ID: 1175786271

View in Genome Browser
Species Human (GRCh38)
Location 20:61713597-61713619
Sequence GCCAAAGACTCCCCCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175786264_1175786271 27 Left 1175786264 20:61713547-61713569 CCTCTGCTTATGTAGCAGCACAG 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1175786271 20:61713597-61713619 GCCAAAGACTCCCCCAGAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175786271 Original CRISPR GCCAAAGACTCCCCCAGAAA AGG Intronic
902721140 1:18304988-18305010 GGCAAAGATTCTCCCAGAACTGG - Intronic
902801562 1:18833164-18833186 GCCACAGAGACACCCAGAAAAGG - Intergenic
903214339 1:21835007-21835029 GCCATAGACTGCCCAAGGAAAGG + Intronic
904744758 1:32703598-32703620 GTCAAAGACCTCCCCAGACAGGG - Intergenic
905886093 1:41493032-41493054 ACCAAAGAGTCCCCCAGAACAGG + Intergenic
906155706 1:43612818-43612840 GCCAAAGTATCCCCCAAACACGG - Intronic
908219260 1:61987596-61987618 GCCATAGAGTCCCCCAGGGATGG - Intronic
908748280 1:67396225-67396247 TCCTAAGACTCCCCCAGAGCTGG - Exonic
916573980 1:166051013-166051035 GCCAAAAGCTACCACAGAAATGG - Intergenic
916691779 1:167196855-167196877 ACCACAGAGCCCCCCAGAAAGGG + Intergenic
918693058 1:187506795-187506817 CCCAAAGTCTCTCCCACAAAAGG + Intergenic
920460052 1:206132464-206132486 GCCAAAGGATCCCCTGGAAATGG + Intergenic
921941831 1:220849088-220849110 CCTAAAGACTCCACCAAAAAAGG - Intergenic
1065314224 10:24446556-24446578 ACAAAAGAATCCCACAGAAATGG + Intronic
1069908951 10:71748355-71748377 GCCACGGACTCCCCCAGGCAGGG + Exonic
1075969465 10:126640220-126640242 GACAGAGGCTCCCCCAGAAGTGG - Intronic
1076349734 10:129807795-129807817 GGCACAAACTCCCACAGAAAAGG - Intergenic
1077774054 11:5252189-5252211 TCCAAAGCCTCCCCCACAAATGG + Intronic
1079493566 11:21015885-21015907 GCAAAACAGTCACCCAGAAACGG - Intronic
1084147391 11:67272299-67272321 TCCAAAGGCTCCCTGAGAAACGG - Intronic
1085015345 11:73170152-73170174 GCCCAGGACTCCCACAGATACGG - Intergenic
1085019049 11:73193575-73193597 TCCAAAGCCTCCTCCAGAGAGGG - Intergenic
1087129459 11:94655798-94655820 GTCAAAGGTTACCCCAGAAAAGG + Intergenic
1089122345 11:116146235-116146257 CCCAAAGGCACCCCCAGCAAAGG + Intergenic
1089513519 11:119016643-119016665 GCAAAAGACTGTCTCAGAAAGGG - Intronic
1092330044 12:7578222-7578244 GCCAAAGACACTGCAAGAAAAGG - Intergenic
1097274498 12:57803195-57803217 GAGAAAGACTCCCACAGTAAGGG - Intronic
1097356578 12:58608877-58608899 GCCAAAGAGTAGTCCAGAAAAGG - Intronic
1100577967 12:95910151-95910173 CCCAAAGACTCCACCAAAAGAGG + Intronic
1101323105 12:103690793-103690815 ACCACAGACTAACCCAGAAAGGG + Intronic
1101659402 12:106752691-106752713 GCCGAAGAATCCTCCTGAAATGG + Intronic
1104568882 12:129908110-129908132 CCCAAACTCTCCCCCTGAAAGGG - Intergenic
1104606511 12:130193374-130193396 GCCAGAGACTTTCCCAGAATTGG - Intergenic
1108101082 13:46956609-46956631 TCCAAAGGCTTCCCCAAAAATGG - Intergenic
1111091820 13:83456521-83456543 GATAAGGACTCCACCAGAAAAGG - Intergenic
1112091593 13:96090032-96090054 GCCAAAGCCTCCCCCAGCCCCGG - Intergenic
1112149052 13:96736286-96736308 GGCAAAGACACCCCAAGCAAAGG + Intronic
1112365322 13:98751553-98751575 GCCACAGTCTCCGCCAGAGAGGG + Intronic
1113316607 13:109186874-109186896 GCCCAAGATTCCCCTAGAAATGG + Intronic
1113824585 13:113241474-113241496 GGCACAGACTCTCCCAGAGAGGG - Intronic
1113842176 13:113366416-113366438 TGCAAAGCCTCCCCCGGAAAGGG - Intergenic
1118516122 14:66530436-66530458 GCCATTCACTCCCCCGGAAAGGG - Intronic
1118617971 14:67588072-67588094 TGCAAAGACTGCCCCAGAAGGGG - Exonic
1118770132 14:68937323-68937345 GCCAAATAATCCCAGAGAAATGG - Intronic
1119830400 14:77697039-77697061 GCCAAAGAGACCTCCAGAAGAGG + Intronic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1123143527 14:106106230-106106252 CCTAAAGACTCCACCAAAAAAGG - Intergenic
1129231526 15:74199632-74199654 GCCAGAGGCTCCCCCAGGCAGGG - Intronic
1129833448 15:78685714-78685736 GCCAGAGACTAGGCCAGAAAAGG - Intronic
1129876419 15:78978616-78978638 GCCAATGACCTCCCCAGAGAAGG - Intronic
1132072246 15:98788559-98788581 GGAAAAGACTCCCCCAAACAGGG - Intronic
1132943182 16:2518619-2518641 GCCAAACATTCTGCCAGAAAGGG - Intronic
1135796388 16:25446985-25447007 GCCAAAGATTCTCCTATAAAAGG - Intergenic
1140215475 16:73003880-73003902 GCCAAATGATCCTCCAGAAAGGG + Intronic
1141407690 16:83808234-83808256 GCCAGAGACGCTTCCAGAAACGG - Intronic
1143343398 17:6231896-6231918 GCTGCAGACTCCCCCAGCAAAGG - Intergenic
1145353579 17:22113631-22113653 AACAAAAACTCCCCCTGAAAAGG - Intergenic
1146058734 17:29593631-29593653 GCCAACGCCTCCGCCAGGAAGGG + Exonic
1147624717 17:41892626-41892648 GGCAAAGCCTTCCCCAGCAAAGG + Intronic
1147899922 17:43777464-43777486 GCCAAGGACTGCCACGGAAATGG - Intronic
1149030344 17:52075702-52075724 CCAAAATATTCCCCCAGAAACGG + Intronic
1150813871 17:68377706-68377728 GAAAAAGATTCCCCCACAAAAGG + Intronic
1151596205 17:75079318-75079340 GCCCAGGACTCCCCCAAATAAGG - Intergenic
1151957891 17:77389562-77389584 GTCAAAGACTCCCTGATAAATGG - Intronic
1158912934 18:62085917-62085939 ACCATAGACACCCACAGAAATGG + Intronic
1160801594 19:972875-972897 GCCCAACGCACCCCCAGAAATGG - Exonic
1161076385 19:2287906-2287928 GCCAAAACCTCAGCCAGAAAGGG - Intronic
1161277838 19:3428758-3428780 GCCAGGGAGTCCCCCAGAGATGG + Intronic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1162927837 19:13938897-13938919 GCCAACCATTACCCCAGAAAGGG - Intronic
1165654369 19:37520444-37520466 AGCAAAGACTCCCACATAAAAGG + Intronic
1166169788 19:41019592-41019614 GCAAAATGCTCCCCCAGGAAGGG - Intergenic
1166280503 19:41789424-41789446 GCCAAATACTCAGCTAGAAAGGG + Intergenic
1167725579 19:51210892-51210914 GCCAGAGACTCGCCCAGAGATGG - Intergenic
1167727249 19:51224902-51224924 GCCAGAGACCCGCCCAGAGATGG - Intergenic
927427621 2:22998346-22998368 GCAAAAGAACCCCCCAAAAAAGG + Intergenic
929245567 2:39698615-39698637 ACCAAAGACACCACAAGAAAAGG - Intronic
929465966 2:42144252-42144274 GCCTACCACTCCCCCAGAAGTGG + Intergenic
930451076 2:51539062-51539084 GACCAAGACTCCCCAAAAAAGGG + Intergenic
931474813 2:62576782-62576804 GCCACTAACTTCCCCAGAAAGGG + Intergenic
934546506 2:95221460-95221482 GACACAAACTCCCCCAGAGATGG - Intronic
935257922 2:101328819-101328841 GACAAGGAGTCCACCAGAAATGG + Intergenic
935333218 2:101992804-101992826 GCCTGAGCCTCCACCAGAAATGG - Intronic
935587605 2:104815853-104815875 ACCACAGACTCCTCCAGCAAAGG + Intergenic
937502022 2:122489497-122489519 TCCACAGAATCCACCAGAAAAGG - Intergenic
937849564 2:126620610-126620632 GCCCAAAACTCCACCAGGAATGG + Intergenic
938044285 2:128102726-128102748 GACTAAGACTCTCCCAGTAAAGG - Intronic
938312894 2:130305366-130305388 GCCAGAGACTCACCAGGAAATGG + Intergenic
940827091 2:158424728-158424750 GGGAAAGAATCCCCCAAAAAGGG + Intronic
944057372 2:195537020-195537042 GGCAAAGAGTCCCCCAGATGAGG + Intergenic
944783219 2:203041221-203041243 CCCTAAGACTCCCACAGCAATGG + Intronic
945198438 2:207258585-207258607 GCAAAAGCCTCCCCCAGGCAGGG - Intergenic
947847968 2:233260866-233260888 GGCAAAGATTTCCCCAGACAAGG - Intronic
948394379 2:237633461-237633483 GCTCAAGAGTCACCCAGAAAAGG - Intronic
1171125045 20:22595387-22595409 GCCAAAGACTGCTCCAGAATTGG + Intergenic
1171563839 20:26157820-26157842 AACAAAAACTCCCCCTGAAAAGG - Intergenic
1172514827 20:35526136-35526158 GCCAAAGACTACCCCAGGAATGG + Intronic
1173320360 20:41982025-41982047 GGCATTGACTCCCCCAGAGATGG - Intergenic
1175786271 20:61713597-61713619 GCCAAAGACTCCCCCAGAAAAGG + Intronic
1176010413 20:62890643-62890665 GCCCAAGGCTCAGCCAGAAAGGG - Intronic
1176190792 20:63808611-63808633 GACAGAGCCTCCCCCAGAGAAGG + Intronic
1177276220 21:18916059-18916081 GGCAAAGACTACCTCAGACATGG + Intergenic
1178366074 21:31989833-31989855 AGCAAAGACACCCACAGAAATGG - Intronic
1178624869 21:34206077-34206099 CCCAAACAATCCCCTAGAAATGG + Intergenic
1178631035 21:34261645-34261667 TCCAAACACTCCCCTAGAAGAGG - Intergenic
1180092564 21:45540492-45540514 GCCAGAGTCTCCGCCAGCAAGGG + Intronic
1185397097 22:50598300-50598322 GGCCCAGACTCCCTCAGAAATGG + Intronic
949722696 3:7009544-7009566 TTGAAAGAGTCCCCCAGAAATGG - Intronic
952314267 3:32218813-32218835 GTCAAGGACCCTCCCAGAAACGG - Intergenic
952499049 3:33942306-33942328 GCCAAAGACAAGCCCAGAATGGG - Intergenic
953640620 3:44703785-44703807 GCCTATGACTGCCTCAGAAATGG - Intergenic
954848192 3:53578096-53578118 GCCACAGACACCCCAGGAAAGGG - Intronic
956384934 3:68706382-68706404 GCCACAAACTTCCCCAGTAAGGG - Intergenic
956928610 3:74017049-74017071 GCCAAAGAATCTCCCAGATCAGG - Intergenic
959308459 3:104698815-104698837 ACCATAGACTCCACCAAAAATGG - Intergenic
961255926 3:125552357-125552379 GTCAAAGACTCCCCCGATAAAGG + Exonic
962331296 3:134481039-134481061 GCCATAAACTTCTCCAGAAATGG + Intronic
962751347 3:138436572-138436594 GCCAAAGACTCTTCCTGATAAGG + Intronic
964223034 3:154368158-154368180 GCCAGAGGCTCCCCCTGCAAGGG + Intronic
966872064 3:184297296-184297318 GCCAATGACTCCCCCAGCGCTGG - Intronic
968573608 4:1354913-1354935 GCCACAGTCCCCCCAAGAAAGGG - Intronic
968802145 4:2750254-2750276 GCCCAAGCTTCCCCCAGAAGTGG + Intronic
969501343 4:7555352-7555374 TCCAAAGACACCCCCAGCCATGG + Intronic
974606840 4:64163748-64163770 TTCAAAGACACCTCCAGAAAAGG - Intergenic
975237802 4:72020786-72020808 AGCAAAGACCCCCCCAGAAGAGG - Intergenic
975415554 4:74100098-74100120 GCCATAGACACCACCAGAAAAGG + Intergenic
978450674 4:108829780-108829802 GCCAGTGACTGCCTCAGAAATGG + Intronic
978916929 4:114138173-114138195 ACCACAGACTCCCCCATAATTGG - Intergenic
980106321 4:128591885-128591907 TACAAAGGCTTCCCCAGAAATGG - Intergenic
984201633 4:176728449-176728471 GCCAAATAGTCCGCCTGAAAAGG - Intronic
985889322 5:2703419-2703441 GCCCAATTCTCCTCCAGAAATGG + Intergenic
986963622 5:13244458-13244480 GCCCAAGCCTCCCCCAGCCATGG + Intergenic
988407431 5:30841529-30841551 GCCAAAAACTGCCAAAGAAATGG + Intergenic
988867728 5:35354031-35354053 GCCATTCACTCCCCTAGAAAGGG - Intergenic
991437431 5:66610881-66610903 GCCCAAGACTCCTTCACAAATGG + Intronic
992139307 5:73780011-73780033 GCCCAAGACACCCCCAGCACAGG - Intronic
992448516 5:76855130-76855152 GCAGAAGACTGCCCCAGGAATGG + Intronic
992537757 5:77728245-77728267 GAAAAAGAGGCCCCCAGAAAGGG + Intronic
996556059 5:124780016-124780038 GCCAACGACATCCTCAGAAAAGG + Intergenic
997466702 5:134092962-134092984 GCCAAAGACACCTGCAGCAAAGG + Intergenic
998381651 5:141730159-141730181 GCCAAAGACAGCCTCATAAAGGG - Intergenic
999282480 5:150374665-150374687 GCCAAGGAGTCCCCCAGGAAAGG + Exonic
999282571 5:150375002-150375024 GCCAAGGAGTCCCCCAGGAAAGG + Exonic
999283381 5:150379580-150379602 GCCAAGGAGTCCCCCAGGAAAGG + Exonic
1005928380 6:30463505-30463527 ACCACTGACTCCTCCAGAAAAGG + Intergenic
1008078860 6:47173960-47173982 ACTGAAGACTCCCCCAGAGATGG - Intergenic
1008425244 6:51349296-51349318 ACCATTCACTCCCCCAGAAAGGG - Intergenic
1008695999 6:54037849-54037871 GCCAAAGACAACCCCACAACTGG - Intronic
1011157190 6:84346173-84346195 GACAAAAACTGCCACAGAAAGGG - Intergenic
1013541766 6:111117523-111117545 GCCAAAGTCTGACCCTGAAATGG + Intronic
1014852629 6:126360941-126360963 GCCCACTACTCCCCCAGGAATGG - Intergenic
1016879656 6:148898491-148898513 GCCAAACACTTCCACATAAATGG - Intronic
1021783132 7:24126072-24126094 AGGAAAGACTCCCCCAGGAAAGG + Intergenic
1026683698 7:72490152-72490174 TCAAAAGAGTCCTCCAGAAATGG + Intergenic
1027911812 7:84260912-84260934 GCCACAGACTCCACCTGGAATGG - Intronic
1028151372 7:87377416-87377438 GCCAAATACTCCATTAGAAAAGG - Exonic
1031244380 7:119289707-119289729 GCCACAGACAGCCTCAGAAAGGG - Intergenic
1033226542 7:139567504-139567526 CTCAAAGACGCCTCCAGAAATGG - Exonic
1035549839 8:513189-513211 GACAAAGACACCACGAGAAAAGG + Intronic
1036110362 8:5893025-5893047 GCTAAAAACTCCACCAAAAAAGG + Intergenic
1044273411 8:90273074-90273096 TCCACTGACACCCCCAGAAAGGG + Intergenic
1045413568 8:101944195-101944217 GACAAAGACTCTCTCAAAAAGGG - Intronic
1045705695 8:104920143-104920165 GCCAAAGACTCCACCACCTAGGG + Intronic
1046761485 8:118025978-118026000 GACAAAGGCTCACGCAGAAAAGG + Intronic
1049870800 8:144974162-144974184 GCATAAAACTCCTCCAGAAATGG + Intergenic
1053140966 9:35682464-35682486 GACAAAGACTGCGCCAGGAAAGG + Intronic
1053473726 9:38366055-38366077 GACAAAGACTCTCCAAAAAAAGG - Intergenic
1056895259 9:90540796-90540818 GCCAAAGACTCTCCAATAAATGG + Intergenic
1057041020 9:91847460-91847482 CACATATACTCCCCCAGAAAGGG + Intronic
1059080587 9:111244943-111244965 GCCAAAGTCTCCTCCAAAAATGG - Intergenic
1059277013 9:113106136-113106158 CCCAACGACTGCCTCAGAAATGG - Intergenic
1059279238 9:113118415-113118437 CCCAACGACTGCCTCAGAAATGG + Intergenic
1059480716 9:114587388-114587410 GCCAAAGAAAGTCCCAGAAAGGG + Intergenic
1060730108 9:126031590-126031612 GCCAAGGATTCCCCCAGGGATGG - Intergenic
1061423669 9:130485935-130485957 GCCAAAAAAGCCACCAGAAAGGG - Intronic
1062197582 9:135282810-135282832 GCCAAGGAGGCCCCCAGAACAGG - Intergenic
1203625587 Un_KI270750v1:17024-17046 AACAAAAACTCCCCCTGAAAAGG + Intergenic
1188845103 X:35062564-35062586 TCCAAAGACTCCCCCTTAAGTGG + Intergenic
1190725858 X:53190157-53190179 CCCAGATACTCCCCTAGAAAGGG - Intergenic
1190889828 X:54558363-54558385 TCCAAAGACTTCTGCAGAAAAGG - Intronic
1192837985 X:74822424-74822446 GCAAAAGACACCACCAAAAATGG + Intronic
1195749389 X:108149166-108149188 CCCAAAGACTCCCTCTGGAATGG - Intronic
1196537828 X:116868269-116868291 TCCATAGACTCCCCTAGGAAGGG - Intergenic
1197240347 X:124116700-124116722 GCCAAATTCTCCCCCCTAAAAGG + Intronic
1199136936 X:144265343-144265365 TCCAATGACTCCCGCAGAAGAGG + Intergenic
1200357357 X:155565824-155565846 GCCAAAGGCTACCCCCCAAAGGG - Intronic
1201252296 Y:12071658-12071680 ACCACAGACTCCTCCAGAAGAGG - Intergenic