ID: 1175779448

View in Genome Browser
Species Human (GRCh38)
Location 20:61672955-61672977
Sequence TAGAAGAAGAAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2331
Summary {0: 1, 1: 1, 2: 34, 3: 309, 4: 1986}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175779441_1175779448 20 Left 1175779441 20:61672912-61672934 CCTGAGTTATCCAGTGGGTCCTA 0: 1
1: 0
2: 3
3: 10
4: 102
Right 1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG 0: 1
1: 1
2: 34
3: 309
4: 1986
1175779443_1175779448 1 Left 1175779443 20:61672931-61672953 CCTAAATGCCATCACTAGTGTCC 0: 1
1: 13
2: 50
3: 182
4: 631
Right 1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG 0: 1
1: 1
2: 34
3: 309
4: 1986
1175779444_1175779448 -7 Left 1175779444 20:61672939-61672961 CCATCACTAGTGTCCATAGAAGA 0: 1
1: 0
2: 1
3: 26
4: 138
Right 1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG 0: 1
1: 1
2: 34
3: 309
4: 1986
1175779442_1175779448 10 Left 1175779442 20:61672922-61672944 CCAGTGGGTCCTAAATGCCATCA 0: 1
1: 2
2: 4
3: 21
4: 152
Right 1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG 0: 1
1: 1
2: 34
3: 309
4: 1986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175779448 Original CRISPR TAGAAGAAGAAGAAGGAGGC AGG Intronic
Too many off-targets to display for this crispr