ID: 1175780201

View in Genome Browser
Species Human (GRCh38)
Location 20:61677211-61677233
Sequence CGCAGATATCACAGAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175780201_1175780206 -5 Left 1175780201 20:61677211-61677233 CCCTGGCCTCTGTGATATCTGCG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1175780206 20:61677229-61677251 CTGCGAGCAGGGCAGACTCCTGG 0: 1
1: 1
2: 2
3: 16
4: 179
1175780201_1175780209 19 Left 1175780201 20:61677211-61677233 CCCTGGCCTCTGTGATATCTGCG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1175780209 20:61677253-61677275 TCAGATTCAAGTACAGGAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 204
1175780201_1175780210 20 Left 1175780201 20:61677211-61677233 CCCTGGCCTCTGTGATATCTGCG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1175780210 20:61677254-61677276 CAGATTCAAGTACAGGAAAAGGG 0: 1
1: 0
2: 2
3: 22
4: 282
1175780201_1175780208 13 Left 1175780201 20:61677211-61677233 CCCTGGCCTCTGTGATATCTGCG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1175780208 20:61677247-61677269 CCTGGTTCAGATTCAAGTACAGG 0: 1
1: 0
2: 0
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175780201 Original CRISPR CGCAGATATCACAGAGGCCA GGG (reversed) Intronic
900485011 1:2918511-2918533 CCCAAATGTCACAGAGGACAAGG - Intergenic
900601007 1:3502608-3502630 CCCAGGGAGCACAGAGGCCAGGG + Intronic
901247343 1:7742942-7742964 CCCAGATACTAGAGAGGCCAAGG - Intronic
901772888 1:11539703-11539725 CGCTGAAAAGACAGAGGCCAGGG - Intergenic
901820592 1:11826831-11826853 CACAGAAAACACAGAGGTCAGGG + Intronic
902847920 1:19126900-19126922 CGCACATATGCCAGAAGCCAGGG + Intronic
911562603 1:99424770-99424792 CACAGAAATCAAAGGGGCCAAGG + Intergenic
915099106 1:153485675-153485697 AGCAGATCTCACTGAGGCCACGG - Intergenic
916504294 1:165413968-165413990 AGCAGATAACAGAGAGACCATGG - Intronic
918072482 1:181143091-181143113 AGCAGATGTCACAGAGGCCTGGG - Intergenic
924243569 1:242061473-242061495 AGAGAATATCACAGAGGCCATGG - Intergenic
1062955523 10:1538088-1538110 CACAGATGACACAGAGGCCTGGG + Intronic
1070716764 10:78728162-78728184 CGCCCATAAAACAGAGGCCATGG + Intergenic
1079545993 11:21632433-21632455 AGCATATATCACAGAGGAAAAGG - Intergenic
1084652849 11:70499290-70499312 CCCAGATATAACAGGGGGCAAGG - Intronic
1085269556 11:75262252-75262274 CTCAGACCCCACAGAGGCCAAGG - Intergenic
1085645579 11:78220247-78220269 GGCAGAGATCATGGAGGCCAGGG - Intronic
1086403844 11:86483389-86483411 TCCAGATATCAGAGAGGCCAAGG + Intronic
1092937171 12:13374973-13374995 GCCAGATTCCACAGAGGCCAAGG + Intronic
1101197331 12:102397372-102397394 CACAGATAAGACAGAGGCCCAGG - Intronic
1101582485 12:106054221-106054243 CACAGAGATCAGGGAGGCCAGGG + Intergenic
1102448719 12:113024398-113024420 AGCAGAGCTCATAGAGGCCACGG + Intergenic
