ID: 1175775339

View in Genome Browser
Species Human (GRCh38)
Location 20:61649636-61649658
Sequence GGAGCGCGCGTGGCTGAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175775331_1175775339 13 Left 1175775331 20:61649600-61649622 CCTGCAGGAAGAGACTTGTAGGC No data
Right 1175775339 20:61649636-61649658 GGAGCGCGCGTGGCTGAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175775339 Original CRISPR GGAGCGCGCGTGGCTGAACG GGG Intronic