ID: 1175776359

View in Genome Browser
Species Human (GRCh38)
Location 20:61656275-61656297
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 3, 1: 0, 2: 4, 3: 37, 4: 440}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900116869 1:1032813-1032835 GGGTGGCCAGGGGTGTGCGGGGG + Intronic
900119821 1:1043777-1043799 GGGTCGGCAGGCCCAGGCTGAGG - Intronic
900154194 1:1197574-1197596 GGGTGGGCAGGGGCGGCCAGCGG - Exonic
900158593 1:1213115-1213137 GGGTGGTCAGGTGGGGGCTGTGG + Intronic
900172164 1:1274360-1274382 GGCTGGGCAGGCACCTGCAGGGG - Intergenic
900238885 1:1605445-1605467 GGGTGGTCAGGCGTGGGGTGGGG + Intergenic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900623364 1:3597276-3597298 GGGTGGGCAGGCGGATCCTGGGG - Intronic
900646303 1:3710207-3710229 GGGTGGGGGGGCGCGAACTGGGG + Intronic
900935143 1:5760317-5760339 GGGTGGGCAGGGGCGAGAAGTGG - Intergenic
901018062 1:6242782-6242804 GGGTAGGCGGGGGCGGGCTGGGG + Intergenic
901392611 1:8956872-8956894 GGGCGGGAAGGAGCGTGCTGGGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
902580339 1:17403980-17404002 GGGTGGGTGGGAGAGTGCTGGGG + Intergenic
902734437 1:18390840-18390862 GGGGGGGCACCCGCGTGTTGAGG + Intergenic
902884735 1:19396476-19396498 GCGTGGGCTGCCGCCTGCTGTGG + Intronic
903450826 1:23452630-23452652 GGGTGGGCAGGAGACTGTTGGGG - Intronic
905390118 1:37630799-37630821 GCGTGGGCAGGCCGCTGCTGTGG - Intronic
905775261 1:40664222-40664244 GGGTTGGCAGGGATGTGCTGGGG - Intronic
906411833 1:45584679-45584701 GGGTGGGCGGGGCCTTGCTGAGG + Intronic
906535788 1:46550359-46550381 GGGTGGGGAGGAACATGCTGAGG - Intronic
907304576 1:53506591-53506613 GGATGGGCAGGCGCATGTGGGGG + Exonic
907351440 1:53834965-53834987 GGGCGTGGTGGCGCGTGCTGAGG + Intronic
907451457 1:54548176-54548198 TGGTGGGCGGGCGGGAGCTGGGG + Intronic
907939235 1:59071459-59071481 GGGTGTGCAGCCTCCTGCTGTGG - Intergenic
914050293 1:144125556-144125578 GGGTGGGCAGGGGCTGGCTCTGG + Intergenic
914128889 1:144839889-144839911 GGGTGGGCAGGGGCTGGCTCTGG - Intergenic
915740194 1:158113437-158113459 GGCTCGGCAGGCGCGGGCGGCGG + Intergenic
919756285 1:201068054-201068076 GGGTGAGCAGTGACGTGCTGTGG + Intronic
919790890 1:201290306-201290328 GGGTGGGCAGATGCTTCCTGAGG + Intronic
920037300 1:203074754-203074776 GGGTGGGGAGGCCTGTGCAGAGG + Intronic
920146033 1:203861761-203861783 GGGTGCGAAGGCGCAGGCTGAGG + Intronic
921909037 1:220528117-220528139 GGGTGGGCGGGCGCCAGCCGAGG - Intergenic
922705512 1:227788286-227788308 GGGTGGGTAGGGGCGGGCGGAGG + Intergenic
922756823 1:228101677-228101699 GGTGGGGCAGGGGCGTGCTGTGG - Intronic
922766178 1:228157734-228157756 GGGCGGGCGGGCGGGTCCTGTGG - Exonic
923333951 1:232950783-232950805 GGGTGGGGGCGCGCGGGCTGCGG + Intronic
923338276 1:232987942-232987964 GGGAGGGCAGCCCCGTCCTGCGG - Intronic
924235482 1:241996389-241996411 GGATGGGCAGGAGGGTGGTGAGG + Intronic
924524575 1:244835199-244835221 CGGTGGGCTGGGGCGGGCTGGGG + Intergenic
1062772748 10:116022-116044 GGGTGGGCAGGGGGGTGGAGAGG - Intergenic
1064011874 10:11742333-11742355 GGGCGGGGAGGGGCGTGCCGGGG + Intergenic
1065093179 10:22253760-22253782 GGGTGGGCAGGCGCCGCCCGTGG - Intergenic
1069495584 10:68900912-68900934 GCGTGGGCAGGCCCATGCCGAGG - Intergenic
1070128359 10:73639817-73639839 TGGTGGGAAGGCGGGTGATGGGG - Intronic
1071950361 10:90696956-90696978 GGGTGTGGAGGCGCCTGCTGTGG + Intergenic
1072629302 10:97134521-97134543 GGGTGGGCAGGTGGGCTCTGAGG - Intronic
1073001444 10:100288966-100288988 GGGTGGGCAGGAGAGTGGTGAGG - Exonic
1073030181 10:100519648-100519670 GGCAGGGCAGGCGCGGGCCGGGG + Intronic
1073325913 10:102643985-102644007 GGCTGGCCGGGCGCGGGCTGCGG - Intergenic
1073444692 10:103573747-103573769 GGGTGGGCAGGTGAGGGCAGTGG + Intronic
1073771216 10:106737683-106737705 GGGTGGGTAGGGGAGTGCAGTGG - Intronic
1074516936 10:114179254-114179276 GAGTGCGCAGGCGTGCGCTGAGG + Exonic
1075054541 10:119207650-119207672 GGGTGGGGGGGAGCGTGTTGAGG + Exonic
1075206408 10:120453176-120453198 GGGTGGGGTGGCGGGTGGTGGGG + Intergenic
1075576105 10:123578689-123578711 GGGTAGGGAGGAGGGTGCTGAGG - Intergenic
1076119035 10:127921420-127921442 GGGTGGGAAGAGGCGTCCTGTGG + Intronic
