ID: 1175776758

View in Genome Browser
Species Human (GRCh38)
Location 20:61658666-61658688
Sequence CCCCAAGCCCGGGCCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175776758_1175776767 22 Left 1175776758 20:61658666-61658688 CCAGCTGGGGCCCGGGCTTGGGG No data
Right 1175776767 20:61658711-61658733 GCCCAAGTACCCAGGAACAAAGG No data
1175776758_1175776766 14 Left 1175776758 20:61658666-61658688 CCAGCTGGGGCCCGGGCTTGGGG No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data
1175776758_1175776770 28 Left 1175776758 20:61658666-61658688 CCAGCTGGGGCCCGGGCTTGGGG No data
Right 1175776770 20:61658717-61658739 GTACCCAGGAACAAAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175776758 Original CRISPR CCCCAAGCCCGGGCCCCAGC TGG (reversed) Intronic