1102804946 12:115771414-115771436 GGCACATGTCACAGATGCCATGG - Intergenic
1102863382 12:116355476-116355498 CGCAGATAGCAAAGAGGTCCTGG + Intergenic
1103784157 12:123419735-123419757 AGCTGAAATTACAGAGGCCATGG + Intronic
1104283683 12:127403116-127403138 CTTAGGTATCACAGAGTCCATGG - Intergenic
1106074338 13:26444640-26444662 CAATGTTATCACAGAGGCCAAGG + Intergenic
1107968107 13:45615465-45615487 AGCAGATGTCAGAAAGGCCAAGG + Intronic
1109696185 13:65962227-65962249 CGCAGCTACTCCAGAGGCCAAGG - Intergenic
1110538334 13:76678626-76678648 CTAAGATATGACAGAAGCCATGG + Intergenic
1113913457 13:113855783-113855805 AGCAGAAATCACAGATGCCCTGG + Intronic
1114344664 14:21781885-21781907 CCCAGATACCACAGCTGCCAAGG - Intergenic
1114523472 14:23352875-23352897 CGCAGAGATCGCAGAGACCAAGG - Exonic
1116313627 14:43359438-43359460 CCCAGATATCACACCTGCCAAGG + Intergenic
1116826452 14:49677634-49677656 GGCATATATCACACAGCCCAGGG - Intronic
1119135130 14:72211219-72211241 CAGAGGTATCACAGAAGCCAAGG + Intronic
1120154354 14:81076210-81076232 TTGTGATATCACAGAGGCCAAGG - Intronic
1121060365 14:90902367-90902389 CTCAGCTATCCCAGAGGCTAAGG + Intronic
1121446080 14:93980162-93980184 TCCAGAGATCACTGAGGCCAGGG - Intergenic
1123883174 15:24694806-24694828 GGCAGAAATCACACAGGCAATGG - Intergenic
1127367132 15:58301544-58301566 CGCAGATACTATTGAGGCCAAGG + Intronic
1128304333 15:66588238-66588260 CACACATTTCACAGGGGCCAGGG + Intronic
1129917335 15:79285309-79285331 TGAAGATCTCACAGAGGGCAAGG - Intergenic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1137874012 16:51978559-51978581 TGAAGATGTCACAGAGGCAACGG + Intergenic
1138209981 16:55155380-55155402 TGGAGAGATCACAAAGGCCATGG + Intergenic
1139122971 16:64042917-64042939 CCAAGATATCTCAGAGCCCAAGG - Intergenic
1144510945 17:15875941-15875963 CCCACATATCACAGGGGTCAGGG + Intergenic
1152021128 17:77780872-77780894 CCCAGATTTCACAGAGGGCTTGG + Intergenic
1152409390 17:80114956-80114978 AGCAGAAACCACGGAGGCCATGG - Intergenic
1153492654 18:5665254-5665276 CGCACATATCACAAAGCCAATGG - Intergenic
1153845897 18:9049636-9049658 GGAAGATAGCACAGAGGGCAGGG - Intergenic
1159336433 18:67073492-67073514 CTCAGAAACCACAGAGGACATGG + Intergenic
1162864340 19:13532957-13532979 CTCAGAGATCTGAGAGGCCAAGG + Intronic
1163343655 19:16726358-16726380 CCCAGCTATTCCAGAGGCCAGGG - Intronic
1164785185 19:30924951-30924973 CCCAGATATTACAGAGGCCTGGG + Intergenic
1166949919 19:46420181-46420203 GGAAGATAACACAGAGGCAAAGG + Intergenic
1167720277 19:51174928-51174950 CACAGATATCATAGATGTCATGG + Intergenic
1167728847 19:51238074-51238096 CACAGATATCATAGATGTCATGG + Intronic
1168056313 19:53867086-53867108 CTCAGATATCACAGTGGATAGGG - Intronic
925134359 2:1516075-1516097 TGCAGAAAGCACAGAAGCCAAGG + Intronic
