ID: 1175776753

View in Genome Browser
Species Human (GRCh38)
Location 20:61658654-61658676
Sequence GCCCCAGCTGGTGCTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175776753_1175776763 -3 Left 1175776753 20:61658654-61658676 CCTGTCTCAGCACCAGCTGGGGC No data
Right 1175776763 20:61658674-61658696 GGCCCGGGCTTGGGGGTCTGGGG No data
1175776753_1175776762 -4 Left 1175776753 20:61658654-61658676 CCTGTCTCAGCACCAGCTGGGGC No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776753_1175776760 -10 Left 1175776753 20:61658654-61658676 CCTGTCTCAGCACCAGCTGGGGC No data
Right 1175776760 20:61658667-61658689 CAGCTGGGGCCCGGGCTTGGGGG No data
1175776753_1175776766 26 Left 1175776753 20:61658654-61658676 CCTGTCTCAGCACCAGCTGGGGC No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data
1175776753_1175776761 -5 Left 1175776753 20:61658654-61658676 CCTGTCTCAGCACCAGCTGGGGC No data
Right 1175776761 20:61658672-61658694 GGGGCCCGGGCTTGGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175776753 Original CRISPR GCCCCAGCTGGTGCTGAGAC AGG (reversed) Intronic