ID: 1175776764

View in Genome Browser
Species Human (GRCh38)
Location 20:61658676-61658698
Sequence TGCCCCAGACCCCCAAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175776764_1175776767 12 Left 1175776764 20:61658676-61658698 CCCGGGCTTGGGGGTCTGGGGCA No data
Right 1175776767 20:61658711-61658733 GCCCAAGTACCCAGGAACAAAGG No data
1175776764_1175776766 4 Left 1175776764 20:61658676-61658698 CCCGGGCTTGGGGGTCTGGGGCA No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data
1175776764_1175776770 18 Left 1175776764 20:61658676-61658698 CCCGGGCTTGGGGGTCTGGGGCA No data
Right 1175776770 20:61658717-61658739 GTACCCAGGAACAAAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175776764 Original CRISPR TGCCCCAGACCCCCAAGCCC GGG (reversed) Intronic