ID: 1175777568

View in Genome Browser
Species Human (GRCh38)
Location 20:61662880-61662902
Sequence CAGGCCCAGGATCGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 231}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175777558_1175777568 9 Left 1175777558 20:61662848-61662870 CCATGTCCGCCTACAGGGTAGAG 0: 1
1: 0
2: 0
3: 0
4: 91
Right 1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG 0: 1
1: 0
2: 3
3: 24
4: 231
1175777555_1175777568 16 Left 1175777555 20:61662841-61662863 CCTATCTCCATGTCCGCCTACAG 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG 0: 1
1: 0
2: 3
3: 24
4: 231
1175777551_1175777568 25 Left 1175777551 20:61662832-61662854 CCCTGCCCTCCTATCTCCATGTC 0: 1
1: 0
2: 4
3: 35
4: 446
Right 1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG 0: 1
1: 0
2: 3
3: 24
4: 231
1175777554_1175777568 19 Left 1175777554 20:61662838-61662860 CCTCCTATCTCCATGTCCGCCTA 0: 1
1: 0
2: 1
3: 3
4: 108
Right 1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG 0: 1
1: 0
2: 3
3: 24
4: 231
1175777562_1175777568 0 Left 1175777562 20:61662857-61662879 CCTACAGGGTAGAGCCGGTGGTG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG 0: 1
1: 0
2: 3
3: 24
4: 231
1175777560_1175777568 3 Left 1175777560 20:61662854-61662876 CCGCCTACAGGGTAGAGCCGGTG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG 0: 1
1: 0
2: 3
3: 24
4: 231
1175777553_1175777568 20 Left 1175777553 20:61662837-61662859 CCCTCCTATCTCCATGTCCGCCT 0: 1
1: 0
2: 1
3: 10
4: 244
Right 1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG 0: 1
1: 0
2: 3
3: 24
4: 231
1175777552_1175777568 24 Left 1175777552 20:61662833-61662855 CCTGCCCTCCTATCTCCATGTCC 0: 1
1: 1
2: 5
3: 53
4: 527
Right 1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG 0: 1
1: 0
2: 3
3: 24
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175777568 Original CRISPR CAGGCCCAGGATCGGGACAC AGG Intronic
900228879 1:1545987-1546009 CAGTCCCAGGAAGGGGCCACAGG + Intronic
900600494 1:3500793-3500815 CAGGCCCAAGCGCGGGCCACGGG + Intronic
900946053 1:5832019-5832041 CAGGCCCAAGGTCTGGACCCGGG - Intergenic
901014358 1:6219444-6219466 CAGGCACAAGACTGGGACACTGG + Exonic
901209781 1:7518351-7518373 CAGGCCCAGGATGGAGAGGCCGG - Intronic
901633276 1:10658242-10658264 CAGGCCCTGCGTCGGGACCCCGG + Intronic
902814984 1:18911250-18911272 CAGGCGCAGGATCGGGAGTCAGG - Intronic
905817933 1:40966363-40966385 CAGGCCCAGAATTGGGAAAGAGG - Intergenic
910910550 1:92229491-92229513 CAGGTCCAGAATGGGGACAAGGG - Intronic
912467928 1:109886707-109886729 CAGTCCCAGGTTCTGGAAACTGG + Intergenic
912549086 1:110472939-110472961 CAGGCCCAGGATTCAGACTCAGG - Intergenic
912746638 1:112250663-112250685 CAGGCCCAGGCTCAGGAAATGGG - Intergenic
913479568 1:119274712-119274734 CAAGCCCAAGAATGGGACACAGG - Intergenic
914511051 1:148332360-148332382 CAGTCCCTGGATGGGGCCACAGG - Intergenic
