGGCAGACAATGG + Intergenic
1075551219 10:123394149-123394171 TGGGCTATGCAGACAGAGAAAGG + Intergenic
1076087554 10:127648556-127648578 GTGGCCCACCAGTCAGAGTAGGG - Intergenic
1077115969 11:884819-884841 GGGGCCAGGCAGACAGAACAGGG - Intronic
1077455821 11:2679704-2679726 CTGGACAAGAATACAGAGAACGG - Intronic
1077895153 11:6448516-6448538 GTGGGCAAGCAGGCAGGCAAGGG - Intergenic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078643131 11:13114429-13114451 GTGGGAAAGAAAACAGAGAAGGG - Intergenic
1078798958 11:14623730-14623752 GTGGCCATGCTGCCAGAGACAGG + Intronic
1079141420 11:17812553-17812575 GGGGCCAAGCAGGAAGAGTAGGG + Intronic
1079582766 11:22086868-22086890 GTGGCTTTGTAGACAGAGAAGGG - Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080094893 11:28394140-28394162 GTGGCAGAGCAGAGAGAGAGGGG + Intergenic
1080682057 11:34486342-34486364 GAGACCAAGCAGAAAGGGAATGG + Intronic
1081488706 11:43550351-43550373 GAGGCCAAGGAGCCAAAGAAGGG + Intergenic
1082188790 11:49216746-49216768 CTGGCAAAGGAGACTGAGAAGGG - Intergenic
1083612055 11:64008924-64008946 GCGGCCACGCAGCCAGAGGAAGG + Intronic
1084934375 11:72579156-72579178 GGGGCCGTGCAGCCAGAGAAGGG + Intronic
1087371945 11:97295144-97295166 GTGACCAAGGAGGCAGAGATGGG + Intergenic
1088597050 11:111448602-111448624 GAGGCCACCCAGCCAGAGAAGGG + Intronic
1088767187 11:112994070-112994092 ATGGCAAAGCAGAAAGAAAAAGG - Intronic
1089784935 11:120901098-120901120 GGGGACAGGCAGACAAAGAAGGG - Intronic
1091086113 11:132723654-132723676 GTGGGCAATGAGAAAGAGAAAGG - Intronic
1091198673 11:133753473-133753495 ATGGCCTATCAGACAGAGAGGGG + Intergenic
1091238938 11:134039614-134039636 GGGGAAAAGGAGACAGAGAAAGG + Intergenic
1091333798 11:134751887-134751909 GAGGACAAGCAAACAGGGAACGG - Intergenic
1091898887 12:4126911-4126933 GTGGCCAAAGAGTCTGAGAAAGG - Intergenic
1092141145 12:6184330-6184352 GTGGCTTTGCAGACAGAGGAGGG - Intergenic
1092444139 12:8538036-8538058 GTGGCCAGGCAGACAGACTGTGG + Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1092866001 12:12762101-12762123 GGTGCCAAGCAAACAAAGAAGGG + Intronic
1093196184 12:16132044-16132066 TTGACCAAGCAGAGAGAGAATGG - Intergenic
1093392761 12:18642553-18642575 GTCTCAAAGCAGGCAGAGAAGGG - Intronic
1093934764 12:24988783-24988805 GTGTGAAGGCAGACAGAGAAGGG - Intergenic
1097010708 12:55951821-55951843 GGGGCCAAGCAGTCAGAGGCTGG + Intronic
1098150885 12:67545121-67545143 GTGGGAAAGGGGACAGAGAAGGG + Intergenic
1100258403 12:92907532-92907554 GTGGCCAAGGAGATGGAGAAAGG - Intronic
1100420410 12:94426809-94426831 GTGACCACGGAGACAGAGACTGG + Intronic
1100588197 12:95999048-95999070 CTTGCCAAGAATACAGAGAAGGG - Intergenic
1101426333 12:104591444-104591466 GGGGCATAGCAGACAGAAAAGGG + Intronic
1102262897 12:111455733-111455755 ATAGCAAAGCAGACACAGAAAGG + Intronic
1103046052 12:117735372-117735394 GTGGCCAAGCGGAGAGAGAAGGG + Intronic
1103286185 12:119803558-119803580 GTGGCCATGTTGGCAGAGAAGGG - Intronic
1103355547 12:120317245-120317267 GTGGCCAAGCAGAGAGGCAAGGG - Intergenic
1103732975 12:123041025-123041047 GTGTGTAAACAGACAGAGAAGGG + Intronic
1103745807 12:123122616-123122638 GTAAACAAGCTGACAGAGAAGGG + Intronic
1104017307 12:124969559-124969581 GTGGCCAAGCAGAGAGGGTGAGG - Intronic
1105651101 13:22379006-22379028 GTGGCCAAGAATATAGAGGAAGG + Intergenic
1105700081 13:22929157-22929179 GTGGCCACCCAGGCAGAGTAGGG - Intergenic
1105852853 13:24351070-24351092 GTGGCCATCCAGGCAGAGTAGGG - Intergenic
1105974843 13:25464470-25464492 GTGGACCAGGAGACAGAGAAAGG - Intronic
1106553091 13:30788282-30788304 GTGGCCCAGCAGCCACAGCAAGG + Intergenic
1107457189 13:40565602-40565624 GTGTACAAGAAGACAGACAAAGG - Intronic
1107837636 13:44424489-44424511 GTTGACAAGTAAACAGAGAAAGG + Intergenic
1108830823 13:54476139-54476161 CTGGGCAAGCAGAAAGAAAAAGG - Intergenic
1109130306 13:58575959-58575981 GTGGCAAGAGAGACAGAGAAGGG + Intergenic
1110308052 13:74013345-74013367 GTGGCTAGCCAGACAGAGTAAGG + Intronic
1113948051 13:114055951-114055973 ATAGCCAAGCTGCCAGAGAATGG + Intronic
1114541229 14:23460999-23461021 GTGACCAAGGAGGCAGAGACTGG + Intergenic
1114558727 14:23576841-23576863 GAGGACAGGCAGACAGGGAAGGG + Intronic
1114600644 14:23953473-23953495 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1114604881 14:23988617-23988639 GTGGACAAGCAGATGCAGAAGGG + Intronic
1114610328 14:24036164-24036186 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1115224011 14:31085120-31085142 CTGGCGAAGCAGACATAGAATGG - Exonic
1115928100 14:38460138-38460160 GTGGCTGAGCAGAGAGAGCAAGG + Intergenic
1116265761 14:42687598-42687620 GAGGCCAAGCAGAAAAAAAATGG - Intergenic
1119669681 14:76508932-76508954 GTGGCCATGCAGCCAGTGAGTGG - Intergenic
1120762641 14:88299382-88299404 GGAGCAAAGCAGAGAGAGAATGG - Intronic
1121122273 14:91383445-91383467 GTGCCCAAGCAGAAAGAGGGAGG - Intronic
1121637703 14:95465085-95465107 GAGGAAATGCAGACAGAGAATGG + Intronic
1122270127 14:100565255-100565277 GTGGACAAGAAGGCAGGGAAGGG + Intronic
1122303250 14:100744050-100744072 GTGGTCCAGCAGTCAGAAAAGGG + Intergenic
1122562001 14:102622402-102622424 GTTCCCAAGCAGACAGTGATGGG - Intronic
1122841583 14:104467071-104467093 GTGGCCATCCAGGCAGAGTAGGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124859287 15:33422635-33422657 GTGGGCAAGCAGAGAGAGAGAGG + Intronic
1125732912 15:41904164-41904186 CTGGCCCAGCAGACAAAGGAGGG + Intronic
1126138559 15:45416750-45416772 GTCTAAAAGCAGACAGAGAAAGG - Intronic
1126174352 15:45721767-45721789 GTGGTGAAGTAGACAAAGAAGGG + Intergenic
1128052449 15:64675915-64675937 GTGGACAAGAAGGCAGAGATGGG + Exonic
1128761799 15:70221431-70221453 GTGGCCAAGGTTACACAGAATGG + Intergenic
1129404305 15:75304702-75304724 GTGACCCAGCAGAGAGAGAAAGG - Intergenic
1130049542 15:80472228-80472250 GTGGCCAAGCTGAAATAGAGTGG + Intronic
1130326960 15:82889067-82889089 GTGGCCCAGCCAACAGAGAGAGG + Intronic
1131022332 15:89109390-89109412 GTGGGCTAGCCGACAGAGAAGGG + Intronic
1132352521 15:101148821-101148843 CCGGCCAAGCACCCAGAGAAAGG + Intergenic
1132849707 16:2019556-2019578 GAGGCTGAGCAGGCAGAGAATGG + Exonic
1132872578 16:2122370-2122392 GGGGCCAGGCACACAGGGAACGG + Intronic
1134551676 16:15141570-15141592 GGGGCCAGGCACACAGGGAACGG + Intergenic
1137001188 16:35232553-35232575 CTGGCCAACCAGACACAGCAAGG - Intergenic
1137779633 16:51087104-51087126 AAGGGCAGGCAGACAGAGAAAGG - Intergenic
1138338040 16:56268215-56268237 GTGGCAAAGGAGGCAGGGAAAGG + Intronic
1139116728 16:63963333-63963355 GTGCCCAACCAGACTGAGAGTGG - Intergenic
