ID: 1175775339 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:61649636-61649658 |
Sequence | GGAGCGCGCGTGGCTGAACG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1175775331_1175775339 | 13 | Left | 1175775331 | 20:61649600-61649622 | CCTGCAGGAAGAGACTTGTAGGC | No data | ||
Right | 1175775339 | 20:61649636-61649658 | GGAGCGCGCGTGGCTGAACGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1175775339 | Original CRISPR | GGAGCGCGCGTGGCTGAACG GGG | Intronic | ||