ID: 1175786215

View in Genome Browser
Species Human (GRCh38)
Location 20:61713234-61713256
Sequence CAGGATGTGCACCTTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175786215_1175786221 24 Left 1175786215 20:61713234-61713256 CCAGGTTCAAGGTGCACATCCTG 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1175786221 20:61713281-61713303 ATGCTGAGCTTCAAGGTGCATGG 0: 1
1: 0
2: 1
3: 25
4: 197
1175786215_1175786220 17 Left 1175786215 20:61713234-61713256 CCAGGTTCAAGGTGCACATCCTG 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1175786220 20:61713274-61713296 CTTTGCAATGCTGAGCTTCAAGG 0: 1
1: 0
2: 2
3: 16
4: 235
1175786215_1175786223 26 Left 1175786215 20:61713234-61713256 CCAGGTTCAAGGTGCACATCCTG 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1175786223 20:61713283-61713305 GCTGAGCTTCAAGGTGCATGGGG 0: 1
1: 0
2: 0
3: 12
4: 171
1175786215_1175786222 25 Left 1175786215 20:61713234-61713256 CCAGGTTCAAGGTGCACATCCTG 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1175786222 20:61713282-61713304 TGCTGAGCTTCAAGGTGCATGGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175786215 Original CRISPR CAGGATGTGCACCTTGAACC TGG (reversed) Intronic
902811561 1:18890926-18890948 CAAGATGTGGACCATGAACTTGG + Intronic
903755586 1:25658279-25658301 CAGGTTGTGAACCTGGAGCCAGG + Intronic
903862753 1:26374760-26374782 CCGAATGTGCCCCTTGCACCTGG - Intergenic
906786954 1:48624504-48624526 CATGATGTGCACCTTAACCAGGG + Intronic
907686185 1:56614107-56614129 CACGTTGTGCACCTGGACCCTGG + Intronic
914048261 1:144108187-144108209 CAGGATGAACTGCTTGAACCTGG + Intergenic
914130923 1:144857261-144857283 CAGGATGAACTGCTTGAACCTGG - Intergenic
914881357 1:151549326-151549348 CAGGATTTGCTCCTTGACTCTGG + Intronic
915265476 1:154713636-154713658 CAGCATGGGGACCGTGAACCTGG + Intronic
915324727 1:155075486-155075508 CAGGTTCTGCACCTTGCACAGGG - Intergenic
915574506 1:156766881-156766903 CTGGATGTGCACCCCGATCCTGG + Intronic
917609061 1:176667686-176667708 ATGGATGTGCACCTTGAGACTGG - Intronic
917837475 1:178952799-178952821 CAGAATGAGAGCCTTGAACCAGG + Intergenic
918589530 1:186224629-186224651 CAGGAATTGTACCCTGAACCTGG - Intergenic
1065664267 10:28041060-28041082 CAACATGAGCACCTTGAATCAGG + Intergenic
1065807432 10:29407837-29407859 CAGGAATTGTACCCTGAACCTGG + Intergenic
1066449095 10:35511829-35511851 GAGGAAGTGAACCGTGAACCTGG + Intronic
1067823105 10:49548361-49548383 CAGGAATTGAACCCTGAACCCGG + Intergenic
1072540383 10:96394066-96394088 CAGGCTGTTCACGTAGAACCTGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077521445 11:3037752-3037774 CAGGAGGTGCACTTGGAACGTGG - Intronic
1080776522 11:35392235-35392257 AAAAATGTGCACCTTAAACCAGG - Intronic
1088759120 11:112912772-112912794 CAGGATGTGCTGGATGAACCTGG + Intergenic
1089605325 11:119638228-119638250 CAGGTTGTCCACCTGGACCCAGG - Intronic
1093324780 12:17760205-17760227 CAGGATGGGGACCCTGGACCCGG + Intergenic
1100825246 12:98468695-98468717 CAGGAAGTATCCCTTGAACCTGG + Intergenic
1101738276 12:107480072-107480094 AAGGATGTGGACTTTGAGCCAGG + Intronic
1102654600 12:114471194-114471216 CAGGATGTCCACCTTGATGGAGG - Intergenic
1108508001 13:51129969-51129991 CAGGAATTGAACCCTGAACCCGG - Intergenic
1113504648 13:110806925-110806947 CCGGTTGTGCACCTTGGACAGGG - Intergenic
1114032408 14:18588443-18588465 CCAGATGTGCACCCGGAACCTGG - Intergenic
1114077188 14:19167469-19167491 CCAGATGTGCACCCGGAACCTGG - Intergenic
1114084975 14:19232095-19232117 CCAGATGTGCACCCGGAACCTGG + Intergenic
1116989583 14:51261469-51261491 CAGGTTGTGCACTTTGAACCTGG + Intergenic
1119877876 14:78075864-78075886 CAGTATCTGCCCCTTCAACCAGG - Intergenic
1122229389 14:100298067-100298089 CAGGATGCGCACCCTGAGCTGGG - Intronic
1127578667 15:60316758-60316780 CAGGTTGTGCCCCATGAAGCTGG - Intergenic
1128670226 15:69569130-69569152 CAAGATGTGCACCCTGAAACAGG + Intergenic
1129114668 15:73358553-73358575 AAGGCTGTGCACCTAGGACCAGG + Intronic
1129433672 15:75520362-75520384 CAGGATGAGCACTTTGATCTGGG - Intronic
1131114518 15:89785637-89785659 CAGGACGTCCACCTTGCTCCCGG + Intronic
1132823554 16:1890540-1890562 GAGGCTGTGCACATTTAACCAGG + Intergenic
1132988239 16:2779158-2779180 CAGGATGTCCACCAGAAACCAGG + Intergenic
1135299911 16:21317412-21317434 CTGGTTGTGCTTCTTGAACCTGG + Intergenic
1136142560 16:28296834-28296856 CAAGACCTGCACCTAGAACCAGG - Intronic
1137309816 16:47244084-47244106 CAGGATGTGCTCTTGGCACCTGG - Intronic
1141152011 16:81570751-81570773 CAGAATGGGGACCTGGAACCAGG - Intronic
1142127618 16:88418040-88418062 CAGGAGCTGCTCCTTGAACCTGG - Intergenic
1144102281 17:11952384-11952406 CAGGAGGAGCACTTTGAGCCCGG - Intronic
1144147675 17:12414045-12414067 CAGGAAGTACATCTTAAACCCGG + Intergenic
1146420942 17:32685070-32685092 AAGGATGTGCACCTTTTCCCTGG - Intronic
1149959538 17:61092997-61093019 CAGGATAATCACTTTGAACCTGG - Intronic
1203171141 17_GL000205v2_random:148692-148714 GAGGATGTACACCTTGAGCGTGG - Intergenic
1153816822 18:8798087-8798109 CTGGATGTTCACCCTGAAACAGG - Exonic
1155066972 18:22276431-22276453 CAGGATGTGACCCATGACCCAGG + Intergenic
1157243307 18:46031838-46031860 CAAGATGTTCTCCTAGAACCCGG + Intronic
1157396499 18:47346014-47346036 GTGGATGTGCACCCTTAACCAGG - Intergenic
1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG + Exonic
1160270527 18:77379450-77379472 CAGGACGCACACCTGGAACCTGG - Intergenic
1160560328 18:79751972-79751994 CAGGCTGTGCACATTTAACCAGG + Intronic
1160856603 19:1220678-1220700 CCAGATGTCCACCTTGAAGCCGG - Exonic
1162464985 19:10834551-10834573 CAGGAGGTGGAAGTTGAACCTGG - Intronic
1165242053 19:34476789-34476811 CAGAACGTGCATCTTGAGCCTGG + Intergenic
1165416476 19:35697089-35697111 CAGGAAGTCCACCTGGAGCCAGG - Intergenic
1167408963 19:49333869-49333891 CTGGGTGTGCACCTGCAACCAGG + Intergenic
1167537240 19:50061947-50061969 CATGATGGGCACCTGGTACCTGG + Intergenic
1202687713 1_KI270712v1_random:61082-61104 CAGGATGAACTGCTTGAACCTGG + Intergenic
925153354 2:1632646-1632668 GAGGATGTGCACCTGGAACACGG + Exonic
926060742 2:9803168-9803190 CTGACAGTGCACCTTGAACCTGG - Intergenic
933958640 2:87394503-87394525 CAGGATGAACTGCTTGAACCTGG - Intergenic
938490609 2:131759092-131759114 CCTGTTGTGCACCTGGAACCTGG + Intronic
940450407 2:153828567-153828589 CAGCATGGAGACCTTGAACCTGG + Intergenic
941639559 2:167972499-167972521 CAGGAATTGAACCCTGAACCCGG - Intronic
946326447 2:218986865-218986887 CAGGATGTGGACCTGGAATCTGG + Intergenic
948100172 2:235366802-235366824 GAGGGTGTGGACCTTGAACCCGG + Intergenic
948238017 2:236404868-236404890 CAGAATCTGCACCTTGATCTAGG - Intronic
948995819 2:241577703-241577725 CAGGAGGGGCACCTTGAGCATGG - Intergenic
1172033813 20:31998268-31998290 CTAGATGTGCACCTGGAACGTGG + Exonic
1173741024 20:45402048-45402070 CAGCATCTGCATCTTGCACCTGG + Intronic
1174417189 20:50375196-50375218 CAAGATGTGAACCTTGAGCAAGG - Intergenic
1175786215 20:61713234-61713256 CAGGATGTGCACCTTGAACCTGG - Intronic
1175854448 20:62112894-62112916 CTGGCTGTGCCCCTTGAACCAGG - Intergenic
1176327125 21:5510522-5510544 GAGGATGTACACCTTGAGCGTGG - Intergenic
1176400632 21:6310429-6310451 GAGGATGTACACCTTGAGCGTGG + Intergenic
1176436525 21:6678675-6678697 GAGGATGTACACCTTGAGCGTGG - Intergenic
1176460787 21:7005745-7005767 GAGGATGTACACCTTGAGCGTGG - Intergenic
1176484348 21:7387523-7387545 GAGGATGTACACCTTGAGCGTGG - Intergenic
1178435843 21:32557830-32557852 CAGGAATTGAACCCTGAACCTGG + Intergenic
1180292995 22:10861098-10861120 CCAGATGTGCACCCGGAACCTGG - Intergenic
1180456519 22:15515500-15515522 CCAGATGTGCACCCGGAACCTGG - Intergenic
1180495800 22:15890520-15890542 CCAGATGTGCACCCGGAACCTGG - Intergenic
1180620108 22:17155670-17155692 CAGGATGTACACAGAGAACCAGG + Intronic
1183053599 22:35286475-35286497 GAGGATGATGACCTTGAACCTGG - Intronic
1185418424 22:50721973-50721995 CAGCATGTCCACCTTGAGCTCGG + Intergenic
954322244 3:49840130-49840152 CAGGGTGTGCCCCTTGGCCCTGG - Intronic
954368049 3:50156469-50156491 CAGTATGTCCACCCTGAAGCTGG + Intronic
961443143 3:126964764-126964786 CAGGGTGTGCACCTGGAGGCGGG + Intergenic
961676831 3:128572735-128572757 CAGGGGGAGCACCTTTAACCAGG + Exonic
961809208 3:129512358-129512380 CAGGCTGTGCAGCAGGAACCTGG - Exonic
967152896 3:186665897-186665919 GAGGGTGTTCACCTTGACCCTGG - Intronic
969634665 4:8360152-8360174 CAGGAATTGAACCCTGAACCTGG - Intergenic
969714514 4:8861767-8861789 GAGGATGGGCGCCTTGATCCCGG - Intronic
972366790 4:38383415-38383437 CAGGGTGTGCACCACTAACCTGG - Intergenic
974274460 4:59699859-59699881 CAGGATCTGCATCTTGAAAGAGG - Intergenic
974390621 4:61262068-61262090 CATGATGAGCACCTTCAACATGG - Intronic
974965893 4:68760343-68760365 CAGGATGTGCAACTGCCACCAGG - Intergenic
978036236 4:103998820-103998842 CAGGATTCGTACCTAGAACCAGG - Intergenic
984915029 4:184715403-184715425 CAGGAGAATCACCTTGAACCCGG - Intronic
986050835 5:4088679-4088701 CAGGATTGCCACCTTGAATCTGG - Intergenic
990649106 5:57878184-57878206 CAGGATCTACATCTAGAACCAGG + Intergenic
991303379 5:65150405-65150427 CAGGATGTGAAACTTGAAGATGG + Exonic
993745552 5:91592780-91592802 CAGGAATTGAACCCTGAACCAGG + Intergenic
994706690 5:103215568-103215590 CAGGAGAATCACCTTGAACCTGG - Intergenic
995547635 5:113248784-113248806 CAGCATGTGCACTGAGAACCAGG - Intronic
1000658044 5:163906080-163906102 CAGGAAGTGAACCTTCCACCAGG + Intergenic
1002149108 5:177212174-177212196 CAGGCTGAGCTCCCTGAACCAGG + Exonic
1008925013 6:56882958-56882980 CAGGAGGATCAGCTTGAACCTGG - Intronic
1011437315 6:87351962-87351984 TAGCATGTGAACCTTGAAACAGG - Intronic
1017300749 6:152855047-152855069 CAGGAGAATCACCTTGAACCTGG + Intergenic
1018138057 6:160797236-160797258 CAGGAATTGAACCCTGAACCTGG - Intergenic
1018514824 6:164567964-164567986 CAGTAAGTGCACAGTGAACCAGG - Intergenic
1021192958 7:17643607-17643629 CAGCATGGGGACCTTGGACCTGG - Intergenic
1025253452 7:57367341-57367363 CAAGATGTGAACCTTGAGCAAGG + Intergenic
1029508573 7:100978361-100978383 CAGAATGTGCACCTAGAACTGGG + Intronic
1031949328 7:127875734-127875756 CAGGATGTCCACCATGGAACAGG - Intronic
1032433374 7:131880773-131880795 CAGGATGTTCTTCTTGTACCTGG + Intergenic
1033448162 7:141439846-141439868 CAGGATCTGAACCTTGTGCCTGG - Intronic
1033832670 7:145272347-145272369 GAGGAGGTGAAACTTGAACCTGG + Intergenic
1036681856 8:10880231-10880253 TAGCATGCTCACCTTGAACCAGG + Intergenic
1037619184 8:20548387-20548409 CAGGAGGTGGAGGTTGAACCCGG + Intergenic
1040467823 8:47711553-47711575 CAGGAAGCCCACCTAGAACCCGG - Intronic
1042862417 8:73327768-73327790 CTGCATGTCCACCTTGACCCAGG - Intergenic
1043887014 8:85612599-85612621 CAGGATGTGACACTTGAATCTGG - Intergenic
1045341289 8:101256945-101256967 CAGGATGGGCACCTGGAGCCGGG + Intergenic
1045742765 8:105381238-105381260 CAGGATATGAACCTTCATCCAGG - Intronic
1049826177 8:144670305-144670327 CAGGATCAGCACCTGGGACCAGG + Intergenic
1050276580 9:4007391-4007413 AAGGAAGGGGACCTTGAACCAGG - Intronic
1052188171 9:25624135-25624157 CAGCATGTGAAGATTGAACCTGG - Intergenic
1055141955 9:72886582-72886604 CAGCATGGGCACCTTGAGCCTGG - Intergenic
1061282158 9:129603628-129603650 CAGGTTGTGTCCCTTGCACCAGG + Intergenic
1189496638 X:41514712-41514734 CAGGATGGGCACCAGGAGCCTGG + Intergenic
1194288310 X:92038311-92038333 CAGCATGGGGACCTTGAGCCTGG - Intronic
1195770621 X:108347295-108347317 GAGGATGTGCACCTTCCACATGG + Intronic
1200605833 Y:5262876-5262898 CAGCATGGGGACCTTGAGCCTGG - Intronic
1200884637 Y:8254908-8254930 CAGTCTCTGCACCTTGAAACAGG - Intergenic
1201358946 Y:13125674-13125696 CATCATGAGCATCTTGAACCTGG + Intergenic