1076381501 10:130027264-130027286 TGGTGGGCAGGCGCGTGGGTCGG - Intergenic
1076732802 10:132446824-132446846 GGGTGCCCAGGCCCCTGCTGTGG - Intronic
1076809763 10:132880383-132880405 GGGTGGCCAAGGGCCTGCTGAGG + Intronic
1077095716 11:798231-798253 GGGCGGGCAGGCGAGCGCGGCGG - Exonic
1077177217 11:1196382-1196404 GGCTGGGCAGGTGAATGCTGTGG - Intronic
1077191077 11:1256150-1256172 GGGTGGGCAGGTGAGGTCTGTGG - Exonic
1077226033 11:1439530-1439552 GGGAGGGCAGGGGAGTGCGGGGG + Intronic
1077580899 11:3416625-3416647 GTGTGGACAGCCTCGTGCTGGGG + Intergenic
1082997213 11:59263754-59263776 GGGAGGCCAGGCGCAGGCTGTGG - Intergenic
1083316325 11:61816794-61816816 GGGCTGTCAGGCGCGTGCTCGGG + Exonic
1083758390 11:64803173-64803195 AGGCGGGCGGGCGCGAGCTGCGG + Exonic
1084209244 11:67613419-67613441 GGGTAGGCAGGCGGGAGGTGAGG - Intergenic
1084237826 11:67799459-67799481 GTGTGGACAGCCTCGTGCTGGGG + Intergenic
1084273660 11:68041396-68041418 GGGTGGGCAGGCGTGGGAAGGGG + Intronic
1084303293 11:68265106-68265128 GGGTGGGCAGGCAGGTGGAGAGG + Intronic
1084517257 11:69643664-69643686 GGGAGGGCTGGCGAATGCTGGGG - Intronic
1084834582 11:71793374-71793396 GTGTGGACAGCCTCGTGCTGGGG - Exonic
1088808636 11:113374194-113374216 GGGTGGGCATGAGCGTGTGGAGG + Intronic
1089138460 11:116267987-116268009 GAGTGGGCAGGGGTGTGGTGTGG - Intergenic
1089497156 11:118913667-118913689 GGGTGGGCGGGGGTGGGCTGTGG - Intronic
1089646989 11:119886848-119886870 AGGTGGGCAGGGGAGTGCCGGGG + Intergenic
1090796515 11:130140279-130140301 GCGTGGGGAGGTGCGTGTTGAGG + Intronic
1090806371 11:130204874-130204896 GGGTGGGCACGCGAGTGATGTGG + Intronic
1091281366 11:134383582-134383604 GGGTGCGGAGGCGCGCGCAGGGG - Intronic
1091495638 12:970201-970223 GGTGGGGCAGGGGGGTGCTGAGG + Intronic
1091550036 12:1530241-1530263 TGGTGGGCAGGAGCGAGCCGGGG + Intronic
1092146089 12:6215667-6215689 GGTTGGTCAGGCGCATCCTGGGG - Intronic
1092408499 12:8237056-8237078 GTGTGGACAGCCTCGTGCTGGGG + Intergenic
1094498744 12:31005496-31005518 GGGTGGGCTGGGGTGTGCTCTGG - Intergenic
1096674389 12:53218799-53218821 GGGTGGGAAGGGGCGGGCAGCGG - Intronic
1096843300 12:54391632-54391654 GGGTGGGCAGGGGAGTGGGGGGG + Intergenic
1097165951 12:57087052-57087074 GAGTGGGCAGGCCCCTTCTGCGG + Intronic
1097180091 12:57166924-57166946 GGGGGGGCAGGTGCGGGCTGGGG - Exonic
1097262049 12:57725742-57725764 GGGCGGGCAGGGGCGTGGGGAGG - Intronic
1097326931 12:58287902-58287924 GAGTGGGCAGCAGCATGCTGAGG + Intergenic
1098343610 12:69476725-69476747 GGGTGGGCAGGCGGCTGTGGGGG + Intronic
1099989882 12:89709757-89709779 GGGTGGCCAGGCGCGCGGGGAGG + Intergenic
1101284956 12:103302174-103302196 GGTTGGGCGGGGGGGTGCTGAGG + Exonic
1101768928 12:107730409-107730431 GGGTGAGGAGGCAGGTGCTGGGG + Intergenic
1102887637 12:116533818-116533840 GGGTGGGGAGGTGGGAGCTGGGG + Intergenic
1103778684 12:123384676-123384698 GGGAGGAAAGGCGCCTGCTGCGG - Intronic
1104756018 12:131269732-131269754 GTGTGGGCTGGTGCATGCTGGGG + Intergenic
1105580737 13:21693372-21693394 GGGTGGACATGGGGGTGCTGAGG + Intronic
1106264824 13:28100530-28100552 GGCTGGGCCGGCGCGGCCTGGGG - Exonic
1106340127 13:28819830-28819852 GGGCGGGCAGGCGCGCGCGCAGG + Intergenic
1109944109 13:69408760-69408782 TGGTGGGAAGGTGTGTGCTGAGG - Intergenic
1112440778 13:99423249-99423271 GGGTGGGGAGGGGCATGGTGGGG - Intergenic
1113442633 13:110341048-110341070 GGGTGGGGAGGGGTGTGCTGGGG + Intronic
1113720513 13:112552739-112552761 TGGTGGGGAGGAGTGTGCTGTGG - Intronic
1113720532 13:112552828-112552850 TGGTGGGGAGGAGTGTGCTGTGG - Intronic
1113720551 13:112552917-112552939 TGGTGGGGAGGAGTGTGCTGTGG - Intronic
1113946792 13:114048871-114048893 GGGTGGGCTGGGGAGGGCTGAGG + Intronic
1114635767 14:24186000-24186022 GAATGGGCAGGCTCTTGCTGGGG - Intronic
1115868701 14:37776811-37776833 GGTTGGGCGGGGGCGGGCTGAGG + Intronic
1117162274 14:53001393-53001415 GGGTGGGGAGGGGCGTGTCGGGG + Intergenic
1118265954 14:64294979-64295001 GGGTGGGCAGGTGCCTCCAGCGG - Intronic
1119049247 14:71350013-71350035 GGGAGGGCAGGCAGGTGCTGAGG + Intronic
1119539318 14:75428255-75428277 GGGTGCGAGGGCGCGCGCTGGGG + Intronic
1120360441 14:83494312-83494334 AGGTGGGTTGGCCCGTGCTGGGG - Intergenic
1120993387 14:90397634-90397656 GGGTGGGGAGGGGCGGGCCGGGG - Intronic
1121323197 14:93004801-93004823 GGCTGGGGAGGAGCCTGCTGAGG + Intronic
1121566562 14:94914503-94914525 GGATGGGCAGGTGTGTGGTGTGG - Intergenic
1122410866 14:101525572-101525594 GGGTGGGCAGGAGCTGGCGGGGG + Intergenic
1122597972 14:102906778-102906800 GGGTGGGCGGGTGACTGCTGAGG + Exonic
1122620824 14:103056928-103056950 GCGTGGGGATGCGCGGGCTGGGG + Intronic
1122810091 14:104283468-104283490 GGGTGGTCAGGCCAGTGCTGAGG + Intergenic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1123055494 14:105567418-105567440 GGGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055614 14:105567938-105567960 GGGTGGACAGGTGTGTGGTGTGG + Intergenic
1123079953 14:105687275-105687297 GGGTGGACAGGTGTGTGGTGTGG + Intergenic
1123445694 15:20328667-20328689 GGGTGGGCAGGGGCTGGCTCTGG - Intergenic
1123473755 15:20572492-20572514 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1123529391 15:21131401-21131423 GGGTGGGCAGGGGCTGGCTCTGG + Intergenic
1123531958 15:21151670-21151692 GAGTGGGGAGCTGCGTGCTGTGG - Intergenic
1123644254 15:22427861-22427883 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1123734055 15:23167503-23167525 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1124284558 15:28388814-28388836 GGGTGGGCAGGCAGGAGCAGGGG + Intronic
1124298139 15:28522800-28522822 GGGTGGGCAGGCAGGAGCAGGGG - Intronic
1124351325 15:28957706-28957728 TGGTGGGGAGGCGCGTGCCGAGG + Intronic
1125506512 15:40270768-40270790 GGGTGGGCAGGCAGGTGTGGGGG + Intronic
1125556087 15:40586249-40586271 GGGTGTGCTGGTGTGTGCTGCGG - Intergenic
1126093910 15:45074276-45074298 GGGTGGGCTGGGGCATGTTGGGG - Exonic
1126800838 15:52295475-52295497 GGGCGGGCGGGCGCGCGCTGGGG - Intronic
1128683683 15:69668662-69668684 GGGTGGGCAGGAGCCAGCTGGGG - Intergenic
1129038721 15:72666149-72666171 GGGTGGGCAGGCAGGGGCAGGGG + Intronic
1129211170 15:74071081-74071103 GGGTGGGCAGGCAGGGGCAGGGG - Intronic
1129399233 15:75270006-75270028 GGGTGGGCAGGCAGGGGCAGGGG + Intronic
1129402840 15:75294282-75294304 GGGTGGGCAGGCAGGGGCAGGGG + Intronic
1129476371 15:75786703-75786725 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1129728303 15:77915355-77915377 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130139174 15:81209275-81209297 GTGTGGGGAGGGGCGTCCTGGGG + Intronic
1130141395 15:81229279-81229301 GTGTGGGGAGGGGCGTCCTGGGG + Intronic
1130256600 15:82328746-82328768 GGGTGGGAAGGGGCAGGCTGAGG + Intergenic
1130259268 15:82343075-82343097 GGGTGGGCAGGCAGGAGCAGGGG - Intronic
1130269408 15:82436090-82436112 GGGTGGGCAGGCAGGAGCAGGGG + Intronic
1130276015 15:82476743-82476765 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130281996 15:82526107-82526129 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1130468375 15:84204134-84204156 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130473363 15:84242270-84242292 GGGTGGGCAGGCAGGAGCAGGGG + Intronic
1130480777 15:84356334-84356356 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1130485375 15:84395616-84395638 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1130490935 15:84431425-84431447 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130495891 15:84469408-84469430 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1130502519 15:84510224-84510246 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130590668 15:85208732-85208754 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130595643 15:85246849-85246871 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1130598351 15:85261242-85261264 GGGTGGGAAGGGGCAGGCTGAGG - Intergenic
1131382375 15:91974578-91974600 GGCAGGGTAGGCGTGTGCTGTGG + Intronic
1131473349 15:92714902-92714924 GGGCGGGCAGGCGCGTGTACCGG - Intronic
1131764796 15:95663860-95663882 GGGAGGGCAGGGGTGAGCTGAGG + Intergenic
1132184697 15:99792745-99792767 GGGTGGGCAGGCAGGGGCAGGGG + Intergenic
1132409080 15:101562907-101562929 GGGTGGGCGGGCTCATCCTGGGG - Intergenic
1132432286 15:101771909-101771931 GGGTGGGCAGGCAGGGGCAGGGG - Intergenic
1132601522 16:775120-775142 GGGTGGGCCGGAGCGTGTGGGGG - Exonic
1132697118 16:1206972-1206994 GTGGGGGCAGGGGCGTGTTGAGG - Intronic
1132855523 16:2042970-2042992 GGGTGGGGAGGGAGGTGCTGGGG - Intronic
1132973939 16:2702260-2702282 GCGGTGGCAGGCGCGTCCTGAGG + Intronic
1133142495 16:3757622-3757644 GGGTGTACAGGCGCTTACTGAGG - Intronic
1133209698 16:4256731-4256753 GGGGGGGCAGGGGGGTGCTGGGG + Intergenic
1133349461 16:5091879-5091901 GTGTGGACAGCCTCGTGCTGGGG + Exonic
1136067118 16:27766781-27766803 GGGTGGCCAGGCCTCTGCTGAGG + Intronic
1136349055 16:29695234-29695256 GGGAGGGGAGGGGTGTGCTGAGG - Intronic
1136625198 16:31458080-31458102 GGATGGGCAGGTGGGAGCTGTGG + Intronic
1136707753 16:32202875-32202897 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1136721050 16:32319941-32319963 GGGTGGGCAGGGGCTGGCTCTGG + Intergenic
1136760156 16:32726536-32726558 GGGGGGGCCGGCGCGGGGTGAGG + Intergenic
1136807948 16:33143850-33143872 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1136839431 16:33526227-33526249 GGGTGGGCAGGGGCTGGCTCTGG + Intergenic
1137534945 16:49313225-49313247 GGGGGGGCAGGGGCGTGGAGGGG - Intergenic
1138393291 16:56685341-56685363 GCATGGGCAGGAGCGTGATGTGG + Intronic
1138594542 16:58022795-58022817 GGGTGGGCAGGCTGGGCCTGAGG + Intergenic
1139214469 16:65113812-65113834 GGGTGGGCAGAGGGGTGCGGTGG - Intronic
1139534155 16:67561649-67561671 GGGTCCGCAGGCGCCTCCTGGGG + Intergenic
1139705442 16:68737726-68737748 GGGTGGGCTCGCGCGGGCGGTGG + Intronic
1139908597 16:70382784-70382806 AGGTGGGTAGGCCCGTGGTGTGG - Exonic
1139952756 16:70680073-70680095 GGGTGGGAAGGGGCCCGCTGGGG + Intronic
1140400389 16:74666540-74666562 GGCTGGGCAGGCGAGAGCTCGGG - Intronic
1141722245 16:85763010-85763032 TGGTGTGCAGGCCCCTGCTGGGG + Intergenic
1141877268 16:86834490-86834512 GGGTGGACAGGAACGTGCTGTGG + Intergenic
1142260851 16:89041903-89041925 GGGAGGCCAAGGGCGTGCTGAGG - Intergenic
1142260866 16:89041943-89041965 GGGAGGCCAAGGGCGTGCTGAGG - Intergenic
1142378959 16:89721235-89721257 GGGCGGGCAGGCGCCGGCGGAGG - Intronic
1203005382 16_KI270728v1_random:197829-197851 GGGTGGGCAGGGGCTGGCTCTGG - Intergenic
1203136932 16_KI270728v1_random:1733950-1733972 GGGTGGGCAGGGGCTGGCTCTGG - Intergenic
1203149595 16_KI270728v1_random:1826512-1826534 GGGTGGGCAGGGGCTGGCTCTGG + Intergenic
1142715628 17:1745464-1745486 GGGGGTGGGGGCGCGTGCTGAGG + Intronic
1143026654 17:3945152-3945174 GGGAGCGCAGGGGCGTGCTTAGG + Intronic
1143493143 17:7295116-7295138 GGGTGTGCAGGGCCGTCCTGTGG - Intergenic
1144038921 17:11391218-11391240 GGGTGGGCAGGAAGGTGATGGGG + Intronic
1145214872 17:21043420-21043442 GGGGAGGCGGGGGCGTGCTGCGG + Intronic
1145755926 17:27390032-27390054 GGGTGGGAAGGGGCCTCCTGGGG - Intergenic
1146955049 17:36932636-36932658 GGGGGGGCAGGGGCGTGGGGTGG - Intergenic
1147606023 17:41774128-41774150 GGGTGGTGAGGGGCCTGCTGAGG - Intronic
1147900473 17:43780152-43780174 GGGTGGGCAGGCACGGGGTGGGG - Intergenic
1148048729 17:44759107-44759129 GGGTGGGGAGGCGCCAGCTGCGG - Exonic
1148793188 17:50184986-50185008 GGGCGGGCAGGAGCGGGCTGAGG + Exonic
1150133380 17:62680996-62681018 GGGAGGGCAGGCCCGGGATGAGG + Intronic
1150961437 17:69916901-69916923 GGATGGGCAGACACATGCTGAGG + Intergenic
1151555262 17:74843292-74843314 GGGTGGGCAGGCATGGGCTGGGG + Exonic
1151766968 17:76137733-76137755 GGGTGGGCAGCAGGGTGCTGGGG + Exonic
1152604496 17:81282360-81282382 TGGTGAGCAGGCACGGGCTGTGG - Intronic
1152659761 17:81536804-81536826 GGGTGGGCACGCGGGAGCGGGGG + Intronic
1152715731 17:81899659-81899681 GTGAGGGGAGGCGCCTGCTGCGG + Intronic
1152879818 17:82808502-82808524 GGGCGGGGAGGCCCCTGCTGTGG + Intronic
1153006282 18:500820-500842 GCGAGGGCAGGCGCGGGCCGAGG - Intergenic
1153488864 18:5628896-5628918 GGGTGGCCTGGCTGGTGCTGCGG - Intronic
1154346497 18:13547642-13547664 GGGTGGGCAGCTCCTTGCTGTGG + Intronic
1155060423 18:22223503-22223525 GGGTGGGGCTGTGCGTGCTGGGG + Intergenic
1156088780 18:33440680-33440702 GGGTGGGCAGGCGCGGGTCCGGG - Exonic
1156707031 18:39895385-39895407 GGGTGGGCAGTGGGGTGCTGTGG + Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157484081 18:48074556-48074578 GTGTGGGCAGCTGTGTGCTGAGG + Intronic
1158012824 18:52748484-52748506 GGGTGGGCAGGAGTGTGTTTCGG + Intronic
1158437037 18:57441026-57441048 GGGTGGGCGGGAGCGGGCAGAGG + Intronic