914980489 1:152410603-152410625 CAGACCCAGGGTCAGGCCACTGG - Exonic
915443621 1:155962073-155962095 CAGGCCCAGGAGAGGGCCACTGG - Intronic
915885007 1:159713041-159713063 CAGTCTCAGAATCAGGACACTGG - Exonic
919690456 1:200524080-200524102 CATGCCCAGCAAGGGGACACTGG - Intergenic
920666047 1:207963659-207963681 CAGGCGCAGGCTCGGGAAGCCGG + Intergenic
922194153 1:223345417-223345439 CAGGGCCTGGATCTGGACCCTGG - Intronic
924820135 1:247481579-247481601 CAGGTCCATCATCTGGACACAGG - Intergenic
1062882322 10:988633-988655 CAGGCCCAGGAGCGGGGGATGGG - Intronic
1064012039 10:11742867-11742889 CAGGCCCGGGTCCGGGACACGGG - Intronic
1064145123 10:12820876-12820898 CAGGGCCAGGATGGGAACCCAGG + Intronic
1066226689 10:33390134-33390156 CAGGCACAGAATCTGGAGACAGG + Intergenic
1069708241 10:70472681-70472703 GAGTCCCAGGCTCTGGACACTGG - Intergenic
1070594305 10:77821492-77821514 CAGGCCCAGGACCTGGAAGCAGG + Exonic
1070959638 10:80489595-80489617 CACTCCCAGGATCGGAACAGGGG - Intronic
1073289289 10:102405406-102405428 CAGCCCCAGGCTCGGGAGTCAGG + Exonic
1074276182 10:112004690-112004712 CAGGCATAGGATCAGGAAACAGG + Intergenic
1074468652 10:113707020-113707042 GAGGACCAGGACCGAGACACAGG + Intronic
1076851638 10:133096165-133096187 CAGGCCCAGGAGGGGGCCTCGGG - Intronic
1077101691 11:825334-825356 CAGGCCCAGGAGTGCGACGCTGG - Exonic
1077199286 11:1297349-1297371 CAGGCCTTAGATGGGGACACAGG - Intronic
1078358015 11:10647240-10647262 CAGGCCCAGGATCTGGGCCCAGG - Intronic
1080689594 11:34545334-34545356 CAGGCCCAGGAAGGGGTCAGTGG + Intergenic
1081488101 11:43547342-43547364 CAGGTGCAGGATGGAGACACAGG + Intergenic
1082792317 11:57354922-57354944 CAGGGCCAGAAACAGGACACTGG + Intronic
1083158105 11:60837992-60838014 CAGGCCTAGGACTGGGACATGGG - Intergenic
1083419266 11:62544265-62544287 CAGGGCCAGGGGTGGGACACAGG - Intronic
1083725894 11:64627889-64627911 CAGGCCCAGGCCCGGGTCTCTGG - Intronic
1085255245 11:75168955-75168977 CAGGGCCAGGATTGGAACTCAGG - Intronic
1085332768 11:75667555-75667577 CAGGCCCAGGTCCAGGCCACCGG - Exonic
1090409171 11:126495787-126495809 CAGCCTGAGGATCAGGACACTGG + Intronic
1090665778 11:128914140-128914162 CAGGGTCAGAATCAGGACACAGG + Intronic
1093645476 12:21581285-21581307 CAGGCCCAGGATGTGGTCTCAGG - Intronic
1096691557 12:53325094-53325116 CCGGCCCCGGGTCGGGACGCCGG - Intergenic
1097352419 12:58562886-58562908 TAGGCACAGGATGGGGACACGGG + Intronic
1100398475 12:94205784-94205806 CTGGGCCAGGATGAGGACACAGG - Intronic
1102453175 12:113056469-113056491 CAGGCCCTGGACTGGGAGACTGG + Intergenic
1102520095 12:113472499-113472521 CAGGCCCAGGGTGGGGAGGCGGG + Intergenic
1103969335 12:124660247-124660269 GAGAGCCAGGATCTGGACACAGG - Intergenic
1105853306 13:24354918-24354940 CAGGCCCCGGGTGGGGACCCTGG + Intergenic
1106360832 13:29029139-29029161 CAGGCCCAGAGTCAGAACACAGG - Intronic
