ID: 1175776766

View in Genome Browser
Species Human (GRCh38)
Location 20:61658703-61658725
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175776758_1175776766 14 Left 1175776758 20:61658666-61658688 CCAGCTGGGGCCCGGGCTTGGGG No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data
1175776749_1175776766 29 Left 1175776749 20:61658651-61658673 CCTCCTGTCTCAGCACCAGCTGG No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data
1175776748_1175776766 30 Left 1175776748 20:61658650-61658672 CCCTCCTGTCTCAGCACCAGCTG No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data
1175776753_1175776766 26 Left 1175776753 20:61658654-61658676 CCTGTCTCAGCACCAGCTGGGGC No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data
1175776765_1175776766 3 Left 1175776765 20:61658677-61658699 CCGGGCTTGGGGGTCTGGGGCAG No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data
1175776764_1175776766 4 Left 1175776764 20:61658676-61658698 CCCGGGCTTGGGGGTCTGGGGCA No data
Right 1175776766 20:61658703-61658725 TGTCAAAAGCCCAAGTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type