ID: 1175776770

View in Genome Browser
Species Human (GRCh38)
Location 20:61658717-61658739
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175776765_1175776770 17 Left 1175776765 20:61658677-61658699 CCGGGCTTGGGGGTCTGGGGCAG No data
Right 1175776770 20:61658717-61658739 GTACCCAGGAACAAAGGAACTGG No data
1175776764_1175776770 18 Left 1175776764 20:61658676-61658698 CCCGGGCTTGGGGGTCTGGGGCA No data
Right 1175776770 20:61658717-61658739 GTACCCAGGAACAAAGGAACTGG No data
1175776758_1175776770 28 Left 1175776758 20:61658666-61658688 CCAGCTGGGGCCCGGGCTTGGGG No data
Right 1175776770 20:61658717-61658739 GTACCCAGGAACAAAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type