ID: 1175776744

View in Genome Browser
Species Human (GRCh38)
Location 20:61658627-61658649
Sequence CTCCTGGGCCAGGACATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175776744_1175776750 1 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776750 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
1175776744_1175776751 2 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776751 20:61658652-61658674 CTCCTGTCTCAGCACCAGCTGGG No data
1175776744_1175776762 23 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776744_1175776757 15 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776757 20:61658665-61658687 ACCAGCTGGGGCCCGGGCTTGGG No data
1175776744_1175776754 8 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776754 20:61658658-61658680 TCTCAGCACCAGCTGGGGCCCGG No data
1175776744_1175776760 17 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776760 20:61658667-61658689 CAGCTGGGGCCCGGGCTTGGGGG No data
1175776744_1175776752 3 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776752 20:61658653-61658675 TCCTGTCTCAGCACCAGCTGGGG No data
1175776744_1175776756 14 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776756 20:61658664-61658686 CACCAGCTGGGGCCCGGGCTTGG No data
1175776744_1175776759 16 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776759 20:61658666-61658688 CCAGCTGGGGCCCGGGCTTGGGG No data
1175776744_1175776761 22 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776761 20:61658672-61658694 GGGGCCCGGGCTTGGGGGTCTGG No data
1175776744_1175776763 24 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776763 20:61658674-61658696 GGCCCGGGCTTGGGGGTCTGGGG No data
1175776744_1175776755 9 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776755 20:61658659-61658681 CTCAGCACCAGCTGGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175776744 Original CRISPR CTCCTGGGCCAGGACATGTA TGG (reversed) Intronic