925556097 2:5132987-5133009 CGCAGTTTCCACAGAGCCCACGG + Intergenic
926212203 2:10879331-10879353 CACAGACGTCACAGACGCCATGG - Intergenic
927097532 2:19758881-19758903 CGCAGAGAACACACTGGCCACGG + Intergenic
934655581 2:96115421-96115443 GGCAGAAGCCACAGAGGCCAGGG + Exonic
943672707 2:190680440-190680462 AGCAGGCATCCCAGAGGCCAGGG - Intronic
947715707 2:232337962-232337984 CCGAGATGTCCCAGAGGCCACGG + Intronic
947721241 2:232370339-232370361 CCGAGATGTCCCAGAGGCCACGG + Intergenic
947734736 2:232448722-232448744 CCGAGATGTCCCAGAGGCCACGG + Intergenic
1170975996 20:21165343-21165365 AGCAGAGAACACAGAGGACATGG + Intronic
1172130631 20:32652561-32652583 AGCAGGAATCACAGAGGTCAGGG - Intergenic
1175688860 20:61051210-61051232 AGCAGATCTGACAGAGGCCTTGG - Intergenic
1175780201 20:61677211-61677233 CGCAGATATCACAGAGGCCAGGG - Intronic
1178208350 21:30497076-30497098 GGCAGCTATTACAGAGGCCTGGG - Exonic
1182558619 22:31142272-31142294 CTCAGATATCACAGATGCTGTGG - Intergenic
1182871588 22:33652279-33652301 CCCAGATATCAGAGAGACCTGGG - Intronic
1184868779 22:47219915-47219937 CTCAGATCACACTGAGGCCAGGG + Intergenic
1185208094 22:49551710-49551732 CACAGCAATGACAGAGGCCAGGG + Intronic
950133681 3:10565351-10565373 AGCAGAAATCACAGAGGTCTAGG - Intronic
952385541 3:32839049-32839071 CTCAGAAATCCCAGAGGCCAAGG - Intronic
952513334 3:34078764-34078786 CACAGATATCTCAGACCCCAGGG - Intergenic
953271800 3:41452940-41452962 CGCAGTTAATCCAGAGGCCAAGG + Intronic
953843135 3:46405989-46406011 CCCAGACATTCCAGAGGCCAAGG - Intergenic
962858407 3:139371833-139371855 CCTAGAAATCACAGAAGCCAGGG + Exonic
965126010 3:164630101-164630123 CACAAATATCACAGAAGCAAAGG - Intergenic
968500425 4:947397-947419 CACAGAGATCACAGACCCCAAGG - Intronic
969292619 4:6250409-6250431 AGCAGATATCACAGACAGCACGG - Intergenic
969536762 4:7761025-7761047 CGCAGCTGCCACAGAGGCAAGGG + Exonic
970873730 4:20845602-20845624 CGCACATAACACAGAGGTGATGG + Intronic
972285738 4:37646192-37646214 CTCAAATATCACTGAGGGCATGG + Intronic
972568707 4:40291665-40291687 CACAGAAATCAGGGAGGCCATGG - Intergenic
974642801 4:64653674-64653696 CGCAGCTACTCCAGAGGCCAAGG + Intergenic
977557710 4:98501741-98501763 AGCAAATGTCACACAGGCCATGG + Intronic
977566612 4:98587098-98587120 CGCAGCCATCACACATGCCAAGG + Intronic
979458603 4:120953911-120953933 CCCAGAGAACTCAGAGGCCAGGG - Intergenic
980123173 4:128748694-128748716 CCCAGCTACCCCAGAGGCCAAGG - Intergenic
988595193 5:32584612-32584634 CGGAGATGCCACAGAGGCTAAGG - Intronic
991166704 5:63571041-63571063 GGCAGAGGGCACAGAGGCCACGG + Intergenic
994502154 5:100592775-100592797 GGAAGATATCAGAGAAGCCACGG - Intergenic
995785367 5:115821998-115822020 ACCACATATCACATAGGCCAAGG + Intergenic
997299658 5:132793338-132793360 TGCAGAGACCACAGATGCCATGG + Intronic
997574843 5:134966820-134966842 CCCAGCTACCAGAGAGGCCAAGG - Exonic
998140062 5:139694693-139694715 CTCAGGCATCCCAGAGGCCAGGG - Intergenic
998397311 5:141826945-141826967 CTCAGCTATCCCAGAGTCCAGGG + Intergenic
998812342 5:145978897-145978919 GGCAGATATCCCAGGAGCCAGGG - Intronic
1000046095 5:157523192-157523214 GGCAGAAAGCACAGAGGCTAAGG - Intronic
1001172299 5:169431079-169431101 GGCAGGTTTCACAGAGCCCATGG - Intergenic
1002054324 5:176590045-176590067 GGCAGATGTCACAGAGGCCTGGG - Intronic
1003489677 6:6610442-6610464 CTCAGATGCCCCAGAGGCCAGGG - Intronic
1003641344 6:7878145-7878167 GGCAAATATCACACAGGCAAGGG - Intronic
1006015657 6:31078698-31078720 AGCCGGTATCACTGAGGCCACGG - Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1009906007 6:69870414-69870436 CACAGACTTCACAGAGGACATGG + Intronic
1010462240 6:76126638-76126660 CACAGATATGACAGAGGCTAGGG - Intergenic
1010899124 6:81404001-81404023 CTCAGATATCTCAGAGCCCGAGG - Intergenic
1013016387 6:106164206-106164228 AGCACATATGACTGAGGCCAGGG - Intergenic
1029219362 7:98975784-98975806 CACAGATGTCACCGAGGCCCAGG - Intronic
1030302116 7:107984768-107984790 CTCAAATATCACATAGGACATGG + Intronic
1030543716 7:110866415-110866437 CACAGAGATCAGAGAGGACAGGG + Intronic
1030675988 7:112385574-112385596 CGAAGATTTTTCAGAGGCCAGGG - Intergenic
1031036003 7:116788491-116788513 CACAGACAGCACAGAGGCCAAGG + Intronic
1032048517 7:128630896-128630918 CGCAATTATCACAGAGTCCTGGG + Intergenic
1036667707 8:10758433-10758455 CGCTGAGATCCCAGTGGCCAGGG + Intronic
1036672785 8:10804081-10804103 TGCCCATATGACAGAGGCCATGG - Intronic
1036935518 8:12998567-12998589 AGAAGTTAGCACAGAGGCCAGGG - Intronic
1040531457 8:48269770-48269792 GTTAGATTTCACAGAGGCCAGGG + Intergenic
1047849402 8:128840330-128840352 GGCATATATAACAAAGGCCAAGG - Intergenic
1049732358 8:144185209-144185231 TGCAGAAACCACAGAGGCCAGGG - Intronic
1052132817 9:24870448-24870470 ATCAGAAAACACAGAGGCCAGGG + Intergenic
1056548981 9:87635896-87635918 CCCAGAGAGCACAGAAGCCAGGG + Intronic
1057443650 9:95099130-95099152 CACAGATGTCACGGAGTCCAGGG + Exonic
1057554771 9:96078994-96079016 AGCAGAACTCACAGAGGCCAAGG - Intergenic
1057745531 9:97747932-97747954 CACAGATAGCAAAGAGACCATGG + Intergenic
1058789603 9:108429477-108429499 AGCAGAGATTTCAGAGGCCACGG + Intergenic
1059573516 9:115466212-115466234 TGCAGACATCAAAGAGGCCGTGG + Intergenic
1061748698 9:132759078-132759100 CCCAGCTATTACGGAGGCCAAGG + Intronic
1061895271 9:133643743-133643765 TTCAGACATCACAGAGGCGAGGG - Intronic
1187487123 X:19715155-19715177 CCCAGCTAGTACAGAGGCCAAGG + Intronic
1193982527 X:88201188-88201210 CTCAGATATCAAAGACGACAGGG - Intergenic
1195861080 X:109384007-109384029 CTTAGATATGGCAGAGGCCATGG - Intronic
1198704030 X:139427896-139427918 AGCAGATATGCCACAGGCCATGG + Intergenic