ID: 1175789228

View in Genome Browser
Species Human (GRCh38)
Location 20:61731235-61731257
Sequence GAGGGTCTCCTGAGGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175789219_1175789228 13 Left 1175789219 20:61731199-61731221 CCAAACAGTCGTGCCGCTTGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1175789228 20:61731235-61731257 GAGGGTCTCCTGAGGGATTTTGG 0: 1
1: 0
2: 1
3: 12
4: 159
1175789221_1175789228 0 Left 1175789221 20:61731212-61731234 CCGCTTGTGGTGTGTCCCATTCT 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1175789228 20:61731235-61731257 GAGGGTCTCCTGAGGGATTTTGG 0: 1
1: 0
2: 1
3: 12
4: 159
1175789218_1175789228 30 Left 1175789218 20:61731182-61731204 CCTTGGCTCTGCTCAGGCCAAAC 0: 1
1: 0
2: 2
3: 21
4: 218
Right 1175789228 20:61731235-61731257 GAGGGTCTCCTGAGGGATTTTGG 0: 1
1: 0
2: 1
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175789228 Original CRISPR GAGGGTCTCCTGAGGGATTT TGG Intronic
901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG + Intronic
907310821 1:53538123-53538145 GAGGGTCTCCTCAGAGTTTGGGG + Intronic
908110023 1:60887477-60887499 CAGAGTCTCCAGAAGGATTTTGG + Intronic
909699447 1:78505673-78505695 GAGTGACTCCTGATGGATATAGG - Intronic
911648025 1:100356206-100356228 ATGGGACTCTTGAGGGATTTGGG + Intronic
912435878 1:109660686-109660708 CAGGACCTCCTGAGGGATTTGGG + Intronic
912977165 1:114341225-114341247 GGGGGTCACCTGAGGGATGGTGG + Intergenic
913145114 1:115981424-115981446 TTGGGTCTCCTGAGGGTTTATGG + Intronic
917619276 1:176779385-176779407 AACTGTCTCCTGAGGGATTCTGG + Intronic
920421182 1:205834752-205834774 GAGGGACTTCTAAGGAATTTGGG - Intronic
922998819 1:229988521-229988543 GAGGGTTTCCTGAGGGCACTGGG - Intergenic
923207285 1:231771331-231771353 GAGGGTGTCCTGAGGGTGTTTGG - Intronic
924397418 1:243637031-243637053 GTGTATCTCCTGAGGGAATTGGG + Intronic
1065478814 10:26171508-26171530 GAGGTTGGCCTGAGGGATTCAGG - Intronic
1067989959 10:51200910-51200932 GAGATTCTCTTGAGGGTTTTAGG + Intronic
1070882742 10:79863755-79863777 GTGGGTCTTGTGAGGGAATTAGG + Intergenic
1071003064 10:80853045-80853067 GTGGGTGTCCTGTGGGAATTGGG - Intergenic
1071649308 10:87380057-87380079 GTGGGTCTTGTGAGGGAATTAGG + Intergenic
1073057131 10:100710072-100710094 GAGGGGCTCCTGGGGGATGGGGG - Intergenic
1075513024 10:123087409-123087431 AAGGGGCTGCTGAGGGTTTTTGG + Intergenic
1075991176 10:126840130-126840152 GGGGTTTTCCTGAGTGATTTTGG - Intergenic
1076552697 10:131293685-131293707 GAGGGGCTTCTGGTGGATTTCGG - Intronic
1077343075 11:2034643-2034665 AGGGGTCTCCTGAGGGACTGCGG + Intergenic
1080640409 11:34155216-34155238 GAGGGTCTCTGAAGGGATGTTGG + Intronic
1084172280 11:67406419-67406441 CAGGGTCTGCTGAGGGGTTTAGG - Intronic
1088747019 11:112812448-112812470 GAGGGAGTCCTGAGGGAATGTGG - Intergenic
1090191431 11:124772211-124772233 GAGGGACACCTGAAGTATTTTGG - Intronic
1090593681 11:128297635-128297657 ATGGTTCTCCTGGGGGATTTTGG + Intergenic
1202826061 11_KI270721v1_random:89832-89854 AGGGGTCTCCTGAGGGACTGCGG + Intergenic
1092034110 12:5315965-5315987 GAGGGTCTCCTGACCCATATTGG - Intergenic
1093280908 12:17195263-17195285 CAGGGTCCCCTGAGGGTTTGGGG + Intergenic
1096179055 12:49540611-49540633 GAGGGTGTCCTGAGCAATGTGGG - Intronic
1099883940 12:88503720-88503742 GTGGGTCTGCGGAGGGATTGTGG - Intronic
1100791046 12:98130383-98130405 GATAGTCTTCTGATGGATTTGGG - Intergenic
1101958477 12:109230782-109230804 GCGGCTCTCCTGAGGGCTGTGGG + Intronic
1103265406 12:119626022-119626044 GAGAGTCTCCTGATGTGTTTGGG + Intronic
1104859958 12:131918653-131918675 GAGGGTCTCCTCAGGGAGGTCGG - Exonic
1104947252 12:132421603-132421625 GGGGGTCTCCTGGGGATTTTTGG - Intergenic
1107717003 13:43210147-43210169 GAAGGGCTCCTGAGGGAATCAGG + Intergenic
1111717658 13:91899820-91899842 GAGGGTCTTCAGAGGGAGTATGG + Intronic
1112517733 13:100069945-100069967 GAGGATATCTTGAGGGATTGAGG + Intergenic
1113674537 13:112198240-112198262 GGAGGTCTCATGAGGGATTCGGG + Intergenic
1113681981 13:112250990-112251012 GTGGGACTCCTGAGGGACTGGGG - Intergenic
1120205506 14:81582999-81583021 GAGGGGCTTCTGACCGATTTCGG - Intergenic
1121337991 14:93088944-93088966 GAGGGTTTCCTGACAGATTTGGG - Intronic
1122153906 14:99738935-99738957 CAGGGTCTCCTGGGGGGTGTGGG + Intronic
1202943351 14_KI270726v1_random:4636-4658 GAGAGCGTCCTGGGGGATTTTGG - Intergenic
1127390334 15:58500102-58500124 GAGGGACTGTTGAGGGATGTGGG - Intronic
1129867274 15:78918647-78918669 TAGCCTCCCCTGAGGGATTTAGG - Intergenic
1131707432 15:95013293-95013315 GAGGGGTTCCTGAGACATTTGGG + Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132508330 16:323978-324000 GGGGCTCTCCTGTGGGCTTTGGG - Intronic
1133809046 16:9147099-9147121 GAGGGTCTCCTGAGTTTTTATGG + Intergenic
1135057867 16:19245422-19245444 GTGGGTCCCCTGAGGTTTTTGGG + Intronