ID: 1175786822

View in Genome Browser
Species Human (GRCh38)
Location 20:61717195-61717217
Sequence CTGTGACAGCAGCAGCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 1, 2: 3, 3: 58, 4: 458}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175786822_1175786831 -3 Left 1175786822 20:61717195-61717217 CCCCACTGCTGCTGCTGTCACAG 0: 1
1: 1
2: 3
3: 58
4: 458
Right 1175786831 20:61717215-61717237 CAGGACAAAGGCAGGGGAGCGGG 0: 1
1: 0
2: 2
3: 66
4: 586
1175786822_1175786833 19 Left 1175786822 20:61717195-61717217 CCCCACTGCTGCTGCTGTCACAG 0: 1
1: 1
2: 3
3: 58
4: 458
Right 1175786833 20:61717237-61717259 GAGCAGCCCAGGACAGCCACAGG 0: 1
1: 0
2: 2
3: 48
4: 355
1175786822_1175786828 -10 Left 1175786822 20:61717195-61717217 CCCCACTGCTGCTGCTGTCACAG 0: 1
1: 1
2: 3
3: 58
4: 458
Right 1175786828 20:61717208-61717230 GCTGTCACAGGACAAAGGCAGGG 0: 1
1: 0
2: 3
3: 33
4: 341
1175786822_1175786830 -4 Left 1175786822 20:61717195-61717217 CCCCACTGCTGCTGCTGTCACAG 0: 1
1: 1
2: 3
3: 58
4: 458
Right 1175786830 20:61717214-61717236 ACAGGACAAAGGCAGGGGAGCGG 0: 1
1: 0
2: 5
3: 83
4: 1008
1175786822_1175786834 20 Left 1175786822 20:61717195-61717217 CCCCACTGCTGCTGCTGTCACAG 0: 1
1: 1
2: 3
3: 58
4: 458
Right 1175786834 20:61717238-61717260 AGCAGCCCAGGACAGCCACAGGG 0: 1
1: 0
2: 2
3: 33
4: 342
1175786822_1175786829 -9 Left 1175786822 20:61717195-61717217 CCCCACTGCTGCTGCTGTCACAG 0: 1
1: 1
2: 3
3: 58
4: 458
Right 1175786829 20:61717209-61717231 CTGTCACAGGACAAAGGCAGGGG 0: 1
1: 0
2: 3
3: 23
4: 382
1175786822_1175786832 8 Left 1175786822 20:61717195-61717217 CCCCACTGCTGCTGCTGTCACAG 0: 1
1: 1
2: 3
3: 58
4: 458
Right 1175786832 20:61717226-61717248 CAGGGGAGCGGGAGCAGCCCAGG 0: 1
1: 0
2: 3
3: 58
4: 679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175786822 Original CRISPR CTGTGACAGCAGCAGCAGTG GGG (reversed) Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900899875 1:5509150-5509172 CTGGGACAGCAACAGCAGCCAGG + Intergenic
900907335 1:5568777-5568799 CTGTAAAAGCTGCAGAAGTGGGG + Intergenic
900974945 1:6011158-6011180 CTGAGGGAGCAGCAGGAGTGAGG + Intronic
901739039 1:11330366-11330388 CTGTGACTACAGCAGAAGGGAGG + Intergenic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903372275 1:22844381-22844403 CAGAGACAGCAGCAGCACTCTGG - Intronic
903385131 1:22921116-22921138 CTCTGACAGCAGCTCCAGGGAGG - Intergenic
903586784 1:24421957-24421979 CGGTGGCAGCAGCAGGAGTCAGG - Intronic
903695181 1:25201153-25201175 CTGTCAGAGGAGCTGCAGTGGGG - Intergenic
903759026 1:25684882-25684904 CTGGGCCAGCAGCAGCACAGGGG + Intronic
904192321 1:28755211-28755233 CTGTGATAGTAGCAGCAGCCAGG + Intronic
904672738 1:32178535-32178557 TTGTTACAGCATTAGCAGTGAGG - Intergenic
904716354 1:32470693-32470715 CTGTGACTGCAGCATCATTGTGG + Exonic
906258147 1:44366384-44366406 GTGAGACAGCAGCAGCACTGTGG - Intergenic
906471628 1:46135651-46135673 CTGTGCCAGCAGAATCAGTCTGG + Intronic
907164396 1:52397708-52397730 CTGTGACAGCAACATTAATGCGG - Exonic
907524771 1:55047747-55047769 GGGTGGCAGCAGCAGAAGTGAGG + Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907692674 1:56685275-56685297 CAGTGACAGTAGTAGCAATGGGG + Intronic
908942833 1:69456020-69456042 CTGTTATAGCAGCAGCAGACAGG + Intergenic
909463301 1:75943725-75943747 CTGTGATGGTAGCAGCAGGGTGG - Intergenic
909526221 1:76625789-76625811 CTGTGACAGTAGCAGCAACATGG - Intronic
909709696 1:78633492-78633514 CTGTGACTGGTGCAGCACTGAGG - Intronic
911434905 1:97844814-97844836 CTGAGACTGCAGGGGCAGTGGGG - Intronic
912140665 1:106721997-106722019 GTTTCACAGCAGCAGTAGTGTGG + Intergenic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912680551 1:111726422-111726444 CTGGGACTGGAGCAGCAGTGAGG - Exonic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
914676516 1:149910716-149910738 AAGTGACAGCATCAGCAGAGAGG + Intronic
915448575 1:155989250-155989272 CTGGGACTGCAGCACCAGGGTGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916578061 1:166084715-166084737 CTGTGACACCTGCAGCTGGGAGG + Intronic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
917130583 1:171738369-171738391 CTGTGACATCATCATCATTGAGG + Exonic
917522600 1:175760560-175760582 CAGTGACAGGAGCATCATTGCGG - Intergenic
917717712 1:177754807-177754829 CAATGAGAGCAGCAGCACTGAGG - Intergenic
919451270 1:197775362-197775384 CTGTGACAGCAGCGGTGGCGTGG + Intronic
919536016 1:198788786-198788808 CTGTGACAGCTGCTGTAATGTGG - Intergenic
919755641 1:201064419-201064441 CTCTGAGAGAAGCAGCAGCGTGG - Intronic
920221956 1:204410867-204410889 CTCTTAGAGCAGCAGCTGTGGGG - Exonic
922208234 1:223467465-223467487 CTGTGGCAGCAGCAGTGGAGAGG + Intergenic
922821689 1:228489027-228489049 CAGAGTCAGCAGCTGCAGTGTGG + Exonic
922897303 1:229110314-229110336 CTATAACTGCAGAAGCAGTGAGG - Intergenic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
924129330 1:240889400-240889422 ATGGGACACCAGCAGCAGGGTGG + Intronic
924942878 1:248824800-248824822 AGGTGGAAGCAGCAGCAGTGAGG - Exonic
1062816713 10:506354-506376 TTGGGACAGCAGCAGCAAGGGGG + Intronic
1062849189 10:729811-729833 CTGGGGCTGCAGCATCAGTGAGG + Intergenic
1062853020 10:759899-759921 CTGTGGTAGTAGCAGCAGGGTGG - Intergenic
1062854160 10:771292-771314 CTGTCACACCCGCAGGAGTGAGG + Intergenic
1063089568 10:2850409-2850431 CTGTGACAGTAGGGGCTGTGTGG - Intergenic
1063177729 10:3567536-3567558 AGGTGACAACATCAGCAGTGAGG + Intergenic
1063275936 10:4568036-4568058 CTATAACAGCAGCAGTAGAGGGG + Intergenic
1064102231 10:12473703-12473725 GTGTGAGAGCAGCAGCTGGGCGG - Intronic
1064828478 10:19433397-19433419 GTGTGACTGGAGCAGGAGTGAGG + Intronic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1065356459 10:24846563-24846585 TTGTGAGGGCACCAGCAGTGCGG + Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1065897569 10:30177747-30177769 CTCATTCAGCAGCAGCAGTGGGG + Intergenic
1066210712 10:33234929-33234951 CTGTGACTGCAGTGGCAGTCAGG - Intronic
1066683566 10:37959315-37959337 ATATGAAAGCAACAGCAGTGGGG + Intronic
1067752154 10:48978570-48978592 CTGTGATGGCAGCAGGTGTGAGG - Intronic
1068252135 10:54456235-54456257 CTGTGAAAGCAGCTGAAGGGGGG + Intronic
1068857080 10:61808746-61808768 CTGTGAAAGCTGCAGTACTGTGG - Intergenic
1070749474 10:78955441-78955463 CTGTGACATCAGAAGCATTTAGG + Intergenic
1070816653 10:79328653-79328675 CTGTGGCAGCAGCAGAGGTGGGG - Intergenic
1071389223 10:85154203-85154225 CTGTGTAAGCAGCCACAGTGAGG + Intergenic
1072601208 10:96931755-96931777 TTGTTTCAGCAGCAGCAGTTAGG + Intronic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1072861297 10:99007807-99007829 CTGAGAAAGCAGGAGCAGTGAGG + Intronic
1073219598 10:101859338-101859360 CTGAGACAGCAGCTGCAGGAAGG + Intronic
1073262487 10:102201089-102201111 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1073922073 10:108470709-108470731 CTATGAAAGCAGCAGTAGGGGGG - Intergenic
1074134524 10:110615239-110615261 CTGTGCCAGCAGCAGCTCTGAGG + Intergenic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075120108 10:119658658-119658680 CTGTGACAGGAGTAGCAGAAAGG + Intronic
1075811371 10:125227264-125227286 CTCTGGCCTCAGCAGCAGTGAGG - Intergenic
1076344204 10:129769224-129769246 CTCTGACAGCCGCAGCAGCAGGG + Intergenic
1077158438 11:1101897-1101919 CAGTGCCAGCAGCAGCCGTCGGG - Intergenic
1077214120 11:1388290-1388312 CACTCACAGCAGCAGCAGCGGGG + Intergenic
1079312360 11:19378163-19378185 CTGTGACAGCAGAAGCGGATGGG - Intronic
1079533747 11:21485916-21485938 CTGTGGCAGTATCAGCAGTTGGG - Intronic
1079803173 11:24896431-24896453 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
1080740462 11:35059163-35059185 CAGTGAGAGCAGTTGCAGTGAGG + Intergenic
1080876367 11:36278644-36278666 CTGTAACAGAAGCAGCAGGCAGG + Intronic
1081163892 11:39785573-39785595 CTGTGGCGCCAGCTGCAGTGGGG + Intergenic
1081164185 11:39786964-39786986 CTGTGGCACCAGCTGCAGTGGGG - Intergenic
1081695176 11:45104705-45104727 CTGTGTCATCTGCAGCACTGAGG - Intronic
1081702659 11:45161789-45161811 CTTAGGCAGCAGCATCAGTGTGG - Intronic
1081856783 11:46308910-46308932 GAGTGACAGCAGCAGCAGCCAGG + Intronic
1082027347 11:47582484-47582506 CTGGGACAGCAGCCTCAGGGAGG + Intronic
1083201146 11:61121748-61121770 GTGTGCCGGGAGCAGCAGTGTGG + Exonic
1083540828 11:63510596-63510618 CCGTGGCAACCGCAGCAGTGAGG - Intronic
1083545534 11:63546272-63546294 CTGTGTTAGAAGCAGCTGTGGGG + Exonic
1084427588 11:69094121-69094143 CAGTGCCAGGGGCAGCAGTGGGG + Intergenic
1084455531 11:69266074-69266096 CTGAGCAAGCAGCAGCTGTGTGG - Intergenic
1084511649 11:69609186-69609208 CTGGCACAGCAGCAGCAACGAGG + Intergenic
1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG + Intronic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1085815757 11:79735499-79735521 CTGTGACAGCAGCAAGGGTGAGG - Intergenic
1087743023 11:101911511-101911533 TTGTGAGAACAGCATCAGTGGGG - Intronic
1088234467 11:107707747-107707769 CTGTGACAATGACAGCAGTGGGG + Exonic
1089758665 11:120706783-120706805 CTGGGACAGCAGCTACAGAGGGG - Intronic
1089765032 11:120757054-120757076 CTGACACAGCAGCAGCATCGTGG + Intronic
1090343883 11:126051573-126051595 TTATGACAGCAGGTGCAGTGGGG - Intronic
1090435173 11:126680945-126680967 CTGTGACAGACAGAGCAGTGGGG - Intronic
1090763012 11:129853695-129853717 CTGTGACAGCAGCGGCTGTGTGG - Intronic
1091104852 11:132909044-132909066 CAGAGACAGAAGCATCAGTGCGG + Intronic
1091770604 12:3148826-3148848 CTGGGACAGCTGCAGCCGTGGGG - Intronic
1091846107 12:3657418-3657440 GCATGACAGCAGCAGCAGCGCGG + Intronic
1092006798 12:5076922-5076944 CTGTGACAGCACCATGGGTGTGG + Intergenic
1092670212 12:10853735-10853757 CTGTGTCAGCAGCCACAGGGAGG - Intronic
1092678712 12:10952824-10952846 ACATGCCAGCAGCAGCAGTGTGG - Intronic
1093113962 12:15186783-15186805 CAGTGACAGTTGCAGCACTGGGG + Intronic
1093668861 12:21848387-21848409 CTGTCACAGAAACAGCTGTGGGG + Intronic
1094193029 12:27716133-27716155 TTTGGACAGCAGCAGCATTGTGG + Intronic
1094466895 12:30763018-30763040 CGGGGACAGAAGCAGGAGTGAGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1100025413 12:90122144-90122166 CTGTGGAAGCATCAGCAGTGGGG + Intergenic
1101163971 12:102009098-102009120 CTCTGTCAGAGGCAGCAGTGTGG - Intronic
1101403217 12:104406167-104406189 CTGTGACAGAAGCAGCAACTTGG + Intergenic
1101482048 12:105107724-105107746 CTGTGACAGTAGCTGGGGTGAGG + Exonic
1103173535 12:118843151-118843173 CTGAGACACCAGCTGCAGTGGGG + Intergenic
1103677196 12:122665072-122665094 CTGTCACCCCAGCTGCAGTGTGG - Intergenic
1104056753 12:125236626-125236648 CTGTCCCAGGGGCAGCAGTGGGG - Intronic
1104535872 12:129617574-129617596 CATTGAAAGGAGCAGCAGTGCGG + Intronic
1104663241 12:130627607-130627629 CTGAGAGAGCAGTAGAAGTGTGG - Intronic
1104879472 12:132060517-132060539 ACTTGTCAGCAGCAGCAGTGAGG + Intronic
1105218444 13:18304189-18304211 CTGGGAGAACAGCAGCAGTAAGG - Intergenic
1106798232 13:33229807-33229829 CTGTGCCAGAAGCCTCAGTGAGG + Intronic
1107542400 13:41403336-41403358 GTGTGCCAGCTGCAGCAGGGTGG + Intergenic
1108196157 13:47997559-47997581 CACTCCCAGCAGCAGCAGTGGGG - Intronic
1109345737 13:61113269-61113291 CGGGGACAGCAGCTGCAGTGGGG + Intergenic
1109416450 13:62046759-62046781 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1110401554 13:75097359-75097381 CTTTGACAGCAGCATCACTGAGG - Intergenic
1112294780 13:98177086-98177108 CGGAGAGAGCAGCAGCAGCGGGG - Exonic
1112786196 13:102954323-102954345 ATGGGACAGCAGCACCTGTGAGG + Intergenic
1113671145 13:112176481-112176503 CTGGGACAGCAGCAGCACCTCGG + Intergenic
1113945124 13:114039682-114039704 CTGTAACAGAGGGAGCAGTGGGG - Intronic
1114635345 14:24184019-24184041 CAGTGACAGCAGCATGAGCGTGG + Exonic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115213137 14:30988238-30988260 CTGTGACACGAGCAGCACTTTGG + Intronic
1115399375 14:32939700-32939722 GTGTGACGGGAGCAGCAGCGAGG + Intronic
1117461186 14:55946530-55946552 CTGTGAGAGCAACCACAGTGTGG + Intergenic
1118753557 14:68822899-68822921 CTGTGACAGCAGCAGGGGGTGGG - Intergenic
1118956496 14:70487915-70487937 ATGTGAAAGCAGGAGCAGAGGGG + Intergenic
1119024217 14:71139816-71139838 GTGTGTCGGCAGCAGCACTGAGG - Intergenic
1119577169 14:75735352-75735374 CTGTGGGAGCAGAAGCACTGTGG + Intronic
1121173805 14:91875556-91875578 CTGTGAGAGCAACAGCTTTGGGG + Intronic
1121466977 14:94122127-94122149 CTTTAATAGCAGCAGGAGTGGGG - Intergenic
1122905028 14:104797657-104797679 CAGTCCCAGCAGCAGCCGTGGGG - Intergenic
1123802689 15:23838071-23838093 GTGTGACATTAGCAGCAGTGGGG + Intergenic
1124001822 15:25766545-25766567 CTGAGCCAGCAGAAGAAGTGAGG + Intronic
1126567202 15:50112952-50112974 CTGTGAGGGCTGCACCAGTGTGG + Intronic
1126915557 15:53462235-53462257 CTGAGGCAGCAACAGCAGTGGGG - Intergenic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1128825139 15:70708262-70708284 CTGTGGCAGGAGCAGAGGTGGGG + Intronic
1129273111 15:74429667-74429689 CTATGACTGGCGCAGCAGTGAGG - Intronic
1130017977 15:80202018-80202040 CAGAGACAGCCACAGCAGTGGGG + Intergenic
1130246592 15:82256159-82256181 CTGTGACAGCAACTGCACTCCGG - Intronic
1131032725 15:89199958-89199980 CCGAGGCAGCAGCAGCAGAGGGG - Exonic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1133024485 16:2982037-2982059 CTGTGCATGGAGCAGCAGTGTGG + Intergenic
1133134330 16:3699176-3699198 CTGAGACTGCAGCTGCAGAGTGG - Intronic
1133699214 16:8293625-8293647 CTGTAACAGCATCAGGGGTGGGG - Intergenic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1135054929 16:19223674-19223696 CTGTGAAAGCAGCTGTAGTCAGG + Intronic
1135401888 16:22171773-22171795 CTTTGACAGCCGCAGGAGGGAGG - Intronic
1135698039 16:24607440-24607462 CCGGGACAGAAGCAGCAGTGCGG - Intergenic
1135774752 16:25247201-25247223 TGGAGAGAGCAGCAGCAGTGGGG - Exonic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1135856950 16:26020476-26020498 CTGTGACAGCCGGAGGACTGAGG + Intronic
1135976814 16:27113817-27113839 CTTTGGGACCAGCAGCAGTGGGG - Intergenic
1136022534 16:27449154-27449176 CTCTGACTGCAGCAGCCCTGTGG + Exonic
1137584921 16:49658625-49658647 ATATGGCAGCAGCAGCAGAGAGG + Intronic
1138064176 16:53923540-53923562 CTGTGCCAGTAGGGGCAGTGGGG + Intronic
1138096853 16:54218708-54218730 CAGAGACAGCAGGTGCAGTGGGG + Intergenic
1138249063 16:55488613-55488635 CTATGACAGCTGCACCACTGAGG + Exonic
1138280881 16:55771395-55771417 GTGTGGCAGCAGCAGCTGAGTGG - Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1139832481 16:69811194-69811216 CTGGGAGAGCTGCAGGAGTGGGG - Intronic
1139878221 16:70163506-70163528 CTGCCACAGCAGCAGTGGTGGGG - Intergenic
1139883505 16:70192776-70192798 CTGTGCCAGCAGAGGCTGTGGGG - Intergenic
1140045907 16:71440671-71440693 CTGGGACACCTGCAGCTGTGTGG - Intergenic
1140359342 16:74331306-74331328 CTGCCACAGCAGCAGTGGTGGGG + Intergenic
1140369005 16:74402743-74402765 CTGTGCCAGCAGAGGCTGTGGGG + Intergenic
1141111861 16:81276440-81276462 CTGTGGCAGGAACAGCAGAGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1141698980 16:85633816-85633838 CGGTGTCAGCAGCAGCAGGCAGG - Intronic
1141809524 16:86365696-86365718 CTGTGGCAGCAGCTGCTGTGGGG + Intergenic
1142002096 16:87669954-87669976 CTGTGTCAGCTCCAGCCGTGGGG + Intronic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1143722028 17:8819154-8819176 CTGTGACAGGAGCAGCAGGCAGG + Exonic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144626203 17:16845590-16845612 CTATGGCAGCAGCAGCTTTGAGG - Intergenic
1144880230 17:18427130-18427152 CTATGGCAGCAGCAGCTTTGAGG + Intergenic
1145217476 17:21062760-21062782 CTGGGCCAGCAGCAGCACTTGGG - Intergenic
1146588868 17:34110438-34110460 CTGAGGCAGCGGCAGCAGAGAGG - Intronic
1148508218 17:48145575-48145597 CTGTGACAGGAGGAGCTCTGAGG - Intronic
1151507556 17:74539547-74539569 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151509094 17:74547392-74547414 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151675871 17:75597041-75597063 CTGGGACAGCAGCAGCGAAGGGG + Intergenic
1152346201 17:79753479-79753501 TTGTGACAGCTGCAGCATTTTGG - Intergenic
1152383834 17:79957012-79957034 CTGTGGCCACAGCAGCAGGGAGG + Intronic
1152517923 17:80837017-80837039 CTGTGGAAGCTGCAGCAGTGCGG + Intronic
1152864325 17:82713140-82713162 TCATGACACCAGCAGCAGTGGGG - Intergenic
1152915323 17:83031694-83031716 CTCTGACTGCAGCAGGTGTGGGG + Intronic
1153240764 18:3029522-3029544 CTGTGACAGCATCAGCTATGAGG - Intergenic
1153626048 18:7023299-7023321 CTGTGACTGCAGCGGCAACGTGG - Exonic
1154411341 18:14143725-14143747 CTCTGACAGCAGCTCCTGTGGGG - Intergenic
1156424753 18:36997991-36998013 CAGTGACAGAAGCTTCAGTGTGG + Intronic
1158527318 18:58226755-58226777 CTCTGTCAGCTGTAGCAGTGAGG - Intronic
1158730782 18:60020223-60020245 CTGTGCTAACAGCAGCAGTTAGG - Intergenic
1160188101 18:76691463-76691485 CTGTAACACCAGCAGTCGTGAGG + Intergenic
1160388401 18:78512103-78512125 CGGTGACAGCAGCTGCAGGTGGG - Intergenic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161131997 19:2595893-2595915 CTGTGTGAGCAGCACCTGTGTGG + Intronic
1161132290 19:2598057-2598079 CTGTGTGAGCAGCACCTGTGTGG + Intronic
1161542385 19:4859862-4859884 CGCTGACAGCAGCCGCCGTGAGG + Exonic
1161694603 19:5759095-5759117 CTAAAACAGCAGCAGCACTGGGG + Exonic
1162930413 19:13954568-13954590 CTCCTACACCAGCAGCAGTGGGG + Exonic
1162967618 19:14163548-14163570 CCGTGACTGCAGCAGCAGGAGGG - Intronic
1164394622 19:27851851-27851873 CTTTCACAGGAGCTGCAGTGGGG + Intergenic
1164479467 19:28600234-28600256 GTGACACAGCTGCAGCAGTGGGG - Intergenic
1164695638 19:30241579-30241601 CTGTCTAAGGAGCAGCAGTGTGG + Intronic
1164880231 19:31726692-31726714 GTGAGACAGCACCAGCAGGGAGG - Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165068293 19:33241370-33241392 CTTTCACAGCAGCAACCGTGAGG + Intergenic
1165230251 19:34382238-34382260 CTGTGGCAGGCGCAGCAGAGAGG + Intronic
1165534475 19:36431803-36431825 TGCTGACAGCAGCAGCAGAGAGG + Intergenic
1167473655 19:49688504-49688526 CAGTGCCAGCCTCAGCAGTGGGG + Intronic
1167539468 19:50075846-50075868 CGTTGATAGCAGCAGCAGTGGGG - Intergenic
1167610555 19:50506019-50506041 TTGAGGCAGCAGCGGCAGTGGGG + Exonic
1167630243 19:50622011-50622033 CGTTGATAGCAGCAGCAGTGGGG + Exonic
1168714044 19:58516920-58516942 CGCTGTCAGCAGCAGCAGTGAGG + Exonic
925094489 2:1185219-1185241 CTTTGAGAGCCACAGCAGTGGGG - Intronic
925896523 2:8476539-8476561 CTGTGCCAACAGCAGGAATGAGG + Intergenic
926643764 2:15266049-15266071 CTATCACAGCAGCAGCATGGGGG - Intronic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927209610 2:20630952-20630974 CTGAGAGAGGAGCAGCAGAGGGG + Intronic
927245738 2:20955980-20956002 GTGGAACAGCAGCAGCAGTCCGG - Intergenic
927895443 2:26778634-26778656 CTGTGGCAGCAGCTGCCCTGGGG - Exonic
927937119 2:27082366-27082388 TGGCGGCAGCAGCAGCAGTGGGG + Exonic
927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG + Exonic
928884310 2:36130639-36130661 CTGTGACATAAGCAGAAGAGCGG + Intergenic
932074014 2:68646305-68646327 AGGTGAGTGCAGCAGCAGTGGGG + Exonic
932892971 2:75611933-75611955 CTGTCCCAGCAGCAGTAGGGAGG - Intergenic
933116282 2:78477342-78477364 CTGAGACAGTAGCAGAAGTAGGG - Intergenic
934860550 2:97760814-97760836 CCGTGACTGCAGCAAAAGTGGGG + Exonic
935060765 2:99605580-99605602 GTGGGGCAGCTGCAGCAGTGAGG + Intronic
935338180 2:102036024-102036046 CAGTGACCACAGCAGCAGTTCGG + Intergenic
936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG + Intronic
936147163 2:109987641-109987663 CGCTGTCAGCAGCAGCAGTGAGG + Intergenic
936197529 2:110383842-110383864 CGCTGTCAGCAGCAGCAGTGAGG - Intergenic
936235118 2:110735748-110735770 TTGTGACAGCAGGAGCATTCTGG + Intronic
938241033 2:129742442-129742464 CTGTGACAGCAGCAGACCTCTGG + Intergenic
938319161 2:130351549-130351571 CCTGGTCAGCAGCAGCAGTGAGG + Intergenic
938566846 2:132526317-132526339 CTGTAGAAGCTGCAGCAGTGAGG + Intronic
940362726 2:152813449-152813471 CCCTGGCAGCAGCAGCAGTCAGG + Intergenic
942319796 2:174726275-174726297 CTGCCCCAGCAGCAGGAGTGAGG - Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
946421408 2:219567200-219567222 CTGTGAGAGGACCAGCACTGAGG + Intronic
946484061 2:220084160-220084182 TTGTGAATGCAGCAGAAGTGAGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
948074023 2:235151021-235151043 ATCTGACAGGAGCAGCAGGGAGG + Intergenic
948255296 2:236563960-236563982 CTGTGACAGCAGCTGGGGTGAGG + Intergenic
948420688 2:237858613-237858635 CTGTGGCCGCAGCACCAGGGTGG + Intergenic
948431768 2:237923317-237923339 ACGTGACAGCAGGGGCAGTGGGG - Intergenic
1168983546 20:2027471-2027493 CCATGACACCAGCTGCAGTGGGG - Intergenic
1169258115 20:4114305-4114327 CTGTGACAGCCACAGCAATGGGG + Intergenic
1170644310 20:18183146-18183168 CTGTGACAGGAGCTGCAGTTTGG - Exonic
1171767954 20:29300584-29300606 CCGCGACTGCAGCGGCAGTGGGG - Intergenic
1172027039 20:31955579-31955601 TTGTGTGAGCAGCAGCAGGGAGG - Intergenic
1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG + Intronic
1173529327 20:43756566-43756588 CTGTGACTCCAGCTGCAGTGGGG + Intergenic
1174371303 20:50089994-50090016 AGGTGCCAGCAGCAGCAGAGGGG + Intronic
1175401993 20:58706311-58706333 CACTGACACCACCAGCAGTGAGG - Intronic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175842723 20:62040426-62040448 CAGTGACAGCAGCAGCTCAGTGG + Intronic
1175856800 20:62125219-62125241 CTGTGAGAGCAGCAACAGCCTGG - Intronic
1176861716 21:14014692-14014714 CTCTGACAGCAGCTCCTGTGGGG + Intergenic
1177634914 21:23774692-23774714 CTGAGACAGCAGTAGCGGTGGGG - Intergenic
1179409465 21:41151209-41151231 ATGTGACAGCTGCAGCAGTTAGG - Intergenic
1179582020 21:42350073-42350095 CTCTGAGAGAAGGAGCAGTGTGG - Intronic
1179923693 21:44521262-44521284 CTGTGACCGGAGCAGAGGTGCGG - Intronic
1180082507 21:45493318-45493340 GTGTCACAGCAGCAGCCGGGGGG - Intronic
1181024760 22:20121778-20121800 TTGTGACTGTAGGAGCAGTGGGG + Intronic
1182866214 22:33606743-33606765 CCATGACAGCAGGGGCAGTGTGG - Intronic
1183280009 22:36927031-36927053 CTCTGCCAGCAGCAGTAGAGAGG - Intronic
1184054146 22:42033159-42033181 ATGTGCCAGCTGCTGCAGTGGGG + Intronic
1184069349 22:42138422-42138444 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1184660911 22:45965121-45965143 ATGTGGCAGCATCAGGAGTGGGG - Intronic
1184742060 22:46434321-46434343 CTGAGTCAGCAGCAGCAGCTGGG + Intronic
1184973058 22:48041190-48041212 CTGTCCCAGCAGCAGAAGAGGGG - Intergenic
1185340699 22:50289669-50289691 CAGAGACAGCCGGAGCAGTGGGG - Exonic
949934081 3:9102915-9102937 ATGTGACAGCAGCAGCAGGCGGG + Intronic
950682163 3:14592857-14592879 GTCAGACAGCAGCAGCATTGTGG - Intergenic
950772995 3:15327127-15327149 CTGAGACAGCAGTGGCGGTGGGG + Intronic
951159587 3:19401195-19401217 CAGTGACACCAGCATCACTGTGG - Intronic
952419567 3:33118913-33118935 CTGTGAGAGCAGCAGGGCTGCGG - Intronic
952490590 3:33868472-33868494 CTGTGGCAGGATCAGCTGTGGGG - Exonic
952735183 3:36682110-36682132 CTGTCACAACAGCAGCACTGAGG + Intergenic
953147317 3:40290744-40290766 GTGTGCCAGCTGCTGCAGTGGGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953885852 3:46714012-46714034 CTGAGGCTGGAGCAGCAGTGAGG + Intronic
954436666 3:50499944-50499966 CGGTGACAGCAGCAGCGGCTGGG + Intronic
954573155 3:51659019-51659041 GTGTTACAGCAGCAGAATTGAGG + Intronic
954755858 3:52839358-52839380 CTCTGAAGGCTGCAGCAGTGGGG + Exonic
955485345 3:59429334-59429356 CTGGGAGTGAAGCAGCAGTGAGG - Intergenic
957298587 3:78362457-78362479 CTGGTACAGCAGCTGCAGTTGGG + Intergenic
958161109 3:89817978-89818000 GTGTGCCAGCTGCAGCAGGGTGG + Intergenic
959002683 3:100982730-100982752 CTGTGACAGCAGGATCATTAGGG + Intronic
960044959 3:113187625-113187647 CTGTCACAGCAGCTACAGTGGGG - Intergenic
960950130 3:122993793-122993815 TGCTGACAGCAGCAGCTGTGGGG - Intronic
961917700 3:130394062-130394084 CTGTGGTAGCAGCAGCACTACGG - Intronic
961932318 3:130547280-130547302 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
963488130 3:145963119-145963141 CTGTTACAGCAGCAGAAATCAGG - Intergenic
963583336 3:147154226-147154248 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
963686943 3:148447636-148447658 TAGAGTCAGCAGCAGCAGTGTGG - Intergenic
963804896 3:149713739-149713761 CAGTGATAGCAGCAGCAGAGGGG + Intronic
964357906 3:155867374-155867396 CTTTGACAGAAGCAGAAGTCTGG - Intergenic
964446196 3:156761238-156761260 CTCTGATCTCAGCAGCAGTGGGG + Intergenic
964641015 3:158910686-158910708 ATGTTACAGCTCCAGCAGTGTGG + Intergenic
964893720 3:161568635-161568657 CTGTAACAGAGGCAGAAGTGTGG - Intergenic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
968576145 4:1367060-1367082 CTGTGGCATCACCAGCGGTGAGG - Intronic
968584481 4:1409750-1409772 CTGGGACAGGAGCAGAAGTATGG + Intergenic
968967956 4:3778865-3778887 CTGTAACAGCACCTGCTGTGTGG + Intergenic
969109959 4:4838423-4838445 CTCATCCAGCAGCAGCAGTGGGG - Intergenic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG + Intergenic
969692561 4:8711621-8711643 CTGTCCCTGAAGCAGCAGTGTGG - Intergenic
969831461 4:9801005-9801027 CCATGACACCAGCAGAAGTGTGG + Intronic
973045386 4:45530596-45530618 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
973699199 4:53520165-53520187 CTGTGCCTTCAGCAGCAGTTTGG - Intronic
974019021 4:56676727-56676749 TTGTGACAGCAGCAGTGGGGAGG - Intronic
976140997 4:81991491-81991513 TAGAGGCAGCAGCAGCAGTGGGG + Intronic
976911272 4:90309175-90309197 TTGTAACAGCAGCAGAATTGAGG - Exonic
978350996 4:107820606-107820628 CTGAGACAGCAGCAGCTTTTGGG - Intergenic
978466256 4:109012617-109012639 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
978514611 4:109557544-109557566 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
979678613 4:123435590-123435612 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG + Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
984818206 4:183857720-183857742 CAGGGACACCAGCAGCACTGGGG - Intronic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
985523124 5:388482-388504 CTGGGAGAAAAGCAGCAGTGGGG - Intronic
985553588 5:545476-545498 CTGTGACAAAAGCAGCTCTGTGG + Intergenic
985723041 5:1500834-1500856 GTGTGAGAGCAGCAGCAATGAGG - Intronic
986153190 5:5146657-5146679 CTAGAACAGCAGCAGCAGGGTGG - Intronic
986195544 5:5534067-5534089 CTGTGGCAGGTGCAGTAGTGCGG - Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986905110 5:12486622-12486644 ATGTGACAGAGGCTGCAGTGAGG - Intergenic
987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG + Intronic
988737403 5:34036043-34036065 CTGTTACAGTAGCAGCAGGAAGG - Intronic
989164494 5:38421401-38421423 CTGTGACTGCTCCAGCAGAGTGG - Intronic
989716357 5:44468039-44468061 TTGTAACAGCAGTGGCAGTGTGG + Intergenic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990309008 5:54519634-54519656 CTTTGACAGCAGTACCACTGTGG + Exonic
990371256 5:55120637-55120659 CTGTGACAGGTGCAGACGTGGGG - Intronic
994380996 5:99071100-99071122 CTGTGACAGGATTAGTAGTGTGG + Intergenic
994799258 5:104350186-104350208 CTGTGACTGCAACAGCAGCTAGG - Intergenic
995280132 5:110325325-110325347 CTTTGACACCAGCAGCATAGTGG + Intronic
996694261 5:126376528-126376550 TTGTAACAGCAGGAGAAGTGGGG - Intronic
996747092 5:126854748-126854770 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
999621801 5:153481386-153481408 CTCTGCCAGCAGCACCAGTTAGG - Intergenic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000223349 5:159235089-159235111 CTGGTACAGCAGCTGCAGTTGGG + Intergenic
1000285347 5:159821642-159821664 ATATGACAGCATCAGGAGTGTGG + Intergenic
1000546970 5:162615144-162615166 CTCTCACAGAAGCAGCAGTAAGG + Intergenic
1002072465 5:176688363-176688385 CTGAGCCTGCAGCAGCAGTTTGG + Intergenic
1002549230 5:179974661-179974683 GTGTGACAGCAGACGCTGTGGGG + Intronic
1003398239 6:5771224-5771246 CTGTGCCTGAAGGAGCAGTGTGG - Intronic
1003938745 6:11003120-11003142 AAGTGACAGCAGCAGCAGAAGGG - Intronic
1005281875 6:24283295-24283317 CTGTGACTCCCGCAGCACTGAGG + Intronic
1006905329 6:37529462-37529484 CTGAGACAGCGGCAGCAGGAAGG - Intergenic
1007008365 6:38390080-38390102 ATGTGACGGCACCAGCAGAGAGG - Intronic
1007416519 6:41694410-41694432 GTGTGACAGCTCCAGCGGTGGGG - Intronic
1007764854 6:44154415-44154437 TGGGGACAGCAGCAGCAGTGGGG - Exonic
1008699342 6:54080035-54080057 CTCTGGCATCACCAGCAGTGGGG + Intronic
1009325829 6:62346542-62346564 GTGTGACAGCAGCAGAAGAAAGG - Intergenic
1009403690 6:63287434-63287456 CTGTAATACCAGCAGGAGTGAGG + Intronic
1010133643 6:72524300-72524322 CTGTGCCAGCAGGAGCAGGTGGG - Intergenic
1012840827 6:104326946-104326968 GTGTGAGAGGAGCAGCAGGGAGG - Intergenic
1013168659 6:107616738-107616760 CTTTGACTGCAGAAACAGTGGGG + Intronic
1013650946 6:112193806-112193828 CATTTATAGCAGCAGCAGTGTGG - Intronic
1013989309 6:116234810-116234832 CTGTGAAAGCCGCAGAACTGAGG - Intronic
1014494177 6:122100140-122100162 CGGAGCCAGCAGCAGCAATGTGG + Intergenic
1015487923 6:133792479-133792501 CTGGCAAAGCAGCAGAAGTGAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016360774 6:143265423-143265445 CTGAGATAGCAGCAGCAGCCAGG - Intronic
1017388965 6:153917368-153917390 CTGTGAAAGAAGCCTCAGTGGGG - Intergenic
1017753316 6:157509071-157509093 CTTTCACTCCAGCAGCAGTGGGG + Intronic
1018064882 6:160117921-160117943 CTGGGACAGCAGCAGGCATGGGG - Intergenic
1018463609 6:164022187-164022209 CTATGGCAGGAGCAGAAGTGTGG + Intergenic
1018809248 6:167285594-167285616 CTGAGACAGCAGCAGCTGCAGGG - Intronic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021270168 7:18575030-18575052 CCATGACACCAGCTGCAGTGGGG - Intronic
1021609012 7:22438649-22438671 TTCTGGCAGGAGCAGCAGTGTGG - Exonic
1022312281 7:29208506-29208528 CTATGACAGCAGCACACGTGGGG + Intronic
1022395243 7:29982444-29982466 CTGAGACAGCAGGATCAGTTGGG + Intronic
1022650434 7:32269063-32269085 CTGTGGCAGTAGCAGCACAGAGG + Intronic
1023032028 7:36098288-36098310 CCATGACAGAAGCATCAGTGAGG - Intergenic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1028915300 7:96252484-96252506 CTCTCACAGAAGCAGCAGGGAGG + Intronic
1029170595 7:98627045-98627067 CGGTGACAGGAGGAGCAGTGTGG + Intronic
1029283705 7:99452406-99452428 CTGTGTCTGCTGCGGCAGTGGGG - Exonic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1030009618 7:105153221-105153243 CTTTGAGTTCAGCAGCAGTGCGG + Intronic
1030156617 7:106461735-106461757 CTTTCACAGCAGCAACACTGCGG + Intergenic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1032162676 7:129522793-129522815 CAAGGACAGCAGCAGCAGCGTGG + Intergenic
1032786952 7:135208538-135208560 CAGTGACAGTGGCAGCAGTGGGG - Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033547458 7:142414274-142414296 CTGTGCCAGCAGCAAAAATGTGG + Intergenic
1034235734 7:149567621-149567643 CTGTGACAAGAGCAGAAGTAGGG + Intergenic
1034282669 7:149864781-149864803 CTCCCACAGCAGAAGCAGTGAGG + Exonic
1034551679 7:151824631-151824653 CTGTGAGAGGAGCAGGAGAGAGG - Intronic
1035121323 7:156570279-156570301 CCGTGAGAAAAGCAGCAGTGGGG - Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1037985429 8:23288156-23288178 CGGTGAGTGCAGCAGCACTGGGG + Exonic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038379835 8:27082261-27082283 CTGCAACAGCAACAGGAGTGAGG + Intergenic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1038707196 8:29905572-29905594 CTGTTACAGCAGCAGCAGTAAGG - Intergenic
1038852614 8:31294942-31294964 CTGTGACAGCAGCAGCACCTAGG + Intergenic
1038852881 8:31297260-31297282 CTGTGACAACAGCAGCACCCAGG + Intergenic
1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG + Intergenic
1039892182 8:41693202-41693224 CTGTAACAGCGGCAGAAATGGGG + Intronic
1039987598 8:42460938-42460960 CGATGACAGCAGCAGAAGTATGG + Intronic
1040003698 8:42600286-42600308 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1040440663 8:47438229-47438251 CACTGACAGCAGCAGCTGTCAGG - Intronic
1041869370 8:62615821-62615843 CCCTGGCAGCAGCAGCAGTGTGG - Intronic
1042169484 8:65978011-65978033 CTGGGTCAGCAGCTGCAGAGGGG - Intergenic
1042633352 8:70844857-70844879 GGGTGATGGCAGCAGCAGTGGGG - Intergenic
1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG + Intergenic
1043077032 8:75715475-75715497 ATGCCACAGCAGCAGTAGTGGGG + Intergenic
1043623552 8:82227669-82227691 CTGTGGTAGTAGCAGCAGAGTGG - Intergenic
1046260321 8:111758975-111758997 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1047418935 8:124690144-124690166 CGGCGGGAGCAGCAGCAGTGGGG - Intronic
1048315453 8:133358549-133358571 AGGGCACAGCAGCAGCAGTGAGG + Intergenic
1048343116 8:133555771-133555793 CCGTTCCAACAGCAGCAGTGAGG - Intronic
1048571261 8:135659015-135659037 CTTTGGCAGCAGCAGAACTGTGG - Intergenic
1048877200 8:138846179-138846201 CCAGGACAGCAGCAGCTGTGGGG + Intronic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049030991 8:140037538-140037560 CTGAGACAGGAGGAGCAGTAGGG - Intronic
1049098116 8:140560692-140560714 CTGTGACAGCAGCAGGCTGGGGG + Intronic
1049180994 8:141222113-141222135 CCTGGACAGCACCAGCAGTGTGG - Intronic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1050410513 9:5359796-5359818 CTGTGACAGCAGCAGTATGCTGG + Intronic
1050880896 9:10699535-10699557 CTGTCAGATCAGCAGCAGTGGGG + Intergenic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1051029779 9:12659203-12659225 CCATGACACCAGCTGCAGTGGGG - Intergenic
1051143487 9:14003137-14003159 CACTGACACCAGCAGCAGTGTGG - Intergenic
1051160287 9:14200008-14200030 CTCTGTTAGCAGCAGCAGTAAGG - Intronic
1052221410 9:26027999-26028021 CTTTGAAATCAGCTGCAGTGGGG - Intergenic
1052437223 9:28444375-28444397 ATGCAACAGAAGCAGCAGTGGGG + Intronic
1052552689 9:29970449-29970471 CCGTGACACCAACTGCAGTGTGG - Intergenic
1052961810 9:34304478-34304500 CTGTGACAGAAGCATCATTAAGG + Intronic
1053130623 9:35613010-35613032 GTGTGATAGCAGCAACAGTTGGG + Intronic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053537239 9:38937919-38937941 CTGTGGAAGAAACAGCAGTGTGG - Intergenic
1054628896 9:67426011-67426033 CTGTGGAAGAAACAGCAGTGTGG + Intergenic
1054717641 9:68572435-68572457 CTATCACAAGAGCAGCAGTGGGG + Intergenic
1055030802 9:71769657-71769679 CTGTGAGAGCAGCTCCAGCGAGG - Intronic
1055080458 9:72263712-72263734 CAGTGACAGTAGCTGGAGTGGGG + Intergenic
1055961839 9:81827970-81827992 GTATGAAAGAAGCAGCAGTGAGG + Intergenic
1056821254 9:89843669-89843691 CTGTGCAAGCAGCTGCTGTGGGG - Intergenic
1057220648 9:93256151-93256173 ACATGACAGCAGAAGCAGTGAGG - Intronic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1058280042 9:103103129-103103151 AGTTGACAGCTGCAGCAGTGAGG - Intergenic
1059637849 9:116187977-116187999 CTGTGACATCAGCAAGATTGGGG + Exonic
1060330704 9:122666597-122666619 GAGTGCCTGCAGCAGCAGTGAGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060872320 9:127052500-127052522 CTGTGCCAACAGCATCAATGTGG - Intronic
1060970885 9:127737198-127737220 GGGTCACAGCAGCAGCAGAGTGG - Intergenic
1061412642 9:130429709-130429731 CTGGGGCAGCTGCAGCGGTGTGG - Intronic
1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG + Intergenic
1062286388 9:135774863-135774885 GGGTGAGGGCAGCAGCAGTGAGG + Intronic
1062568126 9:137172241-137172263 CTGAGGCAGAGGCAGCAGTGGGG + Exonic
1062580199 9:137226009-137226031 CTGTGGCAGCGGCAGAAGGGGGG - Exonic
1187260206 X:17678584-17678606 TTGCGACGGCAGCAGCAATGGGG + Intronic
1187883292 X:23865650-23865672 CTTTGAGGGCAGCAGCAGGGTGG - Intronic
1188629315 X:32332592-32332614 CTGTGAAAGCAGCAGCAAAGGGG + Intronic
1188962256 X:36507142-36507164 CTGTGACAACAGCACCAAGGAGG + Intergenic
1189131498 X:38502742-38502764 TAGAGACAGCAGCAGCACTGGGG + Intronic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1190028151 X:46945493-46945515 CAGTGGTAGCAGCAGCACTGGGG - Intronic
1190254714 X:48753892-48753914 AGGTCACAGCAGCTGCAGTGTGG - Intergenic
1190369271 X:49726361-49726383 CTGTCACTCCAGCTGCAGTGGGG + Intergenic
1190383164 X:49859165-49859187 CTATGACATCAACAGCAATGGGG + Intergenic
1191024066 X:55894632-55894654 CTGTCACAGCACCAGCAAGGTGG - Intergenic
1192168763 X:68841721-68841743 CTGGGACAGCAGCAGGAGCTGGG - Exonic
1192177066 X:68892808-68892830 CTGTAACTGCAGCGGGAGTGGGG + Intergenic
1192952276 X:76029591-76029613 GTGTGGCAGCGGCAGCAGCGGGG + Intergenic
1193168401 X:78307768-78307790 GAGTGGCAGCAGCAGAAGTGTGG + Intronic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1193585717 X:83318914-83318936 CTGTGAAAGCAGCCACAGTGAGG + Intergenic
1193671808 X:84396732-84396754 CTGTGGCAGTATCAGCAGGGTGG + Intronic
1194316001 X:92379025-92379047 CCATGACACCAGCTGCAGTGGGG + Intronic
1195394711 X:104398375-104398397 CTCTGGCACCAGCAGCTGTGGGG + Intergenic
1197141487 X:123122089-123122111 CTCTGACAGCAATGGCAGTGCGG - Intergenic
1197971641 X:132120692-132120714 ATGTGACAGCAGGAGATGTGGGG + Intronic
1198579670 X:138049438-138049460 ATGGGACAGCAGCAGGGGTGAGG - Intergenic
1199266871 X:145838332-145838354 GTGCTAAAGCAGCAGCAGTGGGG + Intergenic
1200167258 X:154045350-154045372 CTGTGGCAGCAGCTGGAGTCAGG - Intronic
1200624050 Y:5490599-5490621 CCATGACACCAGCTGCAGTGGGG + Intronic
1200955319 Y:8938473-8938495 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1201903517 Y:19066713-19066735 CCGTGACTGGAGCAGCACTGTGG + Intergenic
1202152564 Y:21856629-21856651 CTGTGGGAGCAGCAGCATAGTGG - Intergenic