ID: 1175771556

View in Genome Browser
Species Human (GRCh38)
Location 20:61627670-61627692
Sequence GGCACTGCTGTCCCAACCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175771556_1175771562 2 Left 1175771556 20:61627670-61627692 CCCCTGGTTGGGACAGCAGTGCC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1175771562 20:61627695-61627717 CCGCCCCCCGACTCGACTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 23
1175771556_1175771572 26 Left 1175771556 20:61627670-61627692 CCCCTGGTTGGGACAGCAGTGCC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1175771572 20:61627719-61627741 CCAGGCACTTGGTGTCATGCAGG 0: 1
1: 0
2: 1
3: 30
4: 177
1175771556_1175771574 28 Left 1175771556 20:61627670-61627692 CCCCTGGTTGGGACAGCAGTGCC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1175771574 20:61627721-61627743 AGGCACTTGGTGTCATGCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 174
1175771556_1175771573 27 Left 1175771556 20:61627670-61627692 CCCCTGGTTGGGACAGCAGTGCC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1175771573 20:61627720-61627742 CAGGCACTTGGTGTCATGCAGGG 0: 1
1: 0
2: 2
3: 36
4: 370
1175771556_1175771569 15 Left 1175771556 20:61627670-61627692 CCCCTGGTTGGGACAGCAGTGCC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1175771569 20:61627708-61627730 CGACTTGAGGCCCAGGCACTTGG 0: 1
1: 0
2: 0
3: 13
4: 152
1175771556_1175771567 8 Left 1175771556 20:61627670-61627692 CCCCTGGTTGGGACAGCAGTGCC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1175771567 20:61627701-61627723 CCCGACTCGACTTGAGGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175771556 Original CRISPR GGCACTGCTGTCCCAACCAG GGG (reversed) Intronic
900589569 1:3453707-3453729 GGCACCGGTGTGCCAGCCAGAGG - Intergenic
900913832 1:5620607-5620629 GGGACCACTGTCCCCACCAGGGG - Intergenic
902121590 1:14170429-14170451 GCCACTGCTGACCCTACCACTGG - Intergenic
902272406 1:15314308-15314330 GGCACTGCGGTCAGAGCCAGAGG - Intronic
902682790 1:18055506-18055528 GGCAGTGATGCCCCACCCAGAGG + Intergenic
903319830 1:22536098-22536120 CCCATTTCTGTCCCAACCAGCGG + Intergenic
904494065 1:30876976-30876998 GGGACTTCTGTCACCACCAGGGG + Exonic
906483928 1:46220175-46220197 GGCACTGCTCCCAGAACCAGTGG - Exonic
906581639 1:46940085-46940107 TGCACTGCTATCCCTACAAGGGG - Intronic
906588941 1:47005301-47005323 GGTGCTGCTGTCCCAAGCAGGGG + Intergenic
906944665 1:50285496-50285518 GGCTCAGCTGTCCCAAACACAGG + Intergenic
912466973 1:109881110-109881132 GGCACTGCTCTCCCACCCACAGG + Intergenic
913108867 1:115640647-115640669 GGCTCTGCTGCCCCACTCAGTGG - Intergenic
915056902 1:153141499-153141521 GGGCCTGCTGCCCCACCCAGGGG + Intergenic
915920194 1:159970440-159970462 GGCCCTGCTGTTCCTACCACTGG - Intergenic
920398573 1:205663230-205663252 GGCACTGGTGTCCCAGTCAATGG + Exonic
922106717 1:222518619-222518641 GGCACTGCGGATCCATCCAGAGG - Intergenic