1112736846 13:102430508-102430530 TAGGCCCAGAATATGGACACAGG + Intergenic
1117298113 14:54397133-54397155 CCGGCCCAGGATCGGGTCCCCGG - Intronic
1117902544 14:60550617-60550639 CAGGCCCAGGACATGGTCACAGG + Intergenic
1119739558 14:77005329-77005351 CAGGCACAGGAACAGGGCACCGG + Intergenic
1120554821 14:85916567-85916589 GTAGCCCAGGATCTGGACACAGG + Intergenic
1121245746 14:92459851-92459873 CAGGGCCAGGAGCTGGATACAGG - Intronic
1122577333 14:102750693-102750715 CAGGGCCAGGAGCTGGGCACAGG + Intergenic
1122884034 14:104702655-104702677 CAGGCCCAGGCTGGGGAGACGGG - Intronic
1122903404 14:104791242-104791264 CAGGGCCAGGGTCGGGGCAGGGG + Intronic
1122970186 14:105149356-105149378 CAGGCCCAGGCCGGGAACACAGG + Intronic
1202929722 14_KI270725v1_random:26778-26800 CAGGACCAGGGTCAGGACAAGGG - Intergenic
1123422579 15:20144466-20144488 CAGGACCAGGGTCAGGACAAGGG + Intergenic
1123531807 15:21151006-21151028 CAGGACCAGGGTCAGGACAAGGG + Intergenic
1124441444 15:29688950-29688972 CAGGTCTACGATGGGGACACTGG + Intergenic
1125965604 15:43873370-43873392 CAGGCCAGGGATCTGGACAATGG - Exonic
1127857499 15:62964486-62964508 CAGGCCCTGCCTCGGTACACAGG - Intergenic
1128250862 15:66163558-66163580 CATGCCCAGGATGGGGAGCCAGG - Intronic
1128537699 15:68503261-68503283 AAGGGCCAGGATTGGGTCACAGG - Intergenic
1129450192 15:75647364-75647386 CAGAGCCAGGATCGGGAGATCGG - Intronic
1131510098 15:93045016-93045038 CAGGGCCAGGAGCGGGACGAGGG + Exonic
1132389907 15:101430944-101430966 CAGACCCAGGATAGGAACCCAGG + Intronic
1132630560 16:915278-915300 CAGGCACAGGATGGGGGCAGAGG + Intronic
1134049614 16:11128353-11128375 CAGGCCCAGGTTCTGGAGCCGGG - Intronic
1135503909 16:23020004-23020026 CAGGCCCAGGCTAGGATCACAGG + Intergenic
1135616095 16:23912416-23912438 CAGGGCAAGCATCAGGACACGGG - Intronic
1135943384 16:26842221-26842243 CAGGGTCTGGATTGGGACACAGG - Intergenic
1137780464 16:51094047-51094069 GAGGCCCAGGCTCAGGACAGGGG + Intergenic
1138191940 16:55020804-55020826 CTGGCACAGGATAGGGACCCTGG - Intergenic
1139699456 16:68698686-68698708 CAGGCCCAGGCCCAGGACACAGG - Exonic
1139901149 16:70329676-70329698 CAGGCCTGGGATGGGGACAGGGG - Intronic
1139905996 16:70366469-70366491 CAGGCCTGGGATGGGGACAAGGG - Intronic
1141098327 16:81178770-81178792 CAGAACCAGGATCCGGAAACAGG + Intergenic
1142272739 16:89099177-89099199 CCGCCCCAGGATGCGGACACAGG - Intronic
1203123667 16_KI270728v1_random:1559077-1559099 CAGGACCAGGGTCAGGACAAGGG - Intergenic
1142903615 17:3028046-3028068 CAGACCCAGGATTTGGACCCAGG - Intronic
1144660149 17:17062833-17062855 CAGGCCCAGGCTCTGGACATGGG + Intronic
1144849777 17:18238246-18238268 CAGGCCAAGGCACAGGACACAGG - Intronic
1145713516 17:26997227-26997249 CTGGCCCAGGACTGAGACACTGG + Intergenic
1147935987 17:44011442-44011464 CAGGCCCAGGAAGGGCACAGGGG - Exonic
1149444837 17:56705433-56705455 CAGGTCCAGAATCTTGACACTGG + Intergenic
1151321481 17:73355092-73355114 GAGGCCGAGGTTCGGGACCCCGG - Intronic
1151978645 17:77496659-77496681 CAAGCCCAAGCTCGGGACAGTGG - Intronic
1152227950 17:79101447-79101469 CAGCCCCAGGGCTGGGACACTGG + Intronic
1152279283 17:79375836-79375858 CAGGGCCAGGATTGGAACCCAGG - Intronic
1152641288 17:81450352-81450374 CGGGCCCAGGTTGGGGACTCAGG - Intronic
1154009202 18:10560899-10560921 CAGGGCCAGGAAAGGGACAAGGG - Intergenic
1156338525 18:36189831-36189853 CAGTCCAATGCTCGGGACACAGG - Intronic
1157555392 18:48610078-48610100 CAGGCCCAGAATGGGTAGACGGG - Intronic
1158128694 18:54129076-54129098 CCAGCCCAGGATCAGGACTCAGG + Intergenic
1158748678 18:60231952-60231974 CAGGACCAGGATCAGAACCCAGG - Intergenic
1159011899 18:63065867-63065889 CAGGCACAGGATGGGGAGAAAGG - Intergenic
1159868394 18:73732762-73732784 CAGACCCAGCTTCAGGACACAGG + Intergenic
1160419639 18:78735229-78735251 CAGGTCCAGGCCCGGGGCACCGG + Intergenic
1160785092 19:896615-896637 GAGGACCAGCATGGGGACACAGG + Exonic
1161030507 19:2055988-2056010 CAGGCCCAGGCTGGGGGCGCGGG + Intergenic
1161058940 19:2204819-2204841 CAGGGCCAGGCTGGGCACACAGG - Intronic
1161171299 19:2813697-2813719 CAGGCCCTGGATTGGGGCTCAGG + Exonic
1161342498 19:3750960-3750982 CAGGCCCAGGATGGGGCTCCGGG + Exonic
1161590304 19:5126465-5126487 CAGAGCCAGGATGGGGACCCAGG + Intronic
1162007719 19:7790539-7790561 CATGCCCAGAATCATGACACAGG - Intergenic
1163012306 19:14433625-14433647 CAGCCCCCGGAACGGGACTCGGG + Intronic
1163534149 19:17867356-17867378 CAAGCCCAGGAACGAGACCCAGG - Intergenic
1165334093 19:35156929-35156951 CAGGACCAGGATGGGGGCAGTGG + Intronic
1166117283 19:40663608-40663630 CACGCCCAGGATGGAGACTCTGG - Intergenic
1166137780 19:40787625-40787647 CAGGGCCAGGGTCAGGGCACAGG + Intronic
1166740353 19:45110982-45111004 CAGGGCCAGGCTCGGGAAAGGGG - Intronic
1166741919 19:45119711-45119733 CAGGCCCAGGATCAGACCACTGG + Intronic
1167290830 19:48624502-48624524 CAGGCCCGGGACTGGGGCACCGG + Intronic
1167762199 19:51456999-51457021 CAGGGACAGGATGGGGACAGGGG + Intronic
925239464 2:2311105-2311127 CAGACCCCGGATCTGAACACAGG + Intronic
925636747 2:5948280-5948302 CAAGGCCAGGATGGGAACACAGG - Intergenic
925886970 2:8401698-8401720 CAGTCCCAGCATAGGCACACAGG + Intergenic
929449860 2:42029709-42029731 CAGGGCCAGGATAGGAACCCAGG + Intergenic
929583523 2:43099647-43099669 CAGAGGCAGGATCAGGACACAGG - Intergenic
930157978 2:48125041-48125063 CAGGGCCAGAATCCAGACACAGG + Intergenic
934460621 2:94212336-94212358 CAGGACCAGGGTCAGGACAAGGG - Intergenic
935641734 2:105297334-105297356 CAGGCCCAGGGTGAGAACACAGG - Intronic
937904536 2:127046417-127046439 CAGGGCCAGGATCGGGGCTGGGG - Intergenic
946275640 2:218629668-218629690 TAGCCCCAGGATGGGGACACTGG + Intronic
947866153 2:233399378-233399400 CAGGCCCAGCATCTGGTCCCAGG - Intronic
948742464 2:240056828-240056850 CAGGCCCAGCAGCCGGTCACTGG + Intergenic
1168741994 20:199993-200015 CAGGCCCAGGATGGATACAGAGG + Intergenic
1172245439 20:33442824-33442846 CAGGCACAGGCTGGGGTCACAGG - Intronic
1172607333 20:36222789-36222811 CAGGGCCAGGAACGTGGCACTGG - Intronic
1173809528 20:45947693-45947715 GAGGCCAAGGACCGGGACTCGGG + Exonic
1173942289 20:46921565-46921587 CAGGCACAGGAACTGGACCCAGG + Intronic
1174058355 20:47815141-47815163 CAGTCCCGTGATGGGGACACTGG + Intergenic
1174075463 20:47932302-47932324 CAGGGCCAGGACTGGGACCCAGG - Intergenic
1174445046 20:50585353-50585375 CAGGCCCAGGCTCATGAGACTGG + Intergenic
1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG + Intronic
1175800636 20:61799485-61799507 CAGGCCCAGGCTCTGGGCACAGG - Intronic
1175967965 20:62669084-62669106 CAGGCCCAGGGAGGGGACAGAGG + Intronic
1176023097 20:62972694-62972716 GAGGCCCAGGAGCGGGACGCGGG + Intergenic
1176591744 21:8655377-8655399 CAGGACCAGGGTCAGGACAAGGG - Intergenic
1178850317 21:36207644-36207666 CACAACCAGGATCTGGACACGGG + Intronic
1179819824 21:43930293-43930315 CAGGCCCAGGACAGGGAACCGGG - Intronic
1180013176 21:45064806-45064828 CAGGCCCAGGAACAGGTCCCAGG - Intergenic
1180274591 22:10632489-10632511 CAGGACCAGGGTCAGGACAAGGG - Intergenic
1181355626 22:22294419-22294441 CAGGACCAGGGTCAGGACAAGGG + Intergenic
1181400501 22:22647792-22647814 CAGGACCAGGAAGGGGACTCTGG + Intronic
1181702480 22:24628890-24628912 CAGGACCAGGAAGGGGACTCTGG + Exonic
1182277912 22:29202062-29202084 CAGGGCCAGGGTCGGGGCGCTGG - Intergenic
1183107243 22:35623216-35623238 CAAGCCCAAGATTGGGACCCAGG + Intronic
1183736645 22:39648283-39648305 CAGGCCCGGCATGCGGACACAGG + Intronic
1184072255 22:42153340-42153362 CCGCCCCAGGATCGGGAGGCTGG - Intergenic
950452933 3:13075507-13075529 GAAGCCCAGGAAAGGGACACTGG - Intergenic
950716250 3:14849721-14849743 CAGGGCCAGGATCTGAACACAGG - Intronic
951976965 3:28521922-28521944 CAGGACCAGGATTGGGACACAGG - Intronic
952556218 3:34534309-34534331 CAGGCCCAGAATTGGGACACTGG + Intergenic
953033396 3:39192072-39192094 CAGGCCCAGGATCTGGAGGAAGG - Intronic
953958753 3:47251016-47251038 CAGATCCAGGATCTGGACACTGG - Intronic
954543938 3:51416809-51416831 CACTCCCAGGATCGGGTCATCGG - Exonic
954685212 3:52366572-52366594 CAGGCCCACTATCCGGACACTGG - Intronic
955374811 3:58386057-58386079 CAGTCCCAGGCTGGGGACCCAGG - Intronic
955403906 3:58613395-58613417 CAGGCCAAGGATCTTGGCACGGG - Intronic
955786821 3:62549998-62550020 CAGGCCATGTATCGGGCCACGGG - Exonic
961475664 3:127144902-127144924 CAGGACCAGGATGTGGATACAGG - Intergenic
964808078 3:160633387-160633409 AAGGCCCAGAGGCGGGACACTGG + Intergenic
968081271 3:195848198-195848220 TTCGCCCAGGATGGGGACACTGG - Intergenic
971343953 4:25795643-25795665 CAGACCCAGGACCTGGACCCAGG + Intronic
983009090 4:162522583-162522605 CAGCCCCAGGATGGGGACTGTGG + Intergenic
983989134 4:174097015-174097037 CAGGCCCTGAATGGGGATACAGG + Intergenic
986163293 5:5250578-5250600 CAGGCCCAGGAGCAGGACCCTGG + Intronic
986723686 5:10578499-10578521 CAGGACCCGCATGGGGACACAGG + Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995043829 5:107621267-107621289 CAGGCCCAGGGTTGGGAAGCCGG + Intronic
995761342 5:115565441-115565463 CAGGGCCAGGATCAGGGCCCTGG + Intergenic
999505289 5:152188319-152188341 TAGAGCCAGGATTGGGACACAGG + Intergenic
1000050740 5:157561041-157561063 CAGAGCCAGGATCTGAACACAGG + Intronic
1001518892 5:172376864-172376886 CAGGCCCAGGACTGGAACCCAGG + Intronic
1001806852 5:174594023-174594045 CAGGCCCTTCATCGGGAGACTGG + Intergenic
1002255971 5:177958824-177958846 CACGCCCAGGACGGGGCCACTGG + Intergenic
1004205822 6:13591468-13591490 CAGTCCCAGGATGGGGACGTAGG + Intronic
1012269559 6:97192012-97192034 CATGCACAGGATTGGGACTCAGG - Intronic
1018002821 6:159594727-159594749 CAGGCCGAGGAACGGGAGAGCGG + Intergenic
1018652380 6:166003040-166003062 CAGGCCAAGGCCCAGGACACAGG + Intergenic
1018668392 6:166160540-166160562 CAGAACCAGGATGGGGACCCTGG + Intronic
1019062592 6:169266772-169266794 CAGGCACAGGATCCAGTCACGGG - Intergenic
1019324697 7:432363-432385 GAGGCTCAGCCTCGGGACACAGG + Intergenic
1019347898 7:539593-539615 CAGGCCCAGGCTCCCTACACTGG + Intergenic
1019488729 7:1301292-1301314 GAGGCCCAGGTTCGGGGCAGGGG - Intergenic
1019667373 7:2258618-2258640 CAGGCCTAGGAAGGGGGCACAGG + Intronic
1019924123 7:4181204-4181226 GAGGGCAAGGATCTGGACACAGG - Intronic
1020456430 7:8378788-8378810 TATGCCCAGTATAGGGACACAGG + Intergenic
1023908057 7:44536175-44536197 CAGGGCCAGGATGGGGACACAGG + Intronic
1024479303 7:49847775-49847797 CAGGGCCAGGTTCCAGACACAGG - Intronic
1025190827 7:56894419-56894441 CAGGCCCTGGTTTGGGACAAAGG - Intergenic
1025681116 7:63682505-63682527 CAGGCCCTGGTTTGGGACAAAGG + Intergenic
1029151092 7:98480981-98481003 CTGACCCAGGATCAGGACCCAGG - Intergenic
1029353091 7:100029536-100029558 CAGAGCCAGGATGGGGACCCAGG - Intronic
1029666705 7:101999841-101999863 CAGGCCCTGGTTTGGGACAAAGG - Intronic
1031922867 7:127614251-127614273 CAGGCCCTGGAACAGAACACAGG - Intronic
1035762354 8:2078318-2078340 GAGGCCCAGGCTGGGGAAACAGG - Intronic
1037259643 8:16993575-16993597 ACGGACCAGGATGGGGACACGGG + Intronic
1037750783 8:21680810-21680832 CAGGCCCAGGCTCAGCACAGGGG + Intergenic
1037894497 8:22642768-22642790 CAGGGCCAGGATGGGGACCCAGG + Intronic
1039542342 8:38382354-38382376 CAGTCCCTGGTTCGGGACGCTGG + Intergenic
1040065481 8:43140921-43140943 GAGGCCGCGGATCGGGACGCCGG + Intronic
1041815210 8:61962727-61962749 CATGCCCAGGATTCTGACACGGG - Intergenic
1044722621 8:95165646-95165668 CAGGCCCAGGATGTGAACCCAGG + Intergenic
1045402613 8:101834278-101834300 CAGCCCCAGCAGGGGGACACCGG - Intronic
1047212647 8:122852514-122852536 CAGGCCCAGGATGTGAACTCAGG + Intronic
1047368887 8:124238529-124238551 CAGAGCCAGGGTTGGGACACAGG - Intergenic
1048378977 8:133847173-133847195 CAGGGCCAGGATTGGAACCCAGG + Intergenic
