ID: 1175777817

View in Genome Browser
Species Human (GRCh38)
Location 20:61664037-61664059
Sequence CAGCCCCCACACAATGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175777817_1175777821 4 Left 1175777817 20:61664037-61664059 CCAAGGGCATTGTGTGGGGGCTG 0: 1
1: 0
2: 2
3: 19
4: 237
Right 1175777821 20:61664064-61664086 GGCCTCAGTCAGTGCCAGAGAGG 0: 1
1: 0
2: 4
3: 33
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175777817 Original CRISPR CAGCCCCCACACAATGCCCT TGG (reversed) Intronic
900984730 1:6066658-6066680 CAGGCTCCACAAGATGCCCTGGG + Intronic
902203161 1:14848920-14848942 CAGCCCCCGCTCCATGCACTTGG - Intronic
902652189 1:17844202-17844224 CTGACCCCACCCACTGCCCTTGG - Intergenic
903285583 1:22274934-22274956 CAGCCCCCAGACAATTATCTGGG - Intergenic
903539687 1:24089958-24089980 CATCCCCCACACCCTGCACTGGG + Intronic
904520596 1:31092400-31092422 GAGCCACCACACCAAGCCCTTGG + Intergenic
906071346 1:43018962-43018984 CAGCCACCAAAGAAAGCCCTGGG + Intergenic
906196553 1:43933793-43933815 CGGCCCCCAGACAAGGCCCGGGG + Exonic
909001824 1:70226622-70226644 AACACCCAACACAATGCCCTGGG - Intronic
911317859 1:96376513-96376535 CAGCTCCCACACAATGCAAAAGG - Intergenic
915217604 1:154350476-154350498 CAGCCCCACCACAGGGCCCTGGG - Exonic
915915297 1:159937092-159937114 CCACCCCCACACACTGGCCTGGG + Intronic
919728953 1:200900848-200900870 CAGCCCTGACACAGTGCTCTAGG - Intronic
920936392 1:210439145-210439167 CAGCCCACAGAGAATGGCCTTGG + Intronic
1064622627 10:17230191-17230213 CTGTCCCCACACATTGCCCAAGG + Intronic
1065100511 10:22326085-22326107 CAGACGCCACACAATCCCCGCGG - Intronic
1065274659 10:24073819-24073841 CAGCACACAGACACTGCCCTAGG + Intronic
1067146434 10:43697432-43697454 CAGCCCCGACACAAGGAGCTAGG - Intergenic
1069255088 10:66322846-66322868 CTGCTCCCTCACAATGCCCTGGG - Intronic
1069869959 10:71527094-71527116 CAGCCCCACCCCAGTGCCCTAGG + Intronic
1070306866 10:75244949-75244971 CAGCCCCTACACCCTGCCCGTGG - Intergenic
1070383237 10:75900610-75900632 CAGCCCCCGCAGCATGCCCCTGG + Intronic
1070823860 10:79379753-79379775 CAGCTCCCGCACACAGCCCTGGG - Intergenic
1073696064 10:105869594-105869616 CATTCCCCAAACAATGCTCTAGG + Intergenic
1074219368 10:111421104-111421126 CTGCCACCACACCATGACCTTGG + Intergenic
1075439601 10:122469064-122469086 CAGCCACAACAATATGCCCTCGG - Intronic
1075534657 10:123260148-123260170 CAGCCAGCACAAAATGCGCTTGG + Intergenic
1075653497 10:124145792-124145814 GAGCTCCCACACAAGGCCCAAGG + Intergenic
1075786358 10:125052776-125052798 CAGCCCCAACACATTCCCATGGG + Intronic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1076752327 10:132549759-132549781 CAGCCCCCACTCTCTGCCCCTGG + Intronic
1076757154 10:132578628-132578650 CAGCCCCCGCACACTCTCCTGGG - Intronic
1077581914 11:3422567-3422589 CTGCCCCCGCGCACTGCCCTGGG - Intergenic
1078442174 11:11377247-11377269 CAGCTCCCAGTCAAAGCCCTGGG + Exonic
1084238825 11:67805384-67805406 CTGCCCCCGCCCACTGCCCTGGG - Intergenic
1084665084 11:70571930-70571952 CACCCCCAACACCATGCCATTGG - Intronic
1085325536 11:75603581-75603603 CCGCCCCCACTCACTGCCCCAGG - Intronic
1085525355 11:77160626-77160648 CACCCACCACACCAGGCCCTGGG + Intronic
1087174109 11:95080427-95080449 CAGCCCCCAAGGAATGCTCTAGG + Intergenic
1088569903 11:111213058-111213080 TAGCTCCCACACCATACCCTGGG + Intergenic
1089166875 11:116484151-116484173 CATGCCCTACACAATCCCCTTGG + Intergenic
1091590786 12:1841995-1842017 CAGCCCCGACAATATTCCCTGGG + Intronic
1091876074 12:3933936-3933958 CAGTCCCCACACCCTGCCCTTGG - Intergenic
1092023526 12:5222285-5222307 CCACCCCCACACACTGCCCCAGG + Intergenic
1092260903 12:6952832-6952854 CAGCCCCCAGCCCATGCCTTTGG - Intronic
1093955042 12:25207190-25207212 CAGTCACCACACAAGGCACTGGG - Intronic
1094045502 12:26161719-26161741 CATCCCCCACACCATGTCTTTGG - Intronic
1094829705 12:34294486-34294508 CAGCCCCAGCACAGTGCCCAGGG - Intergenic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1096115721 12:49053987-49054009 CAGCCCCCTCACTGTGCTCTGGG + Exonic
1096199740 12:49673129-49673151 CAGCCCCCACACTCAGCCCATGG + Intronic
1096979099 12:55718248-55718270 CAGCCCCCACACATTCCAGTGGG + Intronic
1097282062 12:57851133-57851155 CAGCCCCGATACTCTGCCCTGGG - Intergenic
1097624704 12:61985975-61985997 CAGCCCACAACCATTGCCCTTGG + Intronic
1098378626 12:69844377-69844399 CACCCGCCACACAATTCCCCAGG - Intronic
1099932197 12:89087424-89087446 CAGCTCACACACAATCCCATGGG - Intergenic
1102057945 12:109910802-109910824 CAGCCACCACCACATGCCCTCGG - Intronic
1102463483 12:113114729-113114751 CAGCCCCCAGACAAGGCTCCGGG + Intronic
1104035173 12:125092758-125092780 CAGCCCCCACAGAGGGCCCTAGG - Intronic
1104635348 12:130434985-130435007 CACCCCCCACACAGTGCTTTGGG + Intronic
1104745287 12:131206806-131206828 GAGCCCCCACCCTCTGCCCTTGG + Intergenic
1104789050 12:131470300-131470322 GAGCCCCCACCCTCTGCCCTTGG - Intergenic
1105918475 13:24939340-24939362 TAGCCCCAACACCATGCCATGGG - Intergenic
1106239964 13:27903689-27903711 CAGCCCTCCCTTAATGCCCTGGG - Intergenic
1108561597 13:51649367-51649389 CATCCCCCACATAAAGCCCTGGG - Intronic
1113682930 13:112256912-112256934 CCGCACCCACACCAGGCCCTGGG + Intergenic
1113930820 13:113967960-113967982 CCACCCCCAGACACTGCCCTTGG - Intergenic
1117885886 14:60362396-60362418 CAGCTCCCACACAGTTCCCAAGG - Intergenic
1118323698 14:64767880-64767902 CAGACCCCCCACAAGGCCCAGGG + Intronic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1121015054 14:90544053-90544075 CAGGGGCCACACACTGCCCTCGG - Intronic
1121089943 14:91174232-91174254 CTTCCCCCACACCTTGCCCTGGG + Intronic
1122353653 14:101111361-101111383 CTGCCCACACACAGGGCCCTGGG - Intergenic
1124055853 15:26240488-26240510 CAGGCCCCACACCAGGCCCACGG - Intergenic
1124260164 15:28182440-28182462 CAGGCCCCACACAAACACCTTGG + Exonic
1124641572 15:31399496-31399518 AAACCACCACACACTGCCCTTGG + Intronic
1130805863 15:87321267-87321289 CAGGCCCCACACAAGGCCTCAGG + Intergenic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132155392 15:99492361-99492383 CAGTCCCCAGTCAATGACCTTGG + Intergenic
1132230588 15:100181091-100181113 CCGCCACCACACAAGGCCCATGG + Intronic
1133350487 16:5097810-5097832 CTGCCCCCGCTCACTGCCCTGGG - Intergenic
1135989963 16:27212345-27212367 CAACCCACACCCCATGCCCTTGG - Intronic
1136532080 16:30876514-30876536 CAGGCACCACACTAGGCCCTAGG + Intronic
1137436125 16:48455558-48455580 CAGCCCACAGACAGTGCCCCTGG - Intergenic
1137626128 16:49909957-49909979 CAGCCCCCAGAGACTGCCCTGGG + Intergenic
1139475479 16:67200564-67200586 CTGCCCCCACCCGCTGCCCTAGG - Intronic
1139593320 16:67944885-67944907 CAGCACCCGCTCAAGGCCCTCGG + Exonic
1141658890 16:85430987-85431009 CAGCCCCGCCGCAAGGCCCTGGG + Intergenic
1141831527 16:86512087-86512109 CAGTCACCACAAAATGCCCCTGG - Intronic
1141919526 16:87126713-87126735 CAGCCCACTCCCAGTGCCCTTGG - Intronic
1144024580 17:11266777-11266799 CATCCCACACACAATCCCATGGG - Intronic
1145005505 17:19335547-19335569 CACCCCCCACCCCACGCCCTCGG - Exonic
1147616561 17:41832206-41832228 CAGCAGCCACAAAAAGCCCTGGG + Intronic
1147624805 17:41893122-41893144 CATGCCCCACACAATGGCCTTGG + Exonic
1147929351 17:43968000-43968022 CAGCCCCGAGACAATTCCATGGG + Intronic
1151433430 17:74080158-74080180 CAACCCCCACCCAGGGCCCTGGG + Intergenic
1151818446 17:76483567-76483589 CAGCCACCACACCCGGCCCTAGG + Intronic
1152362005 17:79837177-79837199 CAGCGCCCACCCCAGGCCCTTGG + Intronic
1156465806 18:37347323-37347345 CATCTCCCACACAAGGGCCTCGG - Intronic
1157191015 18:45581506-45581528 TTGGCCCCACACAATGCACTTGG - Intronic
1157300015 18:46472519-46472541 TAGTACCCACACTATGCCCTGGG + Intergenic
1159180253 18:64893315-64893337 GAGCCCCCACACAGAGTCCTAGG - Intergenic
1160718912 19:589214-589236 CACCCCTCAAACAGTGCCCTGGG - Intergenic
1160983175 19:1826086-1826108 CTGCACCCACACAAAGCCCAGGG - Intronic
1161590108 19:5125672-5125694 CAGCCCCCACAGAAAGGCCAGGG + Intronic
1161748150 19:6074405-6074427 CTCACCCCACACAGTGCCCTGGG + Intronic
1162088373 19:8262039-8262061 CAGCCCCCACTGATGGCCCTCGG + Exonic
1162159708 19:8702689-8702711 CACCCCCCACGCACTGCCCCCGG + Intergenic
1163183143 19:15618055-15618077 CAACCACCTCACAAAGCCCTGGG - Exonic
1163454606 19:17399189-17399211 ATCCCCCCACACAATGGCCTGGG - Intergenic
1163593158 19:18205365-18205387 CAGCCCGCCCCCAGTGCCCTGGG + Intergenic
1163811927 19:19438485-19438507 CTGCCCTCAAACAATGCCCTGGG - Intronic
1164534239 19:29073171-29073193 CAGCCCCCACAGAATGCTGGTGG - Intergenic
1165143990 19:33719956-33719978 CAGGCCACACACAAGGCCGTGGG + Intronic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1167366511 19:49057513-49057535 CAGCCACCACAAAATCCCCCTGG + Exonic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167978506 19:53253137-53253159 CAGCCCACACAATATGACCTCGG - Exonic
925083837 2:1092075-1092097 CAGCCCCCTCACATAGCCCCAGG + Intronic
925286570 2:2720140-2720162 TAACCCCCCCACACTGCCCTCGG - Intergenic
926636153 2:15181924-15181946 CAGCCCCCATGCAATGCCTGGGG - Intronic
928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG + Intergenic
929596702 2:43180573-43180595 CAGGCCCCACACAAAGAGCTTGG - Intergenic
929938169 2:46310120-46310142 CAGCTCCCACTCCATGCACTAGG - Intronic
930035065 2:47080168-47080190 CAGCCCCCACGCAAGGGCCAGGG + Intronic
930701016 2:54457329-54457351 CACCCCCCACACCACGCCCACGG + Intronic
932563175 2:72889736-72889758 CAGCTCCCTCATAATGCCCAGGG - Intronic
933138412 2:78763342-78763364 CAGCCCCGGCACCATACCCTGGG + Intergenic
934639693 2:96020263-96020285 CAGCACCCACACAGAGTCCTCGG + Intergenic
934793953 2:97085114-97085136 CAGCACCCACACAGAGTCCTCGG - Intronic
937152035 2:119692613-119692635 CAGCTCCCACACAGTGCCTCAGG + Intergenic
937202997 2:120217769-120217791 CGGCTGCCACACCATGCCCTCGG - Intergenic
938032724 2:128009185-128009207 CAGCCACCACACCTGGCCCTGGG - Intronic
938079976 2:128364739-128364761 CTGCCCCCACCCATGGCCCTGGG + Intergenic
938979985 2:136517192-136517214 GAGCTCCCACAAAAGGCCCTAGG - Intergenic
940770141 2:157830799-157830821 ATGCCCCCATACAATTCCCTTGG + Intronic
942490824 2:176488214-176488236 CAGCCCCCATTTAATGGCCTGGG - Intergenic
947119592 2:226800429-226800451 CTGCCCCCAGTCACTGCCCTTGG - Intergenic
947715146 2:232335564-232335586 CAGCCCCCACCCCTGGCCCTTGG + Intronic
947734221 2:232446515-232446537 CAGCCCCCACCCCTGGCCCTTGG + Intergenic
948187736 2:236034785-236034807 CAGCCCCCAGAATATGCCCAGGG + Intronic
1173470781 20:43321865-43321887 CAGACCCCACCCATTCCCCTTGG + Intergenic
1173657628 20:44711363-44711385 CAGCCCCCACACAAGGGCCCAGG - Intergenic
1173829649 20:46073676-46073698 CAGACCACACACAAAGCCTTGGG + Intronic
1173929639 20:46807910-46807932 CAGCCACCCCCCATTGCCCTGGG + Intergenic
1174110348 20:48194196-48194218 CACACCCCAGACAAAGCCCTGGG - Intergenic
1174764540 20:53240299-53240321 CAGCGCCCACACATAGACCTGGG + Intronic
1175447264 20:59031965-59031987 CAGCACCCACAGAGTGCCCCTGG - Intronic
1175469353 20:59216126-59216148 CAACCCCCACACCCTTCCCTGGG + Intronic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1175826117 20:61937577-61937599 CAGCCCCAGCAGAAGGCCCTGGG + Exonic
1175845636 20:62057342-62057364 CAACCCCGAAACAATTCCCTTGG + Intronic
1176033549 20:63025402-63025424 CACCACCCACAAAATGACCTTGG + Intergenic
1178538472 21:33429672-33429694 CAGCCCCCAGAAAAAGCCCTGGG - Intronic
1179405862 21:41125193-41125215 CCGCTCCCTCACAATTCCCTGGG - Intergenic
1180181193 21:46119360-46119382 CAGCCCTCACAGGATGCCCTGGG - Intronic
1180574655 22:16761269-16761291 CAGTCCCCACACTAAGCCCATGG - Intergenic
1180985741 22:19903124-19903146 CAGCCCACACACTGGGCCCTGGG - Intronic
1181144741 22:20836686-20836708 CAGCCCCCTGAGAAAGCCCTAGG - Intronic
1181886353 22:26025158-26025180 CAGCCCCCACCTATTTCCCTGGG + Intronic
1183457433 22:37930341-37930363 CAGCACCCACCCAATGACCCAGG - Intronic
1184650917 22:45919114-45919136 CAACCCCCACCCAGTCCCCTCGG - Intergenic
1184829460 22:46974998-46975020 CTGCCCCTACACCATGCCATAGG - Intronic
1185048688 22:48541911-48541933 CAGCACCCACACGATCCCCTGGG - Intronic
1185065267 22:48628896-48628918 CAGCCCCCACCCACAGCCCCAGG - Intronic
1185274242 22:49943572-49943594 CAGCCCCCGCAGGAGGCCCTGGG + Intergenic
1185310740 22:50152881-50152903 CTGCCCCCAGACCAAGCCCTTGG - Intronic
949298801 3:2559343-2559365 CAGCCCTGACACAATACACTGGG + Intronic
950123086 3:10494794-10494816 TAGCCCCCACCCAATGCCGAGGG - Intronic
952216912 3:31287368-31287390 CAGCCCCCACACACTGCAGCAGG - Intergenic
954103780 3:48398218-48398240 CAGGCTCCACACAATGCCAGAGG - Intronic
954687733 3:52379752-52379774 CAGCCCCCACACACTGTCCCTGG + Intronic
955754476 3:62213941-62213963 CAGCCCCCACTCAAAGTGCTGGG - Intronic
956208051 3:66774160-66774182 CAGACCCCACACAGTGGCCCTGG + Intergenic
957328384 3:78726750-78726772 TAGCCCCCAGACATTCCCCTTGG + Intronic
960251545 3:115461082-115461104 GAGCCCCCACACAAGTCACTGGG - Intergenic
961174507 3:124822752-124822774 CAGGCCCCACAGAAGGCACTGGG + Intronic
961300078 3:125916531-125916553 CTGCCCCCGCGCACTGCCCTGGG + Intergenic
961452376 3:127008209-127008231 CAGCCCCCACACAGAGGCCCAGG - Intronic
961485241 3:127211536-127211558 CAGCACCCAGGCAAAGCCCTGGG + Intergenic
962347636 3:134630261-134630283 CAGCCCCCAGGCAATTCTCTTGG + Intronic
967587792 3:191235720-191235742 CAGCCCTGACAGAAAGCCCTTGG + Intronic
968482912 4:844700-844722 CAGCCCCCACATTCTGGCCTTGG - Intergenic
969235285 4:5861309-5861331 CAGGCCCTTCACAAGGCCCTGGG + Intronic
969699553 4:8760726-8760748 CAGCCCCTCCCCAATGCCCCTGG + Intergenic
969756431 4:9153203-9153225 CTGCCCCCGCGCACTGCCCTCGG + Intergenic
972355401 4:38275795-38275817 CAGCCCTCACACAAATCCCTGGG - Intergenic
984012672 4:174389346-174389368 CAGCCCCAAAATAATACCCTAGG - Intergenic
984314093 4:178103678-178103700 GAGCCCCCACACCCAGCCCTAGG + Intergenic
985670836 5:1205853-1205875 CAGCCCCCACACCCTCCCATAGG + Intronic
985895747 5:2749245-2749267 CAGCCGCACCACATTGCCCTGGG - Intronic
986002717 5:3642816-3642838 CAGCCCCTCCCCACTGCCCTGGG - Intergenic
988042909 5:25911392-25911414 TAGCCCCCACCCACTTCCCTGGG + Intergenic
988702159 5:33686171-33686193 CAGTGCCCTCACAAAGCCCTTGG + Intronic
988842048 5:35092849-35092871 CAGCCCCCACACCTTGCCTGTGG + Intronic
992489349 5:77227018-77227040 CAGCACCCACAAAATGCCACAGG + Intronic
994429539 5:99639976-99639998 CATCCCCAACACTATGACCTTGG + Intergenic
998767803 5:145507589-145507611 CAGCCCCAGCAGAATGACCTGGG - Intronic
999126237 5:149248172-149248194 CAGCCCCGTCTCAATCCCCTGGG + Intronic
1002329361 5:178430899-178430921 CAGCCCTCACGTGATGCCCTGGG + Intronic
1002450336 5:179315037-179315059 CACCCCCCCCACAATCCCCAAGG + Intronic
1005408081 6:25513700-25513722 CAGCCCCCACACACAGCCTGGGG - Intronic
1007390368 6:41546885-41546907 CAGCCCCCACCCACGTCCCTGGG - Intronic
1007404090 6:41623643-41623665 CATTCCCCACCTAATGCCCTGGG + Intergenic
1012732380 6:102899377-102899399 GAGCCCCCACACAGTCTCCTGGG - Intergenic
1019712651 7:2524626-2524648 CGGCCCCCACAGATGGCCCTGGG + Intronic
1019999905 7:4749725-4749747 CAGTCCACCCTCAATGCCCTTGG - Intronic
1022501284 7:30883692-30883714 CAGGCCCTTCACAAAGCCCTTGG + Intronic
1024357226 7:48426556-48426578 TACCTCCCACCCAATGCCCTGGG - Intronic
1024604767 7:51014305-51014327 CAGTCCCCACACTTAGCCCTGGG - Intergenic
1024981856 7:55163897-55163919 CTGCCCACACAGGATGCCCTGGG - Intronic
1026411480 7:70127385-70127407 CAGCCCCCTCCCAAAGCCCTGGG + Intronic
1026930176 7:74219512-74219534 CAACCCTCACACAGGGCCCTGGG - Intronic
1029518991 7:101048134-101048156 CTTCCCCCACCCCATGCCCTGGG + Intronic