1139334601 16:66223047-66223069 GTGGACCAGCTGCCAGAGAAAGG - Intergenic
1140097352 16:71885837-71885859 GTTTCCAAGTAGACAGAAAATGG + Intronic
1141152551 16:81574272-81574294 GTGGCCAAGCAGTTGGAGGAGGG - Intronic
1141902066 16:86997370-86997392 GTGGCCAAGCAGATAAAAAGAGG - Intergenic
1141932602 16:87216082-87216104 GTGGCCACACAGACAGGTAAGGG + Intronic
1143375377 17:6464046-6464068 CTGTCCATGCAGACAGAGATGGG + Intronic
1143863694 17:9908949-9908971 GTGGCGGGGGAGACAGAGAATGG + Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144189023 17:12826232-12826254 GGGGCCAATCAGAGAGTGAAGGG - Intronic
1144772784 17:17769225-17769247 GTGACCCAGCTGGCAGAGAAAGG - Intronic
1144890012 17:18489162-18489184 GGTGCCCAGCAGACAGAGACAGG - Intronic
1145142204 17:20455155-20455177 GGTGCCCAGCAGACAGAGACAGG + Intronic
1146465695 17:33084458-33084480 GTGGCAGAGCAGAAAGAGCATGG + Intronic
1146708890 17:35023521-35023543 GTAGCCATGCAGGCAGAAAATGG + Intronic
1147147469 17:38493550-38493572 GATGCCAAGGAGGCAGAGAAGGG - Intronic
1147428396 17:40357029-40357051 GTGGTCAGGCAGAGGGAGAAAGG - Intronic
1148020178 17:44548183-44548205 GTGGCCCAGCCTAGAGAGAAAGG + Intergenic
1148345717 17:46902574-46902596 GTGGCCAAGCAGTCAGTCCAGGG + Intergenic
1148863306 17:50615715-50615737 GTGGCCAAGGTCACACAGAAAGG + Intronic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1149655404 17:58307162-58307184 ATGGCCATGTAGACAGTGAATGG - Intronic
1151549525 17:74814145-74814167 GGAGCCAAGCAGACTGAGAGTGG + Intronic
1151881427 17:76897502-76897524 GTGACGAAGCAGGCAGAGAGCGG - Intronic
1152927887 17:83095907-83095929 GTGGCCACGGAGGCAGAGACTGG - Intergenic
1153562637 18:6386728-6386750 GAAGCCAAGGAGACAGAGCAGGG + Intronic
1153569219 18:6451580-6451602 GGGGCCAAGAGAACAGAGAAAGG - Intergenic
1154383213 18:13870942-13870964 CTGGCCCAGCAGGCAGTGAATGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157538547 18:48481238-48481260 GTTGGCAAGCATGCAGAGAAAGG + Intergenic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1158229836 18:55242057-55242079 CTAGCCCAGCAGACAGAGCAGGG - Intronic
1159434188 18:68394760-68394782 GTGACCAAGGAGACAGAGATTGG - Intergenic
1160246378 18:77163483-77163505 GTGGCTACGGAGACAGAGATGGG + Intergenic
1160820611 19:1056039-1056061 GGGGCCATGCAGGCAGGGAAGGG - Intronic
1162073226 19:8167496-8167518 CTGGCCAAGCAGCAAGGGAAAGG - Intronic
1162134664 19:8548009-8548031 GCGGCCAAGCAGTCAGGGATGGG - Intronic
1162382455 19:10339607-10339629 GTGGCCATTCTGACAGAGGAAGG + Exonic
1162622924 19:11858839-11858861 GTGGGCAAACAGATAGAAAAGGG - Intronic
1166097527 19:40550262-40550284 CTGGCCATGCAGACAGAGCGAGG + Exonic
1166584030 19:43929514-43929536 GTCAGGAAGCAGACAGAGAAAGG - Intronic
1166784537 19:45359675-45359697 GTGGCCATGGGGAGAGAGAAAGG - Intronic
1167744936 19:51345221-51345243 GTGGCCAAGCTGAAGGAGATTGG - Exonic
1202702669 1_KI270713v1_random:241-263 GAGGCAAGGCAGAGAGAGAAAGG + Intergenic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925665110 2:6245109-6245131 ATGGCCCAGGAGACAGAGGAGGG - Intergenic
925940433 2:8811937-8811959 GCGGACAAGCAGTAAGAGAAGGG + Intronic
926092870 2:10061764-10061786 GTTGCCAGGCAGACAGGGCAGGG - Intronic
