ID: 1175777878

View in Genome Browser
Species Human (GRCh38)
Location 20:61664324-61664346
Sequence GCTAGTTTTAAGTCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175777871_1175777878 14 Left 1175777871 20:61664287-61664309 CCCCAGGCATTGCAATGGCCCCT 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1175777878 20:61664324-61664346 GCTAGTTTTAAGTCAAAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 153
1175777875_1175777878 -5 Left 1175777875 20:61664306-61664328 CCCTTGTTTATTCCTGTTGCTAG 0: 1
1: 0
2: 0
3: 27
4: 293
Right 1175777878 20:61664324-61664346 GCTAGTTTTAAGTCAAAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 153
1175777876_1175777878 -6 Left 1175777876 20:61664307-61664329 CCTTGTTTATTCCTGTTGCTAGT 0: 1
1: 0
2: 1
3: 21
4: 332
Right 1175777878 20:61664324-61664346 GCTAGTTTTAAGTCAAAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 153
1175777874_1175777878 -4 Left 1175777874 20:61664305-61664327 CCCCTTGTTTATTCCTGTTGCTA 0: 1
1: 0
2: 1
3: 25
4: 276
Right 1175777878 20:61664324-61664346 GCTAGTTTTAAGTCAAAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 153
1175777873_1175777878 12 Left 1175777873 20:61664289-61664311 CCAGGCATTGCAATGGCCCCTTG 0: 1
1: 0
2: 2
3: 10
4: 129
Right 1175777878 20:61664324-61664346 GCTAGTTTTAAGTCAAAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 153
1175777872_1175777878 13 Left 1175777872 20:61664288-61664310 CCCAGGCATTGCAATGGCCCCTT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1175777878 20:61664324-61664346 GCTAGTTTTAAGTCAAAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 153
1175777869_1175777878 21 Left 1175777869 20:61664280-61664302 CCACATGCCCCAGGCATTGCAAT 0: 1
1: 0
2: 0
3: 17
4: 226
Right 1175777878 20:61664324-61664346 GCTAGTTTTAAGTCAAAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175777878 Original CRISPR GCTAGTTTTAAGTCAAAAGC AGG Intronic
904090957 1:27944911-27944933 GCTTGTTTTAAAGCAAAGGCGGG - Intronic
908164240 1:61442099-61442121 GCTTGCTTTGAGTCAGAAGCAGG + Intronic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
909842097 1:80339851-80339873 GTTATTTTTAAGCCAGAAGCGGG + Intergenic
913303272 1:117396210-117396232 AATAGTTTTAAAGCAAAAGCTGG - Intronic
915886425 1:159727085-159727107 GATAGTTTCAGGTCAGAAGCTGG - Intergenic
918152890 1:181813777-181813799 GCTGGCTTTAACTAAAAAGCTGG + Intergenic
918366880 1:183817464-183817486 TCTATTTTTAAGTCAGAAGAAGG - Intronic
924116869 1:240756108-240756130 GCAAGTTTCAACTCAAAAGTTGG + Intergenic
1065369077 10:24964756-24964778 GACAGTTTTATGTCAAAGGCAGG - Intergenic
1066174873 10:32893146-32893168 GCTAGCTACAAGTCAAAAGTGGG - Intergenic
1066267562 10:33791087-33791109 GCTAGTTTAAAGTTTAAAGGAGG - Intergenic
1066346946 10:34596932-34596954 GCTATATTTAAGTCTACAGCTGG - Intronic
1067073564 10:43157293-43157315 GAGAGTTATAAGACAAAAGCAGG - Intronic
1067394153 10:45897230-45897252 CCTTGTTCTCAGTCAAAAGCAGG + Intergenic
1067862479 10:49866363-49866385 CCTTGTTCTCAGTCAAAAGCAGG + Intronic
1070025875 10:72631589-72631611 GCTGGTTTCAAGTCTACAGCAGG + Intergenic
1078372091 11:10756976-10756998 GCTATGTTTGAGTCAAAAGCTGG + Intronic
1079661565 11:23043230-23043252 GTTAGTTCTAACTCAATAGCAGG - Intergenic
1080381875 11:31780126-31780148 TGTAGTTTTAAGTCTAAAGGAGG + Intronic
1086941329 11:92801342-92801364 GCTACTTTAAAGTGGAAAGCTGG - Exonic
1087158853 11:94929817-94929839 GGAAGTGTTAAGACAAAAGCTGG + Intergenic
1087827125 11:102778208-102778230 TCTACTTTTAAGTAAAAAGGAGG + Intronic
1092691828 12:11120369-11120391 GATAGTTTATAGTCAGAAGCTGG + Intronic
1093252558 12:16825286-16825308 TTTCATTTTAAGTCAAAAGCTGG + Intergenic
1098890032 12:76000762-76000784 TCTCATTTTAAATCAAAAGCTGG - Intergenic
1100236181 12:92663224-92663246 GGTTGTTTTATGTCAAAAGATGG + Intergenic
1100936611 12:99676775-99676797 GCTACTGTGAAGTCAAAATCTGG + Intronic
1101381160 12:104215315-104215337 ACTAGTATTAAGTGAAATGCTGG + Intergenic
1102615264 12:114148287-114148309 GATAGTTTTCAGTCAAAACGAGG + Intergenic
1103352315 12:120292869-120292891 TCTACTTTTAAGGTAAAAGCAGG - Intergenic
1103548462 12:121718787-121718809 ACTGGTTTTAAGCCAAAAGAGGG + Intronic
1109953296 13:69531084-69531106 TCTCGTTTTAAATAAAAAGCTGG + Intergenic
1110119225 13:71863423-71863445 GTTATTTTTAAGTTAAAGGCGGG - Intronic
1112204620 13:97312003-97312025 GCTAGTTTTTAGTCATCAGTTGG - Intronic
1118560444 14:67074597-67074619 TCTCATTTTAAATCAAAAGCTGG + Intronic
1119537612 14:75415577-75415599 GCTAGTTATAAGTCAGAGCCAGG - Intergenic
1120254163 14:82096888-82096910 GAAAGTTTTAAGTTACAAGCAGG - Intergenic
1120763410 14:88306302-88306324 ACTAGTTTTAAGTCAAAGTAAGG + Intronic
1120859823 14:89245109-89245131 GCTAGTTTGAAGGCAGCAGCAGG + Intronic
1122120308 14:99549723-99549745 GTTAGTTTTATGTGAAACGCGGG - Intronic
1125649565 15:41304190-41304212 GCAAGTTTCAACTCAAAAGTTGG - Intergenic
1127084535 15:55412825-55412847 AGTACTTTTAAGTTAAAAGCTGG + Intronic
1127303067 15:57676719-57676741 GCTTGTTTTAAGCCAAAATGCGG - Intronic
1127926762 15:63553286-63553308 GAGAGATTTAAGTGAAAAGCAGG - Intronic
1128557850 15:68643732-68643754 GCTTGATTTAAATCAAATGCAGG + Intronic
1135139563 16:19909796-19909818 TCTAGTTTAAAGTCAAGAGTTGG - Intergenic
1147481180 17:40764901-40764923 GCTTGTTTTATGTTACAAGCAGG + Intergenic
1148173795 17:45547078-45547100 ACTAGTTTTATGTCAAACCCAGG - Intergenic
1148275474 17:46298369-46298391 ACTAGTTTTATGTCAAACCCAGG + Intronic
1148297579 17:46515948-46515970 ACTAGTTTTATGTCAAACCCAGG + Intronic
1148362131 17:47020427-47020449 ACTAGTTTTATGTCAAACCCAGG + Intronic
1150405007 17:64894000-64894022 ACTAGTTTTATGTCAAACCCAGG - Intronic
1153475200 18:5491447-5491469 CCTGGATTTAAGACAAAAGCAGG - Intronic
1155273242 18:24161212-24161234 GCTAGATTTCATTCATAAGCAGG + Intronic
1155563543 18:27107410-27107432 GCTGTTTTTATGTAAAAAGCAGG - Intronic
1155732774 18:29181441-29181463 GTTAGTTTTCATTTAAAAGCAGG + Intergenic
1156605459 18:38661106-38661128 ATTATTTTTAAGTGAAAAGCTGG - Intergenic
1156828626 18:41464052-41464074 GCTGATTTTTTGTCAAAAGCTGG + Intergenic
1159179216 18:64880064-64880086 ATTAGATTTAAGTAAAAAGCGGG + Intergenic
925947675 2:8880650-8880672 GCTAGTGGTAAGGCAGAAGCAGG + Intronic
927407991 2:22794366-22794388 GGTAGTTTTCAGCCAAAGGCAGG - Intergenic
929083554 2:38146230-38146252 GGTAGTATTTAGTCAAAAGAGGG - Intergenic
932255793 2:70285075-70285097 GCTAGTATTAAGTTAAAAAAAGG - Intronic
934060223 2:88285672-88285694 GCCATTTTTATGTCAAAAGATGG - Intergenic
934510484 2:94936335-94936357 CCTTGTTCTCAGTCAAAAGCAGG + Intergenic
935153638 2:100462704-100462726 GCTAATTTAAAGTGAAAAGGAGG + Intergenic
935979753 2:108615163-108615185 TCTAGTTTTAAGTCAAATTATGG + Intronic
937678333 2:124616696-124616718 TCTCATTTTAAATCAAAAGCTGG - Intronic
939907077 2:147930266-147930288 GCTACATTTAAGTAAAATGCAGG + Exonic
941300999 2:163801193-163801215 TCTAGTTTTAAGCCAACAGTGGG - Intergenic
943110605 2:183600246-183600268 GCTTGTTTTAAGTGAATGGCAGG + Intergenic
1169159772 20:3367495-3367517 TCTCATTTTAAATCAAAAGCTGG - Intronic
1170061928 20:12268278-12268300 GCTAGTTTAAAGACAGAAGGTGG + Intergenic
1175777878 20:61664324-61664346 GCTAGTTTTAAGTCAAAAGCAGG + Intronic
1176525370 21:7862595-7862617 GCTGATTACAAGTCAAAAGCAGG - Intergenic
1177008099 21:15698907-15698929 GCATGTTTTCACTCAAAAGCAGG + Intergenic
1178659390 21:34492608-34492630 GCTGATTACAAGTCAAAAGCAGG - Intergenic
1180893168 22:19306432-19306454 GCTAATTTTATGTCAAATTCAGG - Intergenic
1181978136 22:26747027-26747049 GAAAGTTGAAAGTCAAAAGCAGG - Intergenic
1183398303 22:37585887-37585909 GTCAGTTTTAACTCAAAAGAGGG + Intergenic
1183681471 22:39332762-39332784 TCTTGCTTTAAATCAAAAGCTGG - Intergenic
950158296 3:10740269-10740291 GATAGTTTTAGGTCAATATCAGG - Intergenic
951048754 3:18070598-18070620 GATAGATTTAAGTCACAGGCTGG + Intronic
951386081 3:22044520-22044542 GCAATTTTTAAATAAAAAGCAGG + Intronic
951967925 3:28408850-28408872 GATAATTCTAAGTCTAAAGCAGG - Intronic
952471454 3:33657655-33657677 CCAATTTTTAAGACAAAAGCAGG - Intronic
955246612 3:57230504-57230526 GATAATGTTAAGTTAAAAGCAGG - Intronic
955443893 3:58986643-58986665 GGTAGTTTAAAGTCAAACTCAGG - Intronic
955959410 3:64324145-64324167 GATATTTTTATGTCAAAAGGAGG - Intronic
957115761 3:76023372-76023394 TCTCACTTTAAGTCAAAAGCTGG - Intronic
957694148 3:83611947-83611969 GCAAGTTTCAAGTCTAAATCTGG + Intergenic
958846331 3:99269486-99269508 GGTGGTTTTAAGTAAAAATCAGG - Intergenic
959403204 3:105928637-105928659 GCTTCTTTTGAGTGAAAAGCTGG + Intergenic
959596172 3:108131141-108131163 ACTAGTTTGAAATCAACAGCTGG + Intergenic
962229703 3:133651922-133651944 GATAGTTTAAAGTCCAAACCTGG + Intronic
963183824 3:142390808-142390830 TCTAGGTTTAAATCAAAAGCTGG - Intronic
964041866 3:152269870-152269892 TCTGGTTTTTAGACAAAAGCAGG + Intronic
967429391 3:189364031-189364053 GGTAGTTTCAATTCAAAAGTTGG - Intergenic
970609970 4:17716097-17716119 GCTAGTTTTATGACACAAGATGG - Intronic
971796977 4:31240786-31240808 TCTAGCTGAAAGTCAAAAGCAGG - Intergenic
971941621 4:33223217-33223239 GCTAATTTTATGTCAAATTCAGG + Intergenic
975339645 4:73225189-73225211 ACTTGTTTTAAGTCTAAAGATGG - Intronic
977140655 4:93367271-93367293 GCTAGTTTTAAGTCTCAGACTGG + Intronic
978837860 4:113175217-113175239 GCTAATTTTAAGTTAAAAGGAGG + Intronic
979314021 4:119238236-119238258 TCTCATTTTCAGTCAAAAGCTGG - Intronic
981483980 4:145265491-145265513 GATAGATTTAAAGCAAAAGCAGG + Intergenic
983092086 4:163515841-163515863 GCAAGTTTTAGGAGAAAAGCTGG - Intronic
983528101 4:168781325-168781347 GCCAGTTTCAAGTCAGAAGTGGG + Intronic
985162824 4:187062139-187062161 GCTAGGGTTTAGGCAAAAGCTGG - Intergenic
985520000 5:369927-369949 GCAAGTTTTACGTCAAATGAGGG - Intronic
987589638 5:19907892-19907914 TTTTATTTTAAGTCAAAAGCTGG - Intronic
987943488 5:24573399-24573421 GAAAGTTTAAAGACAAAAGCAGG + Intronic
988447567 5:31304879-31304901 CCCACTTTTAAGTCAACAGCAGG + Intronic
989643377 5:43603934-43603956 GCTAGTTCAAACTCAACAGCCGG + Intronic
992110306 5:73486611-73486633 GCTACTTGTAAGGCCAAAGCAGG - Intergenic
993462767 5:88204668-88204690 GCTTCTTTTAAGACAAAACCTGG - Intronic
994712979 5:103288175-103288197 GCTATTTTTAAATCTAAACCAGG - Intergenic
996613697 5:125414352-125414374 GCTAGTTTTCAGTTAAAATCAGG + Intergenic
1000012564 5:157246245-157246267 GCTGCTGTGAAGTCAAAAGCTGG + Intronic
1000876557 5:166646004-166646026 TCAAGTTTTAAGTCAATAGATGG + Intergenic
1012268884 6:97183124-97183146 GCTAGTTTGGAGTCAAAAATTGG - Intronic
1012321972 6:97860887-97860909 GCTTGTTTAAAGACAAAAGGAGG - Intergenic
1012392613 6:98760112-98760134 TCTCACTTTAAGTCAAAAGCTGG + Intergenic
1013389089 6:109665317-109665339 GCTATGTTTAAGACAATAGCAGG - Intronic
1016767678 6:147813121-147813143 GCTTGTGTTAAATTAAAAGCAGG + Intergenic
1020593654 7:10175363-10175385 TCTGGTTTTAATTCTAAAGCTGG + Intergenic
1023733008 7:43210051-43210073 GATGGTTTTAAGTCAACAGCCGG + Intronic
1024778369 7:52816120-52816142 GCTATTTTTAGGTCTGAAGCTGG - Intergenic
1028282155 7:88944740-88944762 CCTAATTTTAATTCAAAAACTGG + Intronic
1028632837 7:92954512-92954534 GCTAGACTTAAGTGAAAAGAGGG - Intergenic
1030001114 7:105064003-105064025 GCAAGGTTCAAGTCAAAAGGAGG - Intronic
1030544699 7:110877619-110877641 GCTAGTGTAAAGTCATTAGCAGG - Intronic
1031240730 7:119235590-119235612 GGTAGTTTAAAGTGAAAAACTGG - Intergenic
1031384327 7:121128552-121128574 TCTAGTTTGATGTCAAAATCAGG - Intronic
1032359169 7:131239022-131239044 GCTAGTGATACGTCAAAACCTGG - Intronic
1032843653 7:135734720-135734742 GATAATTTTAAGGCAGAAGCTGG + Intronic
1034519813 7:151611121-151611143 TCTGCTTTTAAGTCAAAAGAAGG + Intronic
1042635717 8:70871763-70871785 TCTCATTTTAAATCAAAAGCTGG + Intergenic
1043044045 8:75298802-75298824 GCTAGTTTTAAAAGAAAAGAGGG + Intergenic
1044164288 8:88962061-88962083 TCTCGCTTTAAATCAAAAGCTGG - Intergenic
1045465596 8:102466748-102466770 TCTCATTTTAAATCAAAAGCTGG - Intergenic
1046117370 8:109800400-109800422 GCTGGATTGAAGTCAGAAGCTGG + Intergenic
1053191463 9:36073942-36073964 GCTGATTTTAAGTTACAAGCTGG - Intronic
1053231925 9:36417387-36417409 TATAATTTTAAATCAAAAGCGGG - Intronic
1053569620 9:39290259-39290281 ATAAGTTTTAAGTCAAAAGCAGG - Intergenic
1053654912 9:40208028-40208050 CCTTGTTCTCAGTCAAAAGCAGG - Intergenic
1053835584 9:42131292-42131314 ATATGTTTTAAGTCAAAAGCAGG - Intergenic
1053905296 9:42837235-42837257 CCTTGTTCTCAGTCAAAAGCAGG - Intergenic
1054091248 9:60849259-60849281 ATAAGTTTTAAGTCAAAAGCAGG - Intergenic
1054112665 9:61124829-61124851 ATAAGTTTTAAGTCAAAAGCAGG - Intergenic
1054127528 9:61328753-61328775 ATAAGTTTTAAGTCAAAAGCAGG + Intergenic
1054367027 9:64354244-64354266 CCTTGTTCTCAGTCAAAAGCAGG - Intergenic
1054529688 9:66168287-66168309 CCTTGTTCTCAGTCAAAAGCAGG + Intergenic
1054595045 9:67057322-67057344 ATAAGTTTTAAGTCAAAAGCAGG + Intergenic
1054674654 9:67843985-67844007 CCTTGTTCTCAGTCAAAAGCAGG - Intergenic
1055472142 9:76622507-76622529 GCTATTTTGAAGACAAAAGATGG - Intronic
1056553522 9:87670939-87670961 GCTACTTTTAAGTCAAAGAAGGG - Intronic
1056885280 9:90436690-90436712 ACTAGTTTAAAATCACAAGCGGG - Intergenic
1058360028 9:104134210-104134232 GCTAGTGATAAGACAAAATCAGG - Intronic
1059412420 9:114140934-114140956 GCTATTTTTATCTCAAGAGCTGG - Intergenic
1187596923 X:20783476-20783498 GCTAATTTTAAGGTAAAACCAGG + Intergenic
1191172640 X:57464173-57464195 GCATGTTTTTACTCAAAAGCGGG + Intronic
1195928101 X:110046632-110046654 GCTTGATTTAAGTCAAAATATGG + Intronic