924496451 1:244594996-244595018 AGCACTGCTTTCCCTACCAGAGG + Intronic
1064048577 10:12041945-12041967 GGCTCTGCTCTGCCAACCTGGGG + Intronic
1066727469 10:38408718-38408740 GGCACTGCGGATCCATCCAGAGG + Intergenic
1067018326 10:42773761-42773783 GGAGCTGCTGTCCAAGCCAGAGG - Intergenic
1068865475 10:61890238-61890260 GACACTGCGGTCCCAACCCCAGG - Intergenic
1069638464 10:69940113-69940135 GGCACTCCTGTTCCAACCCTGGG - Intronic
1069759138 10:70795976-70795998 GCCAATGCTGACCCAAACAGAGG - Intergenic
1072415621 10:95244509-95244531 AGCACTGCTTTCTGAACCAGAGG + Intronic
1073458952 10:103654475-103654497 GGCAGAGCTGCCCCAATCAGTGG + Intronic
1073514114 10:104061880-104061902 GCCACCGCTGTGCCAACCTGGGG - Intronic
1073575366 10:104618469-104618491 CACACAGTTGTCCCAACCAGAGG - Intergenic
1073589487 10:104742823-104742845 GGCAGTGCAGTTCCAACCAATGG - Intronic
1075708323 10:124516304-124516326 GGGACTGCTGTCCTTACCAGAGG - Intronic
1076119347 10:127923070-127923092 TGCACTCCTGTCCCAGGCAGAGG + Intronic
1077111663 11:864722-864744 GGCACTGCTACCCCACCCGGAGG + Intronic
1077169136 11:1158647-1158669 GGAACTGCTGGCCCAGCAAGGGG - Intronic
1077352550 11:2099611-2099633 GGAACTGCTGTCCCCACTTGTGG + Intergenic
1078668660 11:13346278-13346300 GGCTGAGCTGTCCCACCCAGTGG - Intronic
1079091298 11:17482148-17482170 GGCCATGCTGTGCCAGCCAGAGG - Intergenic
1083173931 11:60937897-60937919 GGCACTGCTGTCCTTGCCCGGGG - Exonic
1083452027 11:62752629-62752651 GGCACAGCCCTCCCAGCCAGAGG - Exonic
1083648477 11:64186479-64186501 GGCCCTCCTCGCCCAACCAGGGG - Intronic
1084086858 11:66858859-66858881 GGCACTGCTGTTCCCACCATGGG - Exonic
1084390656 11:68874679-68874701 GGCACTGCCATCCCCACTAGGGG - Intergenic
1084514166 11:69626996-69627018 GGCACTTCGGTCACAAGCAGAGG + Intergenic
1084769500 11:71333621-71333643 GGCACTGCTGGCCCACCAAGAGG + Intergenic
1091760374 12:3083557-3083579 GGGACTGCTGCCCCAAAGAGTGG + Intronic
1092312711 12:7375430-7375452 GGGACTGCTCTCTCAACCACAGG - Exonic
1095945939 12:47753468-47753490 GGCACTGCGTGCCCAAGCAGAGG + Intronic
1096003055 12:48145265-48145287 GGCTCTGGTCTTCCAACCAGTGG + Exonic
1096115467 12:49052347-49052369 GCCACTGCTGCCCCCACCTGAGG - Exonic
1096220523 12:49826030-49826052 GGCCCTGCTATACCAGCCAGTGG - Intronic
1099078379 12:78141806-78141828 GGCAGTGCTGGCCCAACAGGAGG - Intronic
1102302851 12:111783454-111783476 GGCACCTCTGTACTAACCAGAGG + Intronic
1103253526 12:119521530-119521552 GGGAATGCTGTTCCAAGCAGGGG + Intronic
1105703439 13:22951185-22951207 GGAACACCTGTCCCACCCAGGGG + Intergenic
1106054744 13:26227775-26227797 AGCACTGCTGCCCCACTCAGGGG - Intergenic
1108239116 13:48444083-48444105 GGCACTGAGACCCCAACCAGTGG - Intronic
1112390365 13:98978041-98978063 GGCTCTGCAGACCCAGCCAGCGG - Intronic
1113485418 13:110649248-110649270 TGCACTGCAGTTCCACCCAGGGG + Intronic
1113786019 13:113002434-113002456 GCCACTGCTGTCCCCACAATGGG + Intronic