926351006 2:11994297-11994319 GTGGTCCAGAGGACAGAGAATGG + Intergenic
926442073 2:12900129-12900151 GTGACCAAGGAGTCAGAGACTGG + Intergenic
926573304 2:14553382-14553404 GGGGCCAGGCAGCCAGAGGAGGG + Intergenic
926829040 2:16940239-16940261 GTGAGAAAGAAGACAGAGAAGGG - Intergenic
927083868 2:19655378-19655400 GTGGCCAAGAAGGTAGAGTAGGG - Intergenic
927295172 2:21445360-21445382 ATGACAAAGGAGACAGAGAAGGG - Intergenic
927640273 2:24841439-24841461 GTGGCCAAGAAAGCAGAGGAAGG + Intronic
927816258 2:26220142-26220164 GTGGTCCAGCAGTCAGAGTAGGG + Intronic
927875836 2:26654689-26654711 GTTTCTAAGCAGACAGAGATGGG + Intergenic
928879501 2:36082201-36082223 GAAGCCAAGAATACAGAGAAAGG + Intergenic
928974923 2:37076388-37076410 GTGACAAAGGAGACAGAGATGGG + Intronic
929315337 2:40471286-40471308 GTGGTCAAGCAGGTAAAGAACGG - Intronic
930978979 2:57498590-57498612 GTGGGCAAGCAGCCTGGGAAGGG - Intergenic
931127751 2:59296572-59296594 GTGCCCAAGCAGACAGATTCTGG - Intergenic
931553647 2:63475308-63475330 TTAGGCAAGCAGAAAGAGAAAGG - Intronic
932014711 2:68013042-68013064 GTGGCCCAGGAGGCAGAGATGGG - Intergenic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
935637531 2:105261238-105261260 GTGGGCAACCAGACAGAGGCAGG + Intergenic
935883937 2:107595250-107595272 GTGGCCAGGGATTCAGAGAAGGG + Intergenic
937027343 2:118710668-118710690 GTGGACAGGGAGACAGAGTAGGG - Intergenic
937036045 2:118783208-118783230 GTGGGCAGGTAGACAGAAAATGG + Intergenic
938698300 2:133854328-133854350 GTGGCCAAGAACACTAAGAAAGG + Intergenic
939350628 2:141033222-141033244 GTGGCTAGGCAGAGAGAGCAAGG + Intronic
940033437 2:149288824-149288846 GAGGTCTAGCAGGCAGAGAAAGG + Intergenic
941400156 2:165020711-165020733 GTGGCCATGAAAGCAGAGAAAGG + Intergenic
941856449 2:170235886-170235908 GTGGCCAAGAAAACTGAGAACGG + Intronic
942246948 2:174016691-174016713 GTGACTAAGGAGACTGAGAAAGG - Intergenic
942495827 2:176539030-176539052 GTGGGAAGGTAGACAGAGAAAGG - Intergenic
942956856 2:181783451-181783473 GTGGCATATCAGCCAGAGAAGGG + Intergenic
944400466 2:199320122-199320144 GTGGCCACGCAGACAGAATGTGG + Intronic
944990407 2:205229513-205229535 GTGGCTCAGCACACAGAGAGAGG - Intronic
945423453 2:209668059-209668081 GGAGCCCAGCAGAAAGAGAAAGG - Intronic
945476705 2:210291482-210291504 GTTGCCTAGCAGACAGTGATGGG - Intronic
946184392 2:217970981-217971003 CTGGCCAAGAAGACAGAGCTTGG + Intronic
946334944 2:219030213-219030235 GTGGCCAAGCAGAAGGACAAAGG + Intronic
946426656 2:219602001-219602023 GAGGCCATGCAGACAGTGGAGGG - Exonic
947406220 2:229780346-229780368 GTGGACCAGATGACAGAGAATGG - Intronic
947985923 2:234447357-234447379 GTGACCACGGAGACAGAGACTGG + Intergenic
948484005 2:238268438-238268460 TTGGTAAAGCAGACAGAAAAGGG + Intronic
1168836514 20:881319-881341 GTGGGCAAGGAAAGAGAGAAGGG + Intronic
1169901532 20:10557672-10557694 GTGGCAAAGCCGAAAGGGAATGG - Intronic
1170418748 20:16171421-16171443 GAGGGAAAGCAGAAAGAGAAAGG + Intergenic
1170592383 20:17780733-17780755 GTGGCGATGGAGACAGAGATTGG + Intergenic
1170880047 20:20289056-20289078 GTTGCCACAGAGACAGAGAAAGG + Intronic
1171213326 20:23333940-23333962 GTGGGAAAGCAAACAGGGAAGGG - Intergenic
1172774026 20:37396976-37396998 GTGGCCGAAGAGACAGAGAGTGG - Intronic
1173181228 20:40807776-40807798 GAAGCCAAGAATACAGAGAAAGG - Intergenic
1173705600 20:45108200-45108222 GAGGCCCAGCAGATAGAGCAGGG + Intergenic
1173914632 20:46697841-46697863 CTGGCCTTGAAGACAGAGAAAGG - Intergenic
1174148538 20:48469450-48469472 GTGGGAGAGGAGACAGAGAAGGG - Intergenic
1174207424 20:48850820-48850842 TTTGCCAGGCAGACAGAGGAAGG - Intergenic
1174458464 20:50666154-50666176 GAGGCCTAGAATACAGAGAAAGG + Intronic
1174850399 20:53988343-53988365 GAGACTAAGCAGAGAGAGAAAGG - Intronic
1174955214 20:55090377-55090399 GTGGACAAGCAGAAAGAAAGTGG - Intergenic
1175452086 20:59077904-59077926 GAGGGCAAGGAGAAAGAGAAAGG + Intergenic
1175629757 20:60525692-60525714 CTGCCCAAGCAGGAAGAGAAAGG - Intergenic
1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG + Intronic
1176241126 20:64076456-64076478 GGGGCCAAGCAGACCCAGGAGGG - Intronic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1176984591 21:15421358-15421380 TTGGCGAAGAAGACAGAGATTGG - Intergenic
1178204514 21:30447758-30447780 GTGGCCAGGCAAAAAGAAAAAGG + Intergenic
1178223208 21:30684507-30684529 TTGGCCAAGGAAACAGGGAAAGG + Intergenic
1178337153 21:31753502-31753524 GTTGCCCACCAGTCAGAGAAGGG - Intergenic
1179606836 21:42522051-42522073 GTGGCCACACAGGCAGAGACTGG - Intronic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1180109869 21:45642866-45642888 GGGGCCAGGCCCACAGAGAACGG + Intergenic
1180627525 22:17204052-17204074 CTGGCCAAGCATACAGAGGGAGG - Intronic
1181308266 22:21929225-21929247 GGGGCCAAGCCTACAGAGCATGG + Intronic
1181504002 22:23338540-23338562 CTGGCAAAGCTGAAAGAGAAGGG - Intergenic
1181778072 22:25174226-25174248 GTGGCCAAGCTGCCAAAAAAGGG - Exonic
1182752249 22:32651113-32651135 AAGGCCAAGAAGACAGACAAGGG + Intronic
1182764399 22:32748275-32748297 GTGGCCCAGGAGAAAGAGCATGG + Intronic
1183654989 22:39179463-39179485 GGGCCCAAGCAGACAGAGTCAGG + Intergenic
1184024143 22:41841479-41841501 GAGGCCAAATAGACAGAGGAGGG - Intronic
1185009818 22:48306656-48306678 GTGGCCCAGCAAGCAGAGAGTGG - Intergenic
1185273954 22:49941908-49941930 GGGGCCAGGCTGGCAGAGAACGG - Intergenic
950032387 3:9861642-9861664 TTGGCCAAGGGGACAGATAAAGG - Intergenic
950134643 3:10571978-10572000 ATGGCCAAGCAGAAAGCCAAGGG - Intronic
951547113 3:23837902-23837924 GTGGACAAGCAGAAAGAAAAGGG - Intronic
951579456 3:24146561-24146583 GAACCCAAGAAGACAGAGAAGGG - Intronic
952883734 3:38000637-38000659 GTGGACAGGCAGGCAGAGACAGG + Intronic
952957376 3:38565525-38565547 GTAGCCAAGCAGAGAGAAACGGG - Intronic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
954096521 3:48332982-48333004 GTGCCAAAGGAGATAGAGAAAGG - Intergenic
954382868 3:50228826-50228848 AAGGCCAAGCAGACAGAGTTAGG - Intronic
954645743 3:52130586-52130608 GAGGACATGCAGAGAGAGAACGG - Intronic
955527197 3:59833379-59833401 GTGACCATGAAGACAGAGATTGG + Intronic
955666141 3:61350775-61350797 GCGCCGAAGCAGACAGGGAAAGG + Intergenic
955774611 3:62420156-62420178 GTTTCCAAGCAGATAGTGAAAGG + Intronic
956710069 3:72031189-72031211 GTTGCCAAGTATACAGAAAAAGG + Intergenic
956975021 3:74569147-74569169 GAGGCAGAGCAGACAGAAAATGG - Intergenic
957418724 3:79940034-79940056 GTGGGCAAGTAGAGAAAGAAAGG - Intergenic
958131361 3:89429288-89429310 GAGGCTAAATAGACAGAGAAGGG + Intronic
958145437 3:89617835-89617857 GTGGCCAAGCAGAAGCTGAAGGG - Intergenic
960744496 3:120872176-120872198 CTGGCCAATCAGCAAGAGAAAGG - Intergenic
961709098 3:128813304-128813326 CTGGACAAGGAAACAGAGAAAGG - Intronic
962113966 3:132482284-132482306 TTGGCAACGCAGACAAAGAAAGG + Exonic
966583563 3:181596042-181596064 GTGTTCAAGCAGAGAAAGAAAGG + Intergenic
967034426 3:185637515-185637537 ATGGCTGAGTAGACAGAGAAGGG - Intergenic
967382333 3:188872946-188872968 GTGAGCAAGCAGACTGAGAGAGG - Intronic
968446138 4:653276-653298 TTGACCAAGGAGGCAGAGAAAGG + Intronic
968880051 4:3293931-3293953 ATAGCCGTGCAGACAGAGAAGGG + Intronic
969197753 4:5576676-5576698 TTGGTCAGGCAGACAGAGAAAGG - Intronic
969710408 4:8840151-8840173 GTGCCCAGGAAGACAGAGAGAGG + Intergenic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
972178163 4:36433123-36433145 GTGCCCACCCAGACTGAGAATGG + Intergenic
973936448 4:55851469-55851491 GTGGACAAGCTGGCAAAGAAAGG + Intergenic
974038245 4:56835964-56835986 CTTGCCTAGCAGATAGAGAAAGG + Intergenic
974967210 4:68775053-68775075 GAGGACAGGCAGACAGAGATGGG + Intergenic
975001618 4:69230394-69230416 GAGGACAGGCAGACAGAGATGGG + Intergenic
975003825 4:69261723-69261745 GAGGACAGGCAGACAGAGATGGG - Intergenic
976712217 4:88084711-88084733 GTGGAAGAGCAGGCAGAGAAAGG - Intergenic
981195044 4:141909456-141909478 GTGGCCAGGGAGGCAGAGACTGG + Intergenic
983317845 4:166154836-166154858 GTGGCTAAGAGGAGAGAGAAGGG + Intergenic
984804794 4:183741792-183741814 TGGCACAAGCAGACAGAGAAAGG - Intergenic
985574554 5:667964-667986 GCGGACAAGCACACAGAGAGGGG + Intronic
986805090 5:11301679-11301701 GTTTGCAAGCAGACAGGGAATGG + Intronic
989609986 5:43281685-43281707 GTGGACAAGCAGGCAAAGAAAGG - Intergenic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
991603659 5:68378868-68378890 CTGGGGAAGCAGACAGGGAAAGG + Intergenic
992216690 5:74531481-74531503 GTGACCAAGCAGGGAGGGAAAGG + Intergenic
992311154 5:75500073-75500095 GTGTACATGCAGACAGAGATTGG + Intronic
992377249 5:76200090-76200112 GTGGTCAACCAGTCAGAGCAGGG + Intronic
992943217 5:81783455-81783477 GTGGACAAGGAATCAGAGAAAGG - Intergenic
994181238 5:96768731-96768753 TGGGCTAAGCAGACAGAAAAGGG - Intronic
995200299 5:109417571-109417593 ATGGCCCAGCAGACAAAGATAGG - Intergenic
995708845 5:115014447-115014469 GTAGCTAAGGAGACACAGAATGG - Intergenic
995833938 5:116381883-116381905 GTGGCCCAGGAGACAGCGAGGGG + Intronic
997472806 5:134126107-134126129 GTGGCCAGGCAGGCAGAGGTGGG + Intronic
998132078 5:139656263-139656285 GGGGCCAGGCCCACAGAGAAAGG - Intronic
999049837 5:148510436-148510458 ATGTGCAAGCAGACAGGGAAGGG - Intronic
1000007447 5:157200278-157200300 GTGGCCAAGAAAAGAGACAAGGG + Intronic
1000508436 5:162150873-162150895 GAGGCAAAACAGACAGGGAAGGG - Intronic
1001577623 5:172774390-172774412 GTCACCAAGCAGACAGTGAGCGG - Intergenic
1002665426 5:180820343-180820365 GTGGCCAGGCAGAGAGAGAGAGG + Intergenic
1003232329 6:4265807-4265829 TTAGCCAAGAAGAAAGAGAAAGG + Intergenic
1004406147 6:15335603-15335625 GTGGACAGGCAGGCAGAGAAAGG - Intronic
1004609275 6:17223924-17223946 GTGGCAGAGCAGACAGAAAGAGG - Intergenic
1006972846 6:38064740-38064762 GTCACCAAGAAGAGAGAGAAAGG - Intronic
1010327334 6:74580093-74580115 GTTGCCAGGCAGGCAGAGATGGG + Intergenic
1010538346 6:77059835-77059857 GTGGCTAAGGAGGAAGAGAAGGG - Intergenic
1011712678 6:90070474-90070496 CAGGCCAAGCAGACACAGCATGG + Intronic
1013327274 6:109059280-109059302 ATAGCCAAGCAGACACAAAATGG + Intronic
1013502416 6:110765953-110765975 GTTGGCAAGGAGGCAGAGAAAGG + Intronic
1013790401 6:113829850-113829872 GTGGGGAAGCAGGCAGAGAATGG + Intergenic
1014780394 6:125558708-125558730 TGGTCCAAGCAGACAGAGAAAGG + Intergenic
1016257877 6:142130788-142130810 TCGGCCAAGAACACAGAGAATGG + Intergenic
1018862155 6:167719004-167719026 GTGACCAAGAGGACAGATAAAGG - Intergenic
1018953746 6:168394586-168394608 GTGGCCATGGAGAGAGAGATGGG + Intergenic
1019078382 6:169410228-169410250 GTGGACAGGCAGAGAGGGAAGGG - Intergenic
1019404647 7:877116-877138 GCGGCCGAGGAGACAGAGGAAGG - Intronic
1021229430 7:18067858-18067880 GTGGCCCAGCAGACAAAGCTGGG + Intergenic
1022610002 7:31861458-31861480 GAGGCCAAGCAGAAAGAAAAAGG - Intronic
1022973762 7:35538888-35538910 GTGACCAGGCGGACAGAGGAGGG - Intergenic
1023012424 7:35936116-35936138 GTGGCTATGCACATAGAGAATGG + Intergenic
1023125335 7:36949444-36949466 GTGGCCATGCACATTGAGAAGGG - Intronic
1023490262 7:40732231-40732253 GTCACCAGCCAGACAGAGAATGG - Intronic
1023855703 7:44182361-44182383 GTAGCCAAGCAGGTAGAGAAAGG + Intronic
1023903175 7:44500648-44500670 GTGGCCCAGAAGACAAACAAGGG + Intergenic
1024078703 7:45837713-45837735 GTGGCTATGCACATAGAGAATGG - Intergenic
1024710403 7:52009083-52009105 GAGACCAAGAAGACAGGGAAGGG - Intergenic
1025126088 7:56346226-56346248 GTGGCTATGCACATAGAGAATGG + Intergenic
1026541316 7:71282397-71282419 GTAGCAATGCAGAGAGAGAAGGG + Intronic
1027702778 7:81488479-81488501 GTGTCCCAGCTGACAGAGGAGGG + Intergenic
1029309328 7:99647209-99647231 GAGCCCAAGCAATCAGAGAAGGG - Intergenic
1029314997 7:99703844-99703866 GAGTCCAAGCAAGCAGAGAAGGG - Intronic
1029320680 7:99756745-99756767 GAGTCCAAGCAAGCAGAGAAGGG - Intergenic
1029712715 7:102308410-102308432 CTGGCCAAGCACACTGAGTAGGG - Intronic
1030993828 7:116334290-116334312 GTGGCCATTTACACAGAGAAGGG + Intronic
1031411472 7:121444760-121444782 TTGGCTAAGCATACAGAGAAGGG - Intergenic
1032139424 7:129313538-129313560 GTGGACAGCCAGACAGACAAAGG + Intronic
1033648914 7:143325446-143325468 GTGGCAAAGCACACAGACTAAGG + Intronic
1034221432 7:149449439-149449461 AGGGAAAAGCAGACAGAGAAAGG + Intronic
1035203386 7:157280166-157280188 GAGGCCACGGAGACAGAGGAGGG - Intergenic
1035676594 8:1461046-1461068 GTGGCCAGGAGGAGAGAGAAGGG + Intergenic
1035763721 8:2088424-2088446 GAGGCCTACCAGACAGAGCAAGG - Intronic
1035891879 8:3353951-3353973 CAGGCCAAGCAGACTGAGACAGG - Intronic
1036630906 8:10514357-10514379 GTGGCTAGGCAGACAGTGAAAGG + Intergenic
1037220245 8:16510308-16510330 GGGGCCAAGCAAAGAGAAAATGG + Intronic
1038423807 8:27451714-27451736 GTGGCCACTGAGAGAGAGAAGGG - Intronic
1038567769 8:28634302-28634324 GGGGCCAGGCAGACACAGCATGG - Intronic
1039626683 8:39061427-39061449 GTGGTCAAGAAGTCAGAGTAGGG - Intronic
1040410397 8:47148484-47148506 GGGGACTACCAGACAGAGAACGG + Intergenic
1041048835 8:53913643-53913665 GTGGCAAAGAAGACAGAGATTGG + Intronic
1043426826 8:80156228-80156250 GAGGCCAGGCAGACAGAGACAGG - Intronic
1043517289 8:81006371-81006393 GTGCCCACACAGAGAGAGAAGGG - Intronic
1043691531 8:83159519-83159541 TTCACCAAGCAGAAAGAGAAGGG + Intergenic
1044624057 8:94218767-94218789 GAGCCCAAACAGACAGAGGAGGG - Intergenic
1047232194 8:123007146-123007168 GTGGCCATGCAGGCAGAGATTGG - Intergenic
1048228451 8:132613510-132613532 GTTGCCATGAAGACAGAGAATGG + Intronic
1048230759 8:132638620-132638642 GTCACCTAGCAGAGAGAGAATGG + Intronic
1049755957 8:144311433-144311455 GGGGCACAGCTGACAGAGAAGGG - Intronic
1049815460 8:144597089-144597111 GTGCCCAAGGAGACAGAGGAGGG + Intronic
1053560288 9:39185647-39185669 GTGGCCAAGCAGAAAGTGACAGG + Intronic
1053824392 9:42005890-42005912 GTGGCCAAGCAGAAAGTGACAGG + Intronic
1054136830 9:61433308-61433330 GTGGCCAAGCAGAAAGTGACAGG - Intergenic
1054606179 9:67181473-67181495 GTGGCCAAGCAGAAAGTGACAGG - Intergenic
1055418832 9:76114237-76114259 GAGGCCTAGCGGACAGAGAAGGG + Intronic
1055787982 9:79891590-79891612 GAGGCCAGGCACACAGATAAGGG - Intergenic
1056089639 9:83192544-83192566 GTGGCCTACCAGACAGTGAAGGG + Intergenic
1057150720 9:92793830-92793852 CTGGCCCACCAGACAGAAAAGGG + Intergenic
1057725741 9:97566939-97566961 TTGGCCAAGCAGACAACTAAAGG + Intronic
1058504184 9:105652292-105652314 GTGGACAAGGACTCAGAGAAAGG - Intergenic
1058676899 9:107407808-107407830 GTGCTCAAGCAGTCAGAAAAGGG - Intergenic
1059345310 9:113624270-113624292 GTGACCAGGCAGAAAGAGCATGG + Intergenic
1060530877 9:124346478-124346500 TTGGCCAAGAAGCCAGAGCAGGG + Intronic
1061008370 9:127941354-127941376 GAGGTCACGCAGACACAGAAGGG + Exonic
1061244281 9:129393315-129393337 GGGTCCATGCAGGCAGAGAATGG - Intergenic
1062037508 9:134389337-134389359 GAGGCCAAGCAGGCTGGGAAGGG + Intronic
1185535127 X:854999-855021 GAGGAGAAGAAGACAGAGAAAGG - Intergenic
1185807709 X:3075706-3075728 AGAGACAAGCAGACAGAGAAAGG - Intronic
1187830550 X:23376773-23376795 GTGACAAAGCAGCCAGAGAGAGG - Intronic
1188982197 X:36736416-36736438 ATGGCCAACCACACTGAGAAGGG - Intergenic
1190047121 X:47121339-47121361 GTGGCCACGGAGGCAGAGATTGG - Intergenic
1190329459 X:49226697-49226719 GTGGCCCTGCAGGGAGAGAAAGG + Exonic
1191831264 X:65419018-65419040 GTGGCCCCTCAGACAGAGTAGGG + Intronic
1193776538 X:85649517-85649539 GTGCCCAATCAGACAGAGGGTGG + Intergenic
1194327602 X:92539913-92539935 GTGGCTCAGCACACAGAGAGAGG - Intronic
1195815481 X:108880734-108880756 GTGAAAAAGAAGACAGAGAATGG + Intergenic
1196641356 X:118066023-118066045 GTTACAAAGCAGACAGAAAAGGG + Intronic
1198169858 X:134094974-134094996 GTGGCCTACCAGTCAGAGTAGGG + Intergenic
1198312116 X:135434011-135434033 GTGGCCCTGGAGACAGAGGATGG + Intergenic
1198681091 X:139183137-139183159 GTGTGCAAGTAGACAGAGCAGGG - Intronic
1199748393 X:150791258-150791280 CTGTCTAAGCAGACAGAGATAGG - Intronic
1200636315 Y:5659131-5659153 GTGGCTCAGCACACAGAGAGAGG - Intronic
1201271134 Y:12255060-12255082 ATAGACAAGCAGACAGAGAGGGG + Intergenic
1201473917 Y:14360807-14360829 GTGGATGAGCAGACACAGAATGG - Intergenic
1201799173 Y:17935869-17935891 GTAGCAAAGGAGACTGAGAAAGG + Intergenic
1201802380 Y:17970087-17970109 GTAGCAAAGGAGACTGAGAAAGG - Intergenic
1201924276 Y:19267676-19267698 GTGACCAATGAGACAGAGATAGG - Intergenic
1202362488 Y:24126454-24126476 GTAGCAAAGCAGACTGAGAAAGG - Intergenic
1202508193 Y:25543471-25543493 GTAGCAAAGCAGACTGAGAAAGG - Intergenic