ID: 1175776749

View in Genome Browser
Species Human (GRCh38)
Location 20:61658651-61658673
Sequence CCAGCTGGTGCTGAGACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175776749_1175776762 -1 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776749_1175776761 -2 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776761 20:61658672-61658694 GGGGCCCGGGCTTGGGGGTCTGG No data
1175776749_1175776759 -8 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776759 20:61658666-61658688 CCAGCTGGGGCCCGGGCTTGGGG No data
1175776749_1175776766 29 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data
1175776749_1175776756 -10 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776756 20:61658664-61658686 CACCAGCTGGGGCCCGGGCTTGG No data
1175776749_1175776760 -7 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776760 20:61658667-61658689 CAGCTGGGGCCCGGGCTTGGGGG No data
1175776749_1175776757 -9 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776757 20:61658665-61658687 ACCAGCTGGGGCCCGGGCTTGGG No data
1175776749_1175776763 0 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776763 20:61658674-61658696 GGCCCGGGCTTGGGGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175776749 Original CRISPR CCAGCTGGTGCTGAGACAGG AGG (reversed) Intronic