1030116600 7:106066273-106066295 TAGCCCCCACACCCTGTCCTGGG - Intergenic
1032023997 7:128426958-128426980 AAGCCCCCACACATGGCACTTGG - Intergenic
1034233239 7:149548843-149548865 GAGGCCCCACACTATGCCCTGGG + Intergenic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1034682264 7:152938092-152938114 CAGCTCCCACATGATGGCCTGGG + Intergenic
1035167061 7:156997646-156997668 CAGCCCTCCCAGAAGGCCCTTGG + Intronic
1035260165 7:157656101-157656123 CAGCCCCCACACACAGTCCCTGG - Intronic
1036871262 8:12436415-12436437 CTGCCCCCGCGCACTGCCCTCGG - Intergenic
1037970032 8:23165131-23165153 CAGGGCCCAGACAATGACCTAGG + Intergenic
1038460389 8:27711204-27711226 GAGCCACCACACCAGGCCCTGGG + Intergenic
1038654156 8:29433451-29433473 CAGCCCCCAGACAATCCACCAGG + Intergenic
1040782151 8:51122065-51122087 CAACCCTCAGACACTGCCCTGGG + Intergenic
1041304840 8:56447588-56447610 CAGCCTCCACAGTGTGCCCTCGG - Intergenic
1047408978 8:124608743-124608765 CACCCTCCACACAGTGCCCCAGG - Intronic
1047410129 8:124617641-124617663 CAGCCCCACCACAAGCCCCTGGG + Intronic
1050462195 9:5886344-5886366 CAGCCCCCACACCAGCCCCAGGG - Intronic
1053826490 9:42030344-42030366 CAGCGACCACACAACACCCTTGG - Intronic
1054604070 9:67157053-67157075 CAGCGACCACACAACACCCTTGG + Intergenic
1056057369 9:82840858-82840880 CTGCCCCCACAAAATTCACTGGG - Intergenic
1056692066 9:88816214-88816236 CAGCTCCCACGCAAGGCTCTGGG - Intergenic
1057168833 9:92948782-92948804 CTGCCCCAACACAAGGGCCTGGG - Intronic
1057206050 9:93173279-93173301 CGGCCCCCACCCAATGGGCTTGG - Intergenic
1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG + Intronic
1060828292 9:126698811-126698833 CAGTCCCCCCAGAATGTCCTGGG + Exonic
1061325785 9:129863320-129863342 CAGTCCCCACACACCGCCCAAGG - Intronic
1061448950 9:130658586-130658608 CAGGTCCCATACAAGGCCCTGGG - Intergenic
1061841637 9:133361828-133361850 CAGCCCCCATCAAATGACCTTGG - Exonic
1061874572 9:133537327-133537349 CTGCCCCCACCCCATGCCCGAGG - Intronic
1062065050 9:134522193-134522215 CAGCCCCTACAGGAAGCCCTGGG - Intergenic
1062107531 9:134764053-134764075 CAGACCCTCCACAATGCCCATGG - Intronic
1062107601 9:134764261-134764283 TTGACCCCCCACAATGCCCTCGG - Intronic
1062107647 9:134764403-134764425 GACCCCCCCCACAATGCCCCTGG - Intronic
1062286141 9:135773376-135773398 CATCCTCCACCCAGTGCCCTAGG + Intronic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062554299 9:137107051-137107073 CGGCCCCCACACACCGCCCGAGG - Intronic
1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG + Intergenic
1191870321 X:65740052-65740074 TAGCCCCCACCCACTTCCCTGGG + Exonic
1192291038 X:69795690-69795712 CATTCCCCACACACTGGCCTAGG + Intronic
1193820022 X:86149494-86149516 CAGCCCCCAGAGAAAGCCCTTGG - Intronic
1198737859 X:139807298-139807320 CAGGCCCCACACAAAGCTCAAGG + Intronic
1199276140 X:145944755-145944777 CAGCCAGCATATAATGCCCTAGG - Intergenic
1199971223 X:152863387-152863409 CAGCCCACCCTCAATGCCATGGG + Intronic
1200259726 X:154607058-154607080 CAGATGCCACACAATGCCCTTGG - Intergenic
1200389444 X:155929451-155929473 CACCCCCCACACAATGCCCAGGG - Intronic