1158878424 18:61753817-61753839 GGGTGTGGTGGCACGTGCTGTGG - Intergenic
1159695955 18:71556573-71556595 GGGTGGCGAGGAGGGTGCTGGGG + Intergenic
1160453529 18:78980407-78980429 GGCTGGGGAAGCGCGTGCGGCGG + Intronic
1160525067 18:79531013-79531035 GGGTGGGGAGGGGAATGCTGGGG - Intergenic
1160753583 19:746870-746892 GGGTGGGCAGGCGCCGGGAGGGG - Exonic
1160786410 19:901945-901967 GGGTCGGGAGGCGCCTCCTGGGG - Intronic
1160922817 19:1528742-1528764 GTGTGGGCAGGCGGGAGGTGTGG - Intronic
1160981529 19:1818658-1818680 AGGTGGGCAGGTGCGGGATGTGG - Intronic
1161066685 19:2242074-2242096 AGGTGTGCAGGGGCATGCTGAGG - Intronic
1161083925 19:2325273-2325295 GGGTGGGCTGGCCTCTGCTGGGG - Intronic
1161326756 19:3667868-3667890 GGGGGGGCAGGCCCCCGCTGGGG + Intronic
1161494929 19:4581506-4581528 GGGCGGGAGGGCGCGGGCTGGGG + Intergenic
1161613619 19:5257644-5257666 GGGTGGGCAGGCAGGTGGGGTGG + Intronic
1161977348 19:7613773-7613795 GGGGTGGTAGGAGCGTGCTGGGG - Intronic
1162435234 19:10654302-10654324 GGGCGGGCAGGCGCGCGCCGGGG - Exonic
1162578614 19:11514071-11514093 GTTTGGGCAGGCGCCTGGTGGGG - Exonic
1163091055 19:15020825-15020847 GTGTGGGCAGGAGAGTGCAGGGG - Intronic
1163634707 19:18432619-18432641 GGGTGGGCAGGCTTGGGGTGGGG + Intronic
1163655474 19:18543010-18543032 GGGGGAGCTGGCCCGTGCTGGGG - Intronic
1165142772 19:33712370-33712392 GGGTGGACAAGCGGGGGCTGTGG + Intronic
1165225050 19:34348952-34348974 GGGTGGGGTGGCGGGTGGTGGGG + Intronic
1165830866 19:38729554-38729576 GGGTGGGCAGGGAGGGGCTGGGG + Exonic
1166366468 19:42280820-42280842 GGGTTGGTCGGCGCGGGCTGAGG - Intronic
1166873995 19:45886233-45886255 CGGCGGGCAGACGCGGGCTGGGG + Intergenic
1167235019 19:48309076-48309098 GGGTGGGGAGGGGGGTGCGGTGG - Intronic
1167266353 19:48484836-48484858 GGGTGGGAAGGTGCAGGCTGCGG - Intergenic
1168337659 19:55605596-55605618 GGGCGGGCAGGCGGGCGGTGCGG + Intronic
1202689700 1_KI270712v1_random:78194-78216 GGGTGGGCAGGGGCTGGCTCTGG + Intergenic
926165600 2:10520897-10520919 GGGTGGGAAGGAGTGGGCTGAGG + Intergenic
926249865 2:11148599-11148621 GGGTGGGCATGGGCGTGGTCAGG - Intergenic
927652282 2:24919996-24920018 GGGCCGGCAGGCGCGGGCGGCGG + Intergenic
927751371 2:25673443-25673465 GGCTGGGCCGGAGCGTGCGGAGG - Exonic
929510120 2:42559809-42559831 GGGCGGGCAGGGGGGTGCGGTGG + Intronic
930075627 2:47403408-47403430 GGCCGGGACGGCGCGTGCTGGGG + Intronic
931463406 2:62467195-62467217 GGGTGGGGAGGCGTGGGCGGGGG - Intergenic
931716259 2:65031403-65031425 GTGTGGGCAAGCACCTGCTGCGG - Intergenic
932485855 2:72083939-72083961 GGGTGGGGAGGGGCAGGCTGCGG + Intergenic
932625163 2:73291624-73291646 GGGTGCGCACGTGCGTGGTGAGG + Exonic
933956720 2:87377828-87377850 GGGTGGGCAGGGGCTGGCTCTGG - Intergenic
934240864 2:90269855-90269877 GGGTGGGCAGGGGCTGGCTCTGG - Intergenic
934272329 2:91546904-91546926 GGGTGGGCAGGGGCTGGCTCTGG + Intergenic
936148371 2:109996815-109996837 GGGTGGGCAGGGGCTGGCTCTGG + Intergenic
936196306 2:110374553-110374575 GGGTGGGCAGGGGCTGGCTCTGG - Intergenic
936468734 2:112777854-112777876 GGGTGGGCAGGTGGGGGCTGTGG + Intronic
936512153 2:113157319-113157341 GGGCGGGGAGGGGCGGGCTGAGG - Intronic
937914629 2:127092840-127092862 GGGGGTGCAGGCGTGGGCTGTGG - Intronic
938065181 2:128278144-128278166 GGGCAGGCAGGCACGAGCTGAGG + Intronic
939736607 2:145854888-145854910 GGGTGTGGTGGCACGTGCTGTGG - Intergenic
946185493 2:217978556-217978578 GCGGGGGCAGGGGCGGGCTGGGG - Intronic
946369573 2:219272436-219272458 GAGTGGGCAGGTGAGGGCTGGGG + Intronic
946396812 2:219447573-219447595 GGGTGGGGAGGGGCGTTCTCAGG - Intronic
947801204 2:232929189-232929211 GGGTGGGTTGGAGCGTGCGGGGG - Intronic
948393422 2:237627871-237627893 GGCCGGGCAGGCGCGCGCCGGGG + Intronic
948454196 2:238097155-238097177 GGGAGGGCTGGGGCGGGCTGGGG + Intronic
948616617 2:239203226-239203248 GGGTGGGCACCCACTTGCTGGGG - Intronic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1172876813 20:38169484-38169506 GGGTGGGCAGGAGTGTGCCAGGG + Intergenic
1173872612 20:46351359-46351381 TGGTGGCCAGCCGCATGCTGAGG - Intronic
1175036183 20:56003808-56003830 GGGCAGGCAGCCTCGTGCTGAGG + Intronic