1048999292 8:139814448-139814470 CAGGCCCAGGAAAAGGACCCCGG + Intronic
1049181788 8:141226651-141226673 CAGGCCGAGGATGGAGAGACAGG + Intronic
1049204694 8:141358319-141358341 CAGGCCCTGGAACTGCACACTGG - Intronic
1049468523 8:142764659-142764681 CAGGCCCAGGCTGGGGATATCGG + Exonic
1049748798 8:144274011-144274033 CAGGCCCTGGATCCAGACCCAGG + Intronic
1049867162 8:144946630-144946652 CAGGCCCAACAGCAGGACACAGG - Intronic
1049867262 8:144947030-144947052 CAGGCCCAACAGCAGGACACAGG - Intronic
1049989999 9:981677-981699 CTGGCCCAGGACTGGGACCCTGG + Intronic
1050466555 9:5931279-5931301 GAGGCACAGGATGGGGAGACTGG + Intronic
1051896792 9:21995845-21995867 CAGGCTCCGGGTCGGGGCACCGG - Intronic
1053104582 9:35398928-35398950 CTGGGCCAGGTTCGGGGCACAGG + Exonic
1053691118 9:40588033-40588055 CAGGACCAGGGTCAGGACAAGGG - Intergenic
1054273686 9:63049458-63049480 CAGGACCAGGGTCAGGACAAGGG + Intergenic
1054302378 9:63389004-63389026 CAGGACCAGGGTCAGGACAAGGG - Intergenic
1054401148 9:64715498-64715520 CAGGACCAGGGTCAGGACAAGGG - Intergenic
1054434759 9:65199824-65199846 CAGGACCAGGGTCAGGACAAGGG - Intergenic
1054495630 9:65821857-65821879 CAGGACCAGGGTCAGGACAAGGG + Intergenic
1056659282 9:88533032-88533054 CAGGCACAGGAGCAGGACTCAGG + Intergenic
1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG + Intronic
1058539395 9:105995752-105995774 CAGGGCCAGGATGGGGACGCTGG + Intergenic
1059281340 9:113136634-113136656 CAGGCCCAGGCACTGGACACAGG + Intergenic
1061074037 9:128329977-128329999 CAGGCCCTGGATCAGGCTACTGG + Intronic
1061119683 9:128635276-128635298 CAGGGCCAGGATGGAGACAAGGG + Intronic
1061796284 9:133087542-133087564 CAGGCCCAGGAGTGGGAGTCAGG + Intergenic
1061879547 9:133561952-133561974 CAAACCCAGGATCAGGATACAGG + Intronic
1061885981 9:133591334-133591356 CAGGCCCAGCCTCAGGGCACTGG + Intergenic
1062149095 9:135008197-135008219 CAGTCCCAGAATAGGGACAGTGG - Intergenic
1062319651 9:135984521-135984543 CAGCCACAGGATGGGGACACGGG - Intergenic
1062419021 9:136470211-136470233 CAGCCGCAGGATCCGAACACAGG + Intronic
1062427663 9:136513313-136513335 GAGACACAGGATCGGGACCCAGG - Intronic
1062494492 9:136825396-136825418 CGTGCCCAGGATCGGGGCCCGGG + Intronic
1062494523 9:136825462-136825484 CGTGCCCAGGATCGGGGCCCTGG + Intronic
1062494539 9:136825495-136825517 CGTGCCCAGGATCGGGGCCCGGG + Intronic
1203790054 EBV:146426-146448 AAGGTCCAGGATCAGGACACTGG - Intergenic
1203621771 Un_KI270749v1:134141-134163 CAGGACCAGGGTCAGGACAAGGG - Intergenic
1185473697 X:400449-400471 CAGGCCCACGATCGAGTGACGGG - Intergenic
1192334765 X:70209045-70209067 CAGTCCCAGGATTGGGACAGAGG + Intergenic
1194901682 X:99520028-99520050 CAGGCACAGGAGCTGGGCACCGG + Intergenic
1197263584 X:124342377-124342399 CAGGCCCAGGATATGAACACAGG - Intronic
1197763977 X:130047431-130047453 CAGGCCCATGAGTGGCACACAGG - Intronic
1202583820 Y:26405239-26405261 CAGGACCAGGGTCAGGACAAGGG + Intergenic