ID: 1175781974

View in Genome Browser
Species Human (GRCh38)
Location 20:61688597-61688619
Sequence TCGCAGCATCTCTGCAGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175781966_1175781974 20 Left 1175781966 20:61688554-61688576 CCTTCCGGAAGCACTGGGACACA 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1175781974 20:61688597-61688619 TCGCAGCATCTCTGCAGCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 199
1175781968_1175781974 16 Left 1175781968 20:61688558-61688580 CCGGAAGCACTGGGACACAGGCT 0: 1
1: 0
2: 2
3: 38
4: 455
Right 1175781974 20:61688597-61688619 TCGCAGCATCTCTGCAGCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 199
1175781965_1175781974 23 Left 1175781965 20:61688551-61688573 CCGCCTTCCGGAAGCACTGGGAC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1175781974 20:61688597-61688619 TCGCAGCATCTCTGCAGCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175781974 Original CRISPR TCGCAGCATCTCTGCAGCTC CGG Intronic
900215053 1:1477123-1477145 TCCCAGCAACTCTGAGGCTCAGG - Intronic
900887057 1:5422710-5422732 TCCAAGCCTCTCTCCAGCTCGGG - Intergenic
902186078 1:14726409-14726431 TCCCAGCATCTCAGCAGGTGTGG + Intronic
903740746 1:25557052-25557074 TAGCAGGTTCTCTGCAACTCAGG + Intronic
904913270 1:33951156-33951178 CCGCAGCCTCTCTCCAGCCCTGG - Intronic
905227993 1:36492569-36492591 TCCCAGCCTCTCTGCAGCCTGGG - Intergenic
906797753 1:48711247-48711269 TTCCAGCATCTCTGAACCTCAGG - Intronic
908177052 1:61566125-61566147 TCTCAGAATCCCAGCAGCTCTGG - Intergenic
908774231 1:67624987-67625009 TCCCAGCTTCCCTGCAGCTGGGG - Intergenic
911052351 1:93681626-93681648 TCTCAGGATCTCTGGACCTCCGG + Intronic
911612976 1:99977415-99977437 TCTCAGCATCTCAGCTACTCGGG + Intronic
914796594 1:150925213-150925235 TCCCAGCAACTCCGCAGCTGAGG - Intergenic
914815471 1:151059363-151059385 CCCCAGCATCTCTGCAGCCCAGG + Exonic
915566263 1:156714841-156714863 TTGCTGCATCTGCGCAGCTCAGG + Intergenic
916882002 1:169028177-169028199 TCTCAGCACCACTGCACCTCCGG + Intergenic
919337031 1:196248981-196249003 TTGAAGCATCTCTGCATCCCTGG - Intronic
922792068 1:228316265-228316287 CCTCAGCCCCTCTGCAGCTCCGG - Intronic
923382860 1:233439188-233439210 TCTCAGAATCTCAGCACCTCTGG + Intergenic
923772306 1:236948326-236948348 CCACAGCATCTCTGTAGCTCTGG - Intergenic
1063386259 10:5617979-5618001 TGGCAGCATCTCTGTGCCTCTGG - Intergenic
1064116902 10:12585877-12585899 ACGCAGCATCTGTGCTGCTCAGG + Intronic
1065155723 10:22868567-22868589 TCTCACCCTTTCTGCAGCTCTGG - Intergenic
1067006862 10:42672619-42672641 TTGGAGCATCTCAGCATCTCTGG - Intergenic
1067338065 10:45380065-45380087 TCTCAGCATCTCAGGGGCTCGGG - Intronic
1070243306 10:74705284-74705306 CTGCAGCAGCTCAGCAGCTCAGG + Intronic
1074686870 10:115969915-115969937 TCGCAGGATCACTCCAGCCCAGG - Intergenic
1075134293 10:119769358-119769380 TAGGAGCATCACTGGAGCTCAGG - Intronic
1075518244 10:123126873-123126895 TGGCAGCCTCTCCGCAGCTAAGG + Intergenic
1076880709 10:133237945-133237967 CCGCAGCAGCTCTCCAGCTTTGG + Exonic
1077100036 11:818633-818655 TCCCAGACCCTCTGCAGCTCTGG + Intergenic
1079373605 11:19872688-19872710 TCAAAGCATTTCAGCAGCTCAGG + Intronic
1079387125 11:19990350-19990372 CTGCAGAATCTCTGCAGATCTGG - Intronic
1080967160 11:37225751-37225773 TGGAAGGATCTCTGGAGCTCAGG + Intergenic
1081527295 11:43935827-43935849 TCTCAGCAGGTCTGTAGCTCTGG - Intronic
1083962765 11:66023470-66023492 TCCCAGGCTCTCTCCAGCTCTGG + Intronic
1085622833 11:78050305-78050327 TCGCAGCACCTGTGCAGAGCGGG + Intronic
1088371175 11:109090011-109090033 TGGCACCATCTCTGGAGCTATGG - Intergenic
1088697847 11:112383483-112383505 TCGCAGCATCTCTCCAGCAAGGG + Intergenic
1089032893 11:115351783-115351805 TAGGAGCCCCTCTGCAGCTCTGG + Intronic
1089154174 11:116387870-116387892 TCATAGCATTTATGCAGCTCAGG - Intergenic
1091168064 11:133498073-133498095 AGGCAGCATCTCTGCACCACCGG + Intronic
1092031866 12:5293222-5293244 TCGCACCCTCACTGCACCTCTGG - Intergenic
1092530495 12:9340353-9340375 TCACAGCATTTCTGAAGCTAAGG + Intergenic
1094372490 12:29753347-29753369 TCGCAGGACGTCTGCTGCTCAGG - Intronic
1100159361 12:91840391-91840413 TAGGAGGATCTCTTCAGCTCAGG - Intergenic
1101234449 12:102774776-102774798 GTGCAGGATCTCTGCAGCTTTGG + Intergenic
1101991121 12:109486038-109486060 TCTCAGCATCCATGCTGCTCAGG - Exonic
1102539003 12:113605037-113605059 ACACAGCATCTCTGCTGCCCAGG + Intergenic
1105242178 13:18618812-18618834 TGGCAGCAGCTGTGCAGCTCTGG - Intergenic
1108259894 13:48646026-48646048 TCCCTGTATCTCTGCAGCCCAGG - Intergenic
1108369715 13:49756179-49756201 TAGCAGGATCTCTTGAGCTCGGG + Intronic
1109220527 13:59636750-59636772 TTGCACCATCCCTGTAGCTCAGG + Intergenic
1114065771 14:19059031-19059053 TGGGAGCAGCTGTGCAGCTCTGG - Intergenic
1114096490 14:19340969-19340991 TGGGAGCAGCTGTGCAGCTCTGG + Intergenic
1115396843 14:32918423-32918445 TCTCATCATCTCTGAAGCTCAGG - Intergenic
1116203470 14:41830681-41830703 CCCCAGCTTCCCTGCAGCTCAGG - Intronic
1116416632 14:44685434-44685456 TCGCAGAAACTTTCCAGCTCTGG - Intergenic
1117714140 14:58563455-58563477 TGACAGCATCTTTGCAGCTTAGG + Intergenic
1119619693 14:76122888-76122910 TCCCAGCTTCTCTGGAGCTGAGG + Intergenic
1120277709 14:82398275-82398297 GCTCAGCATCTCTGCTGCTCAGG - Intergenic
1122084289 14:99289134-99289156 TCCCAGCTTCTCTGGAGGTCGGG - Intergenic
1123489137 15:20765785-20765807 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1123545636 15:21334872-21334894 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1125092731 15:35813155-35813177 TCTCCAAATCTCTGCAGCTCTGG + Intergenic
1129011872 15:72426923-72426945 CCCCAGCTTCTATGCAGCTCAGG - Intergenic
1131019375 15:89085534-89085556 GGGCATCTTCTCTGCAGCTCTGG - Intergenic
1202953978 15_KI270727v1_random:62142-62164 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1133774030 16:8884212-8884234 TCCCAGCATCTCCCCATCTCAGG + Intergenic
1134900274 16:17931943-17931965 TAGCAGTATCTCTGTAGCCCTGG - Intergenic
1135497151 16:22962683-22962705 TGGCCCCATCCCTGCAGCTCTGG + Intergenic
1136619131 16:31416409-31416431 TCCCAGGAACTCTGGAGCTCTGG - Intronic
1137906847 16:52332112-52332134 TGTCAGCATCTCTGCCACTCAGG + Intergenic
1140771782 16:78212151-78212173 TCCCAGCAGCTCTACAGCTGAGG - Intronic
1141167107 16:81668305-81668327 TCCCAGCACCTCCGCAGCCCTGG + Intronic
1144570718 17:16396767-16396789 TGGCAGCCTGTCTGCTGCTCTGG + Intergenic
1145362856 17:22226541-22226563 TGGCAGCCTGTCTGCTGCTCTGG + Intergenic
1146269203 17:31473447-31473469 TGGGAGCATCACTGCAGCCCAGG + Intronic
1146608692 17:34285732-34285754 TCTCAGCCTCTCTGCTCCTCTGG - Exonic
1146683199 17:34823266-34823288 TGCCAGCCTCCCTGCAGCTCGGG - Intergenic
1147314130 17:39611589-39611611 TCACTGCATCTCTGCATCTCTGG - Intergenic
1150390467 17:64787112-64787134 CTGCAGCTTTTCTGCAGCTCAGG - Intergenic
1150689279 17:67350542-67350564 TGGCTGCATCTCTGCATCTGAGG - Intronic
1152403985 17:80086233-80086255 TCTCAGCATCACTGCAGGGCCGG - Intronic
1152563647 17:81090736-81090758 CCGCAGCCTCCCCGCAGCTCGGG - Intronic
1153163965 18:2241201-2241223 TGGGAGGATCTCTCCAGCTCGGG - Intergenic
1154425671 18:14270259-14270281 TGCCTGCATCCCTGCAGCTCTGG + Intergenic
1154446772 18:14441068-14441090 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1155832584 18:30536379-30536401 AAGCAGAATCTCTGCAGCTGTGG + Intergenic
1163591409 19:18196159-18196181 TCCCAGCACCACTTCAGCTCCGG + Exonic
1167108180 19:47443264-47443286 TCTCAGCATCTCTGCTCCTATGG + Intronic
1167621865 19:50565228-50565250 GGGCTGCATCTCTGTAGCTCTGG + Intronic
925058479 2:873252-873274 CTGCAGCATCTCAGCAGCCCTGG + Intergenic
929419941 2:41780240-41780262 TTGCAGCATCTTTGTAGCTGAGG - Intergenic
931233314 2:60392385-60392407 TCCCAGCACCTCTGGAGCACTGG - Intergenic
932145396 2:69311180-69311202 TCACAGTATCTCTGCAGGTCTGG - Intergenic
932622318 2:73272152-73272174 TCCCACCATCCCTGGAGCTCAGG + Intronic
932811868 2:74833081-74833103 AAAGAGCATCTCTGCAGCTCTGG - Intergenic
933602406 2:84347085-84347107 TCACAGCATCTCTCCAGCAAGGG - Intergenic
934692425 2:96372009-96372031 TCGCGGGTTTTCTGCAGCTCAGG - Intronic
936671527 2:114662360-114662382 TGGAAGCTTCTCTGCAGCTCCGG - Intronic
942613960 2:177770452-177770474 TCGCAGGCTCCCTGCAGCTGGGG + Intronic
944299422 2:198106236-198106258 GTGCAGCATCTCTGCAGCACAGG - Intronic
944857622 2:203783699-203783721 TCACAGCCTCTGTGCAGCTGAGG + Intergenic
945609025 2:211974660-211974682 TGGGAGCATCTCTGGAGCCCTGG + Intronic
946410849 2:219514529-219514551 TCCCAGCAGCTCCGCAGCCCTGG - Exonic
948699196 2:239749833-239749855 AGGTAGCATCTCTGCAGCCCTGG - Intergenic
948830072 2:240594371-240594393 CCGAAGCAGCTCTGCAGCACAGG - Intronic
1170530436 20:17285925-17285947 TGGGATCATCTCAGCAGCTCTGG - Intronic
1171133606 20:22677411-22677433 TCCACGCCTCTCTGCAGCTCCGG - Intergenic
1171138394 20:22719271-22719293 CCGGAGCATCTCTGCAACTGGGG - Intergenic
1171960087 20:31487075-31487097 TGGGAGCATCTCTTGAGCTCAGG - Intergenic
1172175643 20:32970481-32970503 TCACAGCAACACTGCAGGTCAGG + Intergenic
1172325294 20:34029765-34029787 CCAAAGGATCTCTGCAGCTCTGG - Intronic
1172513326 20:35515458-35515480 CCACAGAACCTCTGCAGCTCTGG + Exonic
1173255042 20:41388183-41388205 TGGCAGGATCACTTCAGCTCGGG + Intergenic
1173470428 20:43319440-43319462 TCCCAGCTTCTCTGCAGGCCAGG + Intergenic
1174914433 20:54639971-54639993 GCCCACCATCTCTGCAGCTCTGG + Intronic
1175016955 20:55801901-55801923 TGGCAGCATCTTTGCATCCCTGG - Intergenic
1175157168 20:56978977-56978999 TCCCAGGATCCCTTCAGCTCAGG + Intergenic
1175781974 20:61688597-61688619 TCGCAGCATCTCTGCAGCTCCGG + Intronic
1176449202 21:6848772-6848794 TGGCAGCAGCTGTGCAGCTCTGG - Intergenic
1176827370 21:13713796-13713818 TGGCAGCAGCTGTGCAGCTCTGG - Intergenic
1176935009 21:14857508-14857530 GCTCAGCAGCTCTGCTGCTCTGG + Intergenic
1178601967 21:34002298-34002320 TGGGAGGATCTCTTCAGCTCAGG - Intergenic
1179025374 21:37675048-37675070 TCGGAGCTCCTCTGCTGCTCCGG + Intronic
1179145901 21:38767116-38767138 TAGCCGCGGCTCTGCAGCTCTGG + Intergenic
1180484253 22:15781623-15781645 TGGGAGCAGCTGTGCAGCTCTGG - Intergenic
1181567160 22:23746034-23746056 TCACTGCCACTCTGCAGCTCAGG + Intronic
1183275660 22:36895947-36895969 TCCCTGCATCCCTGCTGCTCTGG + Intergenic
949206342 3:1443118-1443140 TGTCAGCATTACTGCAGCTCTGG - Intergenic
952336760 3:32410265-32410287 TGGCTGCCCCTCTGCAGCTCAGG - Intronic
954391258 3:50269227-50269249 CCGCCCCATCTCAGCAGCTCAGG - Exonic
956876298 3:73467091-73467113 CTGCACCATCTCTGCAGCTGGGG - Intronic
957268760 3:78002559-78002581 TTGCAGCATCTCTCCAGCAAGGG - Intergenic
957344274 3:78942182-78942204 TCCCAGCAACTCAGGAGCTCAGG + Intronic
959729559 3:109585395-109585417 GAGCAGCATCACTGCAACTCAGG - Intergenic
964975898 3:162620203-162620225 TTGAAGCATCTTTGCATCTCAGG + Intergenic
969074227 4:4564657-4564679 TCCCAGCCTCTCTGCAGCTAGGG - Intergenic
969587807 4:8104561-8104583 TCTCAGCATCTCTGAAGGTCGGG + Intronic
969657254 4:8505421-8505443 TCCCAGCACCTCTGCAGCCCGGG + Intergenic
971325919 4:25643654-25643676 TGGCAGCCTCTTTGCAGCTCGGG + Intergenic
971990038 4:33880748-33880770 TCTCAGCAACTCTGCTGATCTGG + Intergenic
973916094 4:55636184-55636206 TCGCAGCATCTCGGCGGCTGCGG + Exonic
974581820 4:63813839-63813861 TCGCATCACCTCTGCAGCAAGGG - Intergenic
975328054 4:73082208-73082230 TCTCAGCATCTCTGCATTTTGGG + Intronic
976139474 4:81976026-81976048 TAGGAGGATCTCTTCAGCTCAGG - Intronic
977880668 4:102201215-102201237 TGCTAGCATCTCAGCAGCTCAGG + Intergenic
981104007 4:140859739-140859761 TAGCACCACCTCTGCAACTCAGG + Intergenic
985168444 4:187122920-187122942 TGGCAGCAACTCTGCAGCACAGG - Intergenic
988684522 5:33514306-33514328 TCCCAGCCTGTTTGCAGCTCAGG - Intergenic
990228984 5:53689899-53689921 TGGCAGCATCTCTTGAGCCCAGG + Intergenic
990324294 5:54659829-54659851 TCGCCTCACCTCTGCCGCTCTGG + Intergenic
990566432 5:57034251-57034273 TGGGAGGATCTCTTCAGCTCAGG + Intergenic
996759148 5:126969760-126969782 TAGCAGAATCTCTGCAGATGGGG - Intronic
996861472 5:128071935-128071957 TGGCAGGATCTCTTGAGCTCAGG - Intergenic
997643373 5:135464308-135464330 TCGCAGCATGGCTGGAGCACGGG - Intergenic
999813839 5:155155566-155155588 TCTCAGCATCCCTCCAGCCCAGG - Intergenic
1000944017 5:167398554-167398576 TCTCAGCATCTCAGCTGCTCGGG - Intronic
1001677441 5:173530393-173530415 TCCCAGCTTCTCAGCAGGTCTGG + Intergenic
1002399239 5:178982023-178982045 TGGCAGCCTCCATGCAGCTCTGG + Intronic
1003920321 6:10826709-10826731 TCCCAGCCTCCCTGCAGCTAGGG + Intronic
1005479801 6:26244826-26244848 TAGCAGCATCTCTCCAGACCAGG + Intergenic
1006406427 6:33848389-33848411 AAGCAGAATCTCTGCATCTCAGG - Intergenic
1007481575 6:42153785-42153807 GCCCAGCATCTCTGCATCTGGGG - Intergenic
1011599774 6:89049190-89049212 CAGCAGCATCTTTGCAGCACAGG - Intergenic
1012523402 6:100148000-100148022 TGGCAGCATCTATGCAGAACAGG - Intergenic
1016790655 6:148064284-148064306 CTGCAGCATCTCTGCAGATGGGG - Intergenic
1017097645 6:150818983-150819005 TCCCACCATCGCTGCAGCTGAGG + Intronic
1018315504 6:162552949-162552971 ACGCAGCCTCTCTCCAGCACTGG - Intronic
1018712590 6:166507269-166507291 TGGCAGCGCCCCTGCAGCTCTGG - Intronic
1019553507 7:1616971-1616993 TCACAGCAACTCTGCAGGGCAGG - Intergenic
1019637047 7:2081563-2081585 TCCCTGCATCACTGCAGCCCAGG + Intronic
1019832432 7:3346247-3346269 TGCCAGCTTGTCTGCAGCTCTGG + Intronic
1021660656 7:22915513-22915535 TCGCAGAATCCCTGGAACTCTGG + Intergenic
1023187386 7:37546454-37546476 TTGGAGCATCTCTGCAGAACAGG - Intergenic
1023821136 7:43981109-43981131 TGGGAGCATCTCTTGAGCTCAGG + Intergenic
1023823794 7:43995182-43995204 CCGCAGCCTCACTGCAGATCAGG - Intergenic
1024474729 7:49798474-49798496 TGGCAGCCTCTCTGTATCTCAGG + Intronic
1026961720 7:74412541-74412563 TCCCAGCTACTCTGGAGCTCTGG + Intergenic
1027180797 7:75937972-75937994 TAGCAGCATCTCTGCGGCCTTGG - Intronic
1027188527 7:75985385-75985407 TCTCAGCATCTGTCCAGCCCCGG + Intronic
1029704288 7:102267893-102267915 TGGTAGCATCGCTGGAGCTCAGG - Intronic
1029749409 7:102534548-102534570 TGGGAGCATCTCTTGAGCTCAGG + Intergenic
1029752062 7:102548595-102548617 CCGCAGCCTCACTGCAGATCAGG - Intronic
1029767355 7:102633653-102633675 TGGGAGCATCTCTTGAGCTCAGG + Intronic
1029770014 7:102647689-102647711 CCGCAGCCTCACTGCAGATCAGG - Intronic
1031487047 7:122339768-122339790 TCCCAGCTACTCTGCAGCTGAGG + Intronic
1032148530 7:129406556-129406578 TGGCAGCATCTCTGAGGATCTGG - Intronic
1032322162 7:130895498-130895520 TCTCTCCAGCTCTGCAGCTCGGG + Intergenic
1034164539 7:149015182-149015204 TGGCTGCATCTCTGCAGTTTTGG + Intronic
1035600939 8:896385-896407 TCACACCATCCCGGCAGCTCAGG - Intergenic
1036699689 8:11004088-11004110 TCGCTCCATCTCTGCAGCTCAGG - Intronic
1036793117 8:11736535-11736557 TGGCAGGAACTCTGCAGCCCAGG + Intronic
1037333480 8:17768025-17768047 TGCCAGCCTCTCTGCTGCTCAGG - Intronic
1037925164 8:22838679-22838701 TGGCAGCATCGCCCCAGCTCTGG - Intronic
1039793979 8:40896869-40896891 CCGGAGCATCCCCGCAGCTCTGG - Intronic
1043477377 8:80618780-80618802 TCCCAGCATCTCAGCTACTCGGG - Intergenic
1043877728 8:85505397-85505419 TCGCTCCATCACTCCAGCTCAGG - Intergenic
1046985490 8:120383390-120383412 TTGCAGCATCACTACTGCTCAGG - Intronic
1047152038 8:122274472-122274494 TCGCAGCACCTCTCCAGCAAGGG + Intergenic
1048066485 8:130974711-130974733 TCCCAGAATCCTTGCAGCTCTGG + Intronic
1048279782 8:133096617-133096639 ACCCAGAAGCTCTGCAGCTCAGG + Intronic
1048760725 8:137792091-137792113 TCGCATTATCTCTTCTGCTCTGG + Intergenic
1049117551 8:140702644-140702666 TGGCAGCATCTATCCAGGTCAGG - Exonic
1049719525 8:144109229-144109251 GTCCAGCATCTCCGCAGCTCCGG + Intronic
1049883543 9:13666-13688 TAGCAGGATCCCTGCAGATCAGG - Intergenic
1050294666 9:4193697-4193719 TCCCAGCCTCCCTCCAGCTCAGG - Intronic
1050302008 9:4268798-4268820 GGGCAGCATCTCCTCAGCTCTGG + Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056225746 9:84493491-84493513 TGGCAGTGTCTCTTCAGCTCTGG + Intergenic
1057566812 9:96172265-96172287 TTGCAGCATTTCTGGAACTCAGG + Intergenic
1057825896 9:98371858-98371880 TCTCAGCATCTCAGCAGTCCTGG - Intronic
1057951989 9:99376594-99376616 TCGAAGAATGTCTACAGCTCCGG + Intergenic
1058514229 9:105752773-105752795 TTGCAACATCTCTGCAGCAAGGG + Intronic
1059654437 9:116344731-116344753 TCAGAGCCTCTCTGCAGCCCAGG + Intronic
1060517267 9:124273749-124273771 TCGCAGCCTCACTGCAGCAGGGG + Intronic
1062232765 9:135491342-135491364 TCCCAGCACCTCCGCAGATCCGG + Intergenic
1062262234 9:135668584-135668606 TCGGAGCTTCTCTGCATCACAGG - Intergenic
1203519986 Un_GL000213v1:35744-35766 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1186109074 X:6236992-6237014 TAGCAGGATCTCTTGAGCTCAGG - Intergenic
1186121149 X:6362433-6362455 TCACAGCCGCTCTGCTGCTCTGG + Intergenic
1188991098 X:36822010-36822032 TCCCAGCTACTCTGGAGCTCAGG - Intergenic
1192333132 X:70195663-70195685 TGGGAGCATCACTTCAGCTCAGG + Intronic
1193761997 X:85478458-85478480 TCACAGCATCTCTGCACCAGGGG - Intergenic
1196396703 X:115271383-115271405 GCTCTGCAGCTCTGCAGCTCTGG + Intergenic
1200359973 X:155594251-155594273 TAGCAGAAACTCTGCAGGTCAGG + Intronic
1200402273 X:156026483-156026505 TAGCAGGATCCCTGCAGATCAGG + Intergenic