1175222499 20:57425493-57425515 GGGAGGGCAGGAGCGTGGTCAGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175776341 20:61656215-61656237 AGGCGGGCAGGCGCGTGCTGGGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776368 20:61656315-61656337 AAGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776377 20:61656355-61656377 AAGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776390 20:61656416-61656438 AGGTGGGCAGGTGCATGCTGGGG + Intronic
1175776399 20:61656456-61656478 GGGTGGACAGGTGCGTGTTGGGG + Intronic
1176409121 21:6438239-6438261 GGGGGTGCAGGGGCCTGCTGAGG - Intergenic
1179684614 21:43046561-43046583 GGGGGTGCAGGGGCCTGCTGAGG - Intergenic
1179826350 21:43968405-43968427 GGGGGAGTAGGCGGGTGCTGGGG + Intronic
1180551721 22:16546369-16546391 GGGTGGGCAGGGGCTGGCTCTGG - Intergenic
1180695409 22:17748741-17748763 GGGAGGGCAGGCGCCTCCTCCGG + Intronic
1180919681 22:19515051-19515073 GAGGGGCCAGGCGGGTGCTGTGG + Intronic
1181026505 22:20130763-20130785 GGGTGGGCAGGCCAGGGTTGTGG - Intronic
1181053020 22:20246555-20246577 GGGCAGGCAGGCGGCTGCTGAGG + Intronic
1181064583 22:20299464-20299486 GGGTGGACCGGCGTCTGCTGAGG + Intergenic
1181265123 22:21626629-21626651 GGGTGGGCAGGAGAGACCTGGGG - Intergenic
1181352285 22:22267554-22267576 GGGTGGGCAGGGGCTGGCTCTGG + Intergenic
1181581794 22:23832798-23832820 GGGTGGGCACAGGAGTGCTGGGG - Intronic
1182638707 22:31750006-31750028 GGCTGGGCAAGCGCGGGCCGCGG - Exonic
1183184223 22:36282581-36282603 AGGTGGGGAGAGGCGTGCTGCGG + Exonic
1183264462 22:36816833-36816855 GTGTGGGCAGAAGCGCGCTGGGG + Intronic
1183335599 22:37244225-37244247 GGCTGGTGAGGCGCCTGCTGAGG + Exonic
1183350322 22:37331203-37331225 GGGTGGGCAGGTGGGTGCAGAGG - Intergenic
1184091381 22:42294755-42294777 AGGTGGGCAGTGGCTTGCTGTGG + Intronic
1184377764 22:44125311-44125333 GAGTGGGCAGGCGCAGGGTGCGG - Intronic
1184640187 22:45866519-45866541 CGCGGGGCAGGCGGGTGCTGGGG + Intergenic
1184644063 22:45886566-45886588 GGGCGGGAAGGAGGGTGCTGGGG - Intergenic
1185173124 22:49304955-49304977 GGATGGGCAGCTGCGTGATGAGG - Intergenic
949549387 3:5099640-5099662 TGGTGGACAGGCGCAGGCTGGGG + Intergenic
949887050 3:8703955-8703977 TGGTGGGCATGTGAGTGCTGAGG - Intronic
950011983 3:9730831-9730853 GGGTTGGCAGGGATGTGCTGCGG - Intergenic
950433865 3:12967321-12967343 CGGTGGGCTGGCGCAGGCTGTGG - Intronic
950448970 3:13055027-13055049 GGGTGGACAGGAGCCTTCTGTGG - Intronic
950901497 3:16502335-16502357 GGCTGGGCAGTAGCGTGCAGTGG - Intronic
951558824 3:23945902-23945924 GGCTGGGCGGGCGCGTGACGCGG + Intronic
952392555 3:32892847-32892869 GGGTGGACATGCGTGTGCTGAGG + Exonic
954136296 3:48583661-48583683 GGGTGGGAGGCTGCGTGCTGGGG - Intronic
954372410 3:50175709-50175731 GGCTGGGCAGGGGCGGGCAGGGG + Intronic
954380304 3:50215705-50215727 GGGCGGGCAGGCAGGCGCTGAGG - Intronic
955856425 3:63278289-63278311 GGGTGGGCAGGGAAGAGCTGGGG - Exonic
956438886 3:69260628-69260650 AGGAGTGCAGGCGCGTGGTGCGG + Intronic
960569884 3:119175512-119175534 GGGTGGGCAGGCGGGTAGGGCGG - Intronic
960997666 3:123350551-123350573 GGGTGGGCAGGGGGCCGCTGAGG + Intronic
961301077 3:125922458-125922480 GTGTGGACAGCCTCGTGCTGGGG - Intergenic
961361035 3:126367337-126367359 GGGAGGGCAGGCTGGGGCTGGGG - Intergenic
961754909 3:129121819-129121841 GGGCGGGCGGGGGCGGGCTGGGG - Intronic
961887448 3:130105615-130105637 GTGTGGACAGCCTCGTGCTGGGG + Intronic
964376416 3:156052346-156052368 AGGTGTGCAGGTGCGTGGTGTGG + Intronic
964438238 3:156675505-156675527 GGGCGCCCAGGCGCCTGCTGAGG + Intronic
965384736 3:168032519-168032541 GGAAGGGCACGCGCGTGCTGAGG - Exonic
966678389 3:182613996-182614018 GGGAGGGCAGTGGGGTGCTGTGG - Intergenic
968628256 4:1637637-1637659 GGGTGGGCAGGGGTGGGCAGGGG + Intronic
968664181 4:1811667-1811689 GGGCTAGCAGGAGCGTGCTGGGG - Exonic
968883030 4:3310781-3310803 AGGTGGGCAGGCGCCTGCGGGGG + Intronic
968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG + Intergenic
968969162 4:3784500-3784522 GGGTGGGGAGGGGCTTGGTGGGG + Intergenic
968996571 4:3949533-3949555 GTGTGGACAGCCTCGTGCTGGGG + Intergenic
969059954 4:4426563-4426585 GGGTGGGAAGGAGGCTGCTGGGG - Intronic
969757427 4:9159149-9159171 GTGTGGACAGCCTCGTGCTGGGG - Intergenic
969817385 4:9696685-9696707 GTGTGGACAGCCTCGTGCTGGGG - Intergenic
