ID: 1175776762

View in Genome Browser
Species Human (GRCh38)
Location 20:61658673-61658695
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175776745_1175776762 13 Left 1175776745 20:61658637-61658659 CCTGGCCCAGGAGCCCTCCTGTC No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776743_1175776762 24 Left 1175776743 20:61658626-61658648 CCCATACATGTCCTGGCCCAGGA No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776744_1175776762 23 Left 1175776744 20:61658627-61658649 CCATACATGTCCTGGCCCAGGAG No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776740_1175776762 28 Left 1175776740 20:61658622-61658644 CCACCCCATACATGTCCTGGCCC No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776749_1175776762 -1 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776746_1175776762 8 Left 1175776746 20:61658642-61658664 CCCAGGAGCCCTCCTGTCTCAGC No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776748_1175776762 0 Left 1175776748 20:61658650-61658672 CCCTCCTGTCTCAGCACCAGCTG No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776741_1175776762 25 Left 1175776741 20:61658625-61658647 CCCCATACATGTCCTGGCCCAGG No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776753_1175776762 -4 Left 1175776753 20:61658654-61658676 CCTGTCTCAGCACCAGCTGGGGC No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data
1175776747_1175776762 7 Left 1175776747 20:61658643-61658665 CCAGGAGCCCTCCTGTCTCAGCA No data
Right 1175776762 20:61658673-61658695 GGGCCCGGGCTTGGGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type