1115799510 14:36976711-36976733 GCTTCTGCTGTCCCAGCCAGTGG - Intronic
1117742378 14:58832168-58832190 CACAGTGGTGTCCCAACCAGTGG + Intergenic
1119724524 14:76914039-76914061 GTGCCTGCTGTCCCACCCAGTGG - Intergenic
1119963160 14:78882434-78882456 GGCAGTGCTGTCCAAGCCATGGG + Intronic
1122504360 14:102222260-102222282 GGCCCTGCTGTCTCTACCTGTGG + Intronic
1122951673 14:105048336-105048358 AGCCCTGCTGTCCCTACCGGTGG + Intergenic
1127410083 15:58697189-58697211 GACCCTGCTGCCCCAAGCAGTGG + Intronic
1127833235 15:62769270-62769292 GGCACTGGTGTCACCACCAAAGG - Intronic
1127838068 15:62806728-62806750 GGCAAGGCTGTCCCAAGAAGGGG - Intronic
1131036646 15:89226889-89226911 GGCACTATTGTTCCCACCAGGGG - Intergenic
1134057337 16:11178725-11178747 GGCACTGGGGTCCCTACCAGCGG - Exonic
1134595743 16:15494557-15494579 GGAACTGCAGTCCCAATCTGTGG + Intronic
1135401939 16:22172091-22172113 TGCACTGTTCTCCCACCCAGGGG + Intronic
1137394869 16:48109793-48109815 GGCACTCCTGCCCCAGCCTGCGG - Intronic
1138242037 16:55435186-55435208 GGCACTGCTTTCACCTCCAGGGG - Intronic
1141639809 16:85334534-85334556 GGACCTGGTGTCCCGACCAGAGG + Intergenic
1141703540 16:85653054-85653076 GGCAGTGCTGTCCCCACATGGGG + Intronic
1144713597 17:17419417-17419439 GCCACTGCTGACCCAACAGGAGG - Intergenic
1145231378 17:21175616-21175638 GGCACTCCTGTCCTCACCTGAGG - Intronic
1145404034 17:22570211-22570233 GGCTCTTCTGTGCCAAGCAGAGG - Intergenic
1145722306 17:27084279-27084301 TGCACTGCTGCTCCAACCAGAGG - Intergenic
1148032131 17:44628674-44628696 GACATTTCTGTCCCAATCAGAGG + Intergenic
1148535522 17:48435286-48435308 GGCACTGCTGAGCCCAGCAGAGG + Intergenic
1148639598 17:49176541-49176563 GGAACACCTGTCCCACCCAGGGG - Intergenic
1149647778 17:58252611-58252633 GCCATTGCTGTCCCTAGCAGTGG + Intronic
1154217204 18:12423851-12423873 GGCTCCCCTGCCCCAACCAGAGG + Intronic
1162497441 19:11031101-11031123 TACACTGCTTTCCCAATCAGAGG - Intronic
1162781571 19:13009658-13009680 GGCCCTGTTTTCCCAGCCAGGGG - Intronic
1164558863 19:29274777-29274799 GGCACTGCTGTAACCACCACAGG + Intergenic
1165319526 19:35076748-35076770 GGCACTGCTGTTCCACAAAGAGG - Intergenic
929648078 2:43649823-43649845 GGAACTGCTGTCCACATCAGTGG + Intronic
934779671 2:96961641-96961663 GGGTTTGCTGTCCCAAACAGTGG - Intronic
935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG + Intergenic
938427277 2:131202444-131202466 GTCTCTGCTGTCCAAGCCAGAGG - Intronic
940170236 2:150821494-150821516 TGAACTGCTGTCTTAACCAGTGG + Intergenic
941376461 2:164737302-164737324 GTCACCCCTTTCCCAACCAGGGG + Intronic
942220370 2:173763286-173763308 TACACTGCTCCCCCAACCAGCGG + Intergenic
948374960 2:237515365-237515387 GGCCCTGCTGTCCCCACTTGGGG + Intronic
948499366 2:238380515-238380537 TGCACTGCTGCCCGACCCAGTGG + Intronic
948844305 2:240675883-240675905 GGTCCTGCTGCCCCACCCAGAGG - Intergenic
948849553 2:240698996-240699018 GGTCCTGCTGCCCCACCCAGAGG + Intergenic
1168961817 20:1875274-1875296 GGGACTGCTGTCGCAAATAGAGG - Intergenic
1170950704 20:20933518-20933540 GGCACAGCTGCCTCAATCAGGGG - Intergenic
1172196479 20:33095265-33095287 GTCACTGCACTCCCAAGCAGGGG - Intronic
1173664305 20:44753965-44753987 AGCCTGGCTGTCCCAACCAGGGG - Intronic
1173691007 20:44960820-44960842 GGGAATGCTGTTCCAGCCAGAGG + Intergenic
1174177326 20:48653222-48653244 GGAGCTGCTGACCCAACAAGAGG - Intronic
1175549743 20:59809308-59809330 GGCAGGGCTGTCCCAACCGCTGG - Intronic
1175771556 20:61627670-61627692 GGCACTGCTGTCCCAACCAGGGG - Intronic
1175822246 20:61916560-61916582 GTCACTGCTGTCCCGAGCTGGGG + Intronic
1175902175 20:62364294-62364316 GGTCCGGCTGTCCCAGCCAGAGG - Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176308300 21:5135848-5135870 CACACTGCAGCCCCAACCAGGGG + Intronic
1179504831 21:41833416-41833438 GGCACTGGAGGCCCAAGCAGTGG - Intronic
1179505050 21:41834626-41834648 GGCACTGGAGGCCCAAGCAGTGG - Intronic
1179848760 21:44126184-44126206 CACACTGCAGCCCCAACCAGGGG - Intronic
1179994134 21:44966206-44966228 GGCGCCGCTGTCCCAGACAGCGG + Intronic
1182419769 22:30243282-30243304 GGCCCTGCTGTCTCACCCTGTGG + Exonic
1183469626 22:37998524-37998546 GGTCCTGCTGTCCCACCCTGGGG + Intronic
1183560537 22:38569710-38569732 CGCGCTGCTGCCCCCACCAGAGG - Intronic
951834965 3:26972895-26972917 GGCATGGCTGTGCCAGCCAGAGG + Intergenic
953792150 3:45955892-45955914 GGCACTGGGTTTCCAACCAGGGG + Intronic
954149741 3:48651463-48651485 GGCACTGCTGGTCCATCCTGGGG + Exonic
956630305 3:71310699-71310721 ATCGCTGCTGTCCAAACCAGGGG - Intronic
961682470 3:128608302-128608324 GGCGCTGCTGTTCCAAGCCGGGG - Intergenic
961710418 3:128824079-128824101 GGCTCTACTGTCCCCTCCAGAGG + Intergenic
967270726 3:187729868-187729890 GGCTCTGCTCTCACACCCAGGGG + Exonic
968293212 3:197555006-197555028 GGCGGTGCTGTCTCAACCAATGG - Intronic
968477465 4:818822-818844 GGCACTGCTGTCCTTGCCTGCGG - Intronic
968812476 4:2806212-2806234 GGCAGTCCTGCCCCACCCAGTGG - Intronic
968999655 4:3970030-3970052 GGCAATGCTGCCCCAAGAAGTGG + Intergenic
969618012 4:8265022-8265044 TGCACTGCTGTCCCCACCCGTGG + Intergenic
970184085 4:13430904-13430926 GTCACTGCTGGCCCATTCAGTGG - Intronic
975134535 4:70861775-70861797 GGGACTCCTGTCCCAGGCAGAGG + Intergenic
979254449 4:118597009-118597031 GGCACTGCGGATCCATCCAGAGG + Intergenic
985492892 5:189583-189605 GGCGCCGCCGTCCCAACCTGGGG - Exonic
986338410 5:6771063-6771085 AGCAGTCCTGCCCCAACCAGTGG - Intergenic
986721758 5:10564972-10564994 GGCACCGCGCTCCCAAACAGCGG - Intronic
987096304 5:14553579-14553601 GGCACTTCTGTCCCTACCAAAGG - Intergenic
988817108 5:34845396-34845418 GGCATAGCTCTCCCAACTAGGGG - Intronic
989413402 5:41145806-41145828 GGAACTGATGTCCTAACCAGAGG - Intronic
992029328 5:72705335-72705357 GGCAGCGATGTCCCAACCAAAGG + Intergenic
993882717 5:93381642-93381664 GGCACTGCTGCCCTAACCTCTGG + Intergenic
994355850 5:98793182-98793204 GGCATCGCTGTCCCCACCACTGG - Exonic
998880728 5:146642200-146642222 GGCACCGCTGTGCCAGGCAGTGG + Intronic
1001168524 5:169393741-169393763 TGCCCTCCTGTCCCACCCAGAGG - Intergenic
1002134395 5:177098864-177098886 GGCAGTCCTGTCCCAGCCTGAGG - Intergenic
1002681495 5:180968979-180969001 GGCACTGCAGACCCAAACAGTGG + Intergenic
1004300687 6:14454599-14454621 GTCACTGCTGTCCTGGCCAGGGG - Intergenic
1006332750 6:33404099-33404121 GGGACTGATGTCCCAACTAGAGG + Exonic
1007242531 6:40437354-40437376 GCCATTGCTGTCTCTACCAGAGG - Intronic
1007297651 6:40838660-40838682 AGCACTGCATTCCCAAGCAGGGG - Intergenic
1007732121 6:43953777-43953799 GGCACTTCAGTTCCAACCATGGG + Intergenic
1007958832 6:45940754-45940776 GCCACTGCAGTGCCAACCTGGGG - Intronic
1012393899 6:98773767-98773789 GGCTCTGCTGTACCTTCCAGTGG + Intergenic
1015603455 6:134932955-134932977 GGCCCTGGTGTCCCACCCAGAGG - Exonic
1016358099 6:143239501-143239523 GGGGCTGCTGTTCCAGCCAGTGG - Intronic
1018915984 6:168132652-168132674 GGAACTGCTGTCCCCACTCGGGG + Intergenic
1024470742 7:49766941-49766963 GGGACTGATTTCCCAACCTGTGG + Intergenic
1024627324 7:51219410-51219432 GTGGCTGCTGTCCCACCCAGGGG + Intronic
1025614412 7:63105840-63105862 GGCACGGCTGCCACTACCAGAGG - Intergenic
1026974652 7:74490006-74490028 AGCACTGCAGTCCAACCCAGGGG - Intronic
1032046929 7:128618961-128618983 GGCACTGCGGATCCATCCAGAGG + Intergenic
1032794054 7:135263475-135263497 GGCACTGGCATCCCAACAAGGGG + Intergenic
1034271084 7:149803703-149803725 GGAGTTGCTGTGCCAACCAGGGG + Intergenic
1034998579 7:155593910-155593932 GCCACTCCTGTACCAACCAGTGG + Intergenic
1036746205 8:11411907-11411929 GGCTCTGCTGTCAGAGCCAGAGG - Intronic
1038106346 8:24439368-24439390 GGCACTGCTGGCCAAGACAGAGG + Intergenic
1039956479 8:42210793-42210815 GCCACTGCTGATCCAACCGGAGG - Intergenic
1041548075 8:59069068-59069090 AGCACTGCTGTCCCAACTCCTGG - Intronic
1046224344 8:111258785-111258807 GGAACTGCTTTCCAAACCTGGGG - Intergenic
1048340769 8:133537009-133537031 GGCACTGATCTCTCAACCTGTGG - Intronic
1048846352 8:138606626-138606648 GGTAGTGCTGTCACAGCCAGGGG + Intronic
1049743412 8:144251901-144251923 AGCACTGCTGTGCTAAGCAGAGG - Intronic
1051464991 9:17367533-17367555 GCCACTGCTCTCCCAACCCTTGG + Intronic
1055698700 9:78917600-78917622 GGCAGAGCTGTCCAAACCATGGG + Intergenic
1059430974 9:114250197-114250219 GGTATTTCTGTCCCAGCCAGCGG + Intronic
1060934834 9:127508825-127508847 GGCACAGATGTTCCAAGCAGAGG + Intronic
1061290036 9:129645462-129645484 GGTGCTGCTGTCCCAAGCCGAGG - Intergenic
1061517472 9:131098031-131098053 GGCTCTGCTGACCTCACCAGCGG - Intronic
1061777592 9:132975973-132975995 GCCACTGCTCTCCCATCAAGGGG + Intronic
1061798622 9:133102585-133102607 GGCAGTGGTGTGACAACCAGGGG + Intronic
1061799212 9:133105016-133105038 GGCTCTTCTGTCCTAGCCAGAGG + Intronic