970391763 4:15619052-15619074 GGTGGGGCAGGGGGGTGCTGAGG + Intronic
972312163 4:37891420-37891442 GGCGGGGCAGGGGCGTGCTGCGG - Intronic
972356554 4:38284534-38284556 GGGTGGGGTGGGGAGTGCTGTGG + Intergenic
973754882 4:54064675-54064697 GGGCGGGCGGGCGCGTGCGTGGG + Exonic
974540561 4:63228470-63228492 GGGTGGGAATGAGCTTGCTGAGG - Intergenic
975429097 4:74267489-74267511 GGGTGGGCAGGGGTGGGCGGTGG - Intronic
977693760 4:99946201-99946223 CGGCGGGCAGGCGGGTGCAGAGG + Intronic
979099805 4:116599736-116599758 GGGTGGGCAGGGAGGGGCTGGGG + Intergenic
980541494 4:134201689-134201711 GGGCGGCCAGGCGGGGGCTGGGG + Intronic
981504118 4:145481771-145481793 GGGCGGGCAGGCGAGTGCGCCGG + Intronic
982198012 4:152935795-152935817 GGGTGGTCTGGCGCGTGCGTCGG + Intergenic
982769002 4:159378468-159378490 AGGAGTGCAGGCGCGTGGTGTGG + Intergenic
983657765 4:170100124-170100146 GGGTGGGCTGGGGTGTGTTGGGG + Intergenic
984908325 4:184649586-184649608 CGGTGGGCGGGCGCCTCCTGGGG - Intergenic
985155456 4:186982998-186983020 GGGTGGGGAGGAGGGTGCAGGGG + Intergenic
985524878 5:396774-396796 GGGCGGGCAGGCGAATGCAGGGG - Intronic
985542822 5:494688-494710 GGGTGGGCAGGCGCCGGCACCGG - Intronic
985549078 5:524244-524266 GGGCGGGCTGGCGCGGGCCGGGG - Exonic
985588136 5:751356-751378 GGGTGGGCAGGGGCGGGCGTGGG + Intronic
985602807 5:843823-843845 GGGTGGGCAGGGGCGGGCGTGGG + Intronic
985638011 5:1049374-1049396 GGGTGCACTGGCGGGTGCTGGGG - Intergenic
985670292 5:1203396-1203418 GGGTGGACAGGTGCGGGCAGCGG + Intronic
985725106 5:1512004-1512026 GGGTGGGCTGGGTCCTGCTGAGG + Intronic
986255974 5:6101616-6101638 GGGTGGGAAGGTCCGTGCAGTGG - Intergenic
988532122 5:32037017-32037039 GGGCGGTGAGACGCGTGCTGAGG + Intronic
992837484 5:80654924-80654946 GGGCGGGAAGGCGGGAGCTGGGG - Exonic
994355645 5:98791479-98791501 GGGTGGGCAGGCGGGGGGAGGGG + Intronic
998369240 5:141650620-141650642 GGGTGGGGAGGATCCTGCTGGGG - Intronic
999379569 5:151110699-151110721 GGTTGGGGAGGCTGGTGCTGGGG + Intronic
1002093399 5:176817563-176817585 GGGTGGGGAGGGGCGGGGTGGGG - Intronic
1002394178 5:178940673-178940695 GGGCGGGCCAGCGTGTGCTGGGG - Intergenic
1002487612 5:179550523-179550545 GGGCGGGCGGGCGCGGGGTGGGG - Intergenic
1002697582 5:181100932-181100954 GGGTGGGCAGGGGAGGGGTGGGG - Intergenic
1002857977 6:1055136-1055158 GGGTGGGCTGTCCCGTCCTGCGG + Intergenic
1003015656 6:2465542-2465564 GGCTGGACAGGTACGTGCTGGGG - Intergenic
1003880398 6:10475366-10475388 GGGTGGGCTGGCTCTTGCTATGG - Intergenic
1005825214 6:29628104-29628126 GGGGGGGCGGGCGGGAGCTGGGG + Intronic
1013099405 6:106974611-106974633 TGGTGGCCAGGCTCGGGCTGGGG - Intronic
1013180116 6:107709995-107710017 GGGTAGGAAGCCGGGTGCTGTGG - Intronic
1013463884 6:110400325-110400347 GGGTGCGCAGGAGCGGGCCGGGG + Intronic
1017048913 6:150372382-150372404 GGGTGGGGTGGGGAGTGCTGAGG + Intronic
1017048943 6:150372508-150372530 GGGTGGGGTGGGGAGTGCTGAGG + Intronic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018669696 6:166168173-166168195 GGGCGGGCTGGGGCGGGCTGGGG - Intronic
1018937281 6:168281988-168282010 GTGTGGGCCAGCGAGTGCTGTGG + Intergenic
1018959980 6:168441266-168441288 GGCTGGGCGGGCGCGTGGAGGGG - Exonic
1019423107 7:960459-960481 GGGTCGGATGGCGGGTGCTGTGG + Intronic
1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG + Intergenic
1019521712 7:1463650-1463672 GGGTGGCAGGGCCCGTGCTGGGG + Intergenic
1021719255 7:23490454-23490476 GGGCGGGCGGGCGGGTGGTGTGG + Intergenic
1023824174 7:43997691-43997713 GCATGGGCAGGCAGGTGCTGGGG - Intergenic
1024520822 7:50303617-50303639 GGGTGGGCACTCGCATCCTGGGG + Intergenic
1027327924 7:77062742-77062764 GCATGGGCAGGCAGGTGCTGGGG + Intergenic
1029448275 7:100626907-100626929 GGGTGGGGAGGCGCGGGCTGGGG + Intronic
1029752439 7:102551020-102551042 GCATGGGCAGGCAGGTGCTGGGG - Intronic
1029770391 7:102650113-102650135 GCATGGGCAGGCAGGTGCTGGGG - Intronic
1032202831 7:129835096-129835118 GAGTGGGCAGGCATGTGCTTTGG + Intronic
1033448996 7:141446344-141446366 GGCTTGGCAGGCGAGTGATGGGG - Intronic
1034256206 7:149725942-149725964 GGGGGGCCAGGGGCCTGCTGGGG - Exonic
1034400393 7:150857958-150857980 GGGTGTGCAGGCGAGTGCCGTGG - Exonic
1034435047 7:151059529-151059551 GGGTGGGGAGGCGGGAGCGGGGG - Intronic
1034461266 7:151199298-151199320 GGGGGTGCAGGCGGGGGCTGGGG - Intronic
1035096728 7:156361890-156361912 GGGTGAGCAGGGGCGAGCTGAGG - Intergenic
1035300978 7:157896979-157897001 GGGTGGGGAGGTGGGTCCTGTGG - Intronic
1035618714 8:1022158-1022180 GGGTGGACAGTCCTGTGCTGAGG + Intergenic
1035619106 8:1024288-1024310 GGGTGGACAGTCCCGTGCCGAGG + Intergenic
1035619126 8:1024343-1024365 GGGTGGACAGTCCCGTGCCGAGG + Intergenic
1035619146 8:1024398-1024420 GGGTGGACAGTCCCGTGCCGAGG + Intergenic
1035632137 8:1116157-1116179 GGGTGCGCAGGCGTCAGCTGGGG + Intergenic
1035695443 8:1592131-1592153 GCCTGGGCGGGCGTGTGCTGGGG - Intronic
1036182747 8:6598820-6598842 GGGTGGCCAGGCTGGAGCTGCGG + Intronic
1036380666 8:8234477-8234499 GTGTGGACAGCCTCGTGCTGGGG - Intergenic
1036848902 8:12188157-12188179 GTGTGGACAGCCTCGTGCTGGGG + Intronic
1036870263 8:12430435-12430457 GTGTGGACAGCCTCGTGCTGGGG + Exonic
1037915353 8:22769599-22769621 GGGTGGGGAGGCGGGGCCTGGGG - Intronic
1038205022 8:25458072-25458094 AGGTGGGCGTGCGCGGGCTGGGG - Intronic
1041238381 8:55827644-55827666 GGGTGGGGGGCCGGGTGCTGTGG - Intergenic
1041804648 8:61836781-61836803 GGCTGGGCAGGCTTGTGCTGAGG + Intergenic
1042216322 8:66432413-66432435 GGGTGGGCAGGCGCGGCCGAGGG + Intronic
1044809885 8:96048973-96048995 CGGTGGGCAGGGGGGTGCTAAGG + Intergenic
1049010159 8:139881999-139882021 GGGTGGGCAAGGGGGTGGTGAGG + Intronic
1049176187 8:141194037-141194059 GGGTGGGCAGCCGAGGGCTGGGG + Exonic
1049203469 8:141352730-141352752 GGGTGGGGAGGCGCTGTCTGGGG - Intergenic
1049210228 8:141382982-141383004 GCATGGCCAGGCGCGTGCAGGGG - Intergenic
1049222530 8:141434503-141434525 GGGTGGGAGGGTGCGGGCTGCGG + Intergenic
1049366174 8:142237966-142237988 GCGTGGGCAGGCGGGTGGCGTGG - Intronic
1049545008 8:143226456-143226478 GATGGGGCAGGAGCGTGCTGCGG - Intergenic
1049683219 8:143929049-143929071 GGGTCGGCTGGGGGGTGCTGGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1051812825 9:21069611-21069633 GGATGGGCAGGAGAGGGCTGGGG - Intergenic
1051904957 9:22084561-22084583 GGGTGGGCAGGGGTGTGATATGG + Intergenic
1053159890 9:35806609-35806631 GGGTGGGGAGGCGAGTTCTCAGG - Intronic
1053175266 9:35917860-35917882 GGGTGGGCAGGGGTGAGGTGAGG - Intergenic
1053596273 9:39564792-39564814 GGGTGGGCAGCCGCAAGCAGTGG - Intergenic
1053854241 9:42321433-42321455 GGGTGGGCAGCCGCAAGCAGTGG - Intergenic
1054569982 9:66800225-66800247 GGGTGGGCAGCCGCAAGCAGTGG + Intergenic
1056992280 9:91423555-91423577 GGGCGGGCGGGCGCGGGGTGCGG - Intronic
1057214309 9:93219590-93219612 GGCTGGGCAGGCGCCTACTCAGG + Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1058995130 9:110292185-110292207 GCGTGGGCAGCCGGGGGCTGTGG - Intergenic
1059336187 9:113569792-113569814 GGGTGGGGAGGGGGGTGCTGTGG + Intronic
1059913941 9:119077640-119077662 GGATGGGCAATCGCTTGCTGAGG - Intergenic
1060172220 9:121471203-121471225 GGGTGGGCAGGGGTGGGATGTGG - Intergenic
1060666579 9:125435596-125435618 GGGTGGGCTGGTGGGGGCTGGGG - Intergenic
1060960731 9:127678888-127678910 GGGCAGGCAGGGCCGTGCTGGGG - Intronic
1061178091 9:129009301-129009323 GGGTGGGGAGGCGGGCTCTGTGG + Exonic
1061486691 9:130923914-130923936 GGCTGGGCAGGAACGTGCTGGGG - Intronic
1061589224 9:131588081-131588103 GGCTGAGCAGGCCCGGGCTGCGG + Intronic
1061955509 9:133959366-133959388 GGGTGGGCAGGAGCTTGGGGAGG - Intronic
1062566920 9:137167653-137167675 GGGCGGGCAGGCGCAGCCTGGGG - Intronic
1190302274 X:49063937-49063959 TGGAGGGTAGGCGCGGGCTGTGG - Exonic
1190726674 X:53194588-53194610 GTGTGGGCAGGTGCTGGCTGGGG - Exonic
1197723620 X:129761287-129761309 GGGTGGCCTGGGGAGTGCTGAGG - Intronic
1197837743 X:130713325-130713347 GGGTGGGCTGGCATGGGCTGAGG + Intronic
1198724992 X:139667621-139667643 GTGTGGGCAGGCTCATGCTCAGG + Intronic
1198833479 X:140776533-140776555 GGGTGGTCACGCGCGGGCTTGGG - Intergenic
1198945711 X:142011293-142011315 GGGTGGGGGGGCGGGCGCTGTGG + Intergenic
1201963513 Y:19707596-19707618 GTGTGGGCAGGTGCCAGCTGGGG - Exonic
1202367306 Y:24174173-24174195 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1202503475 Y:25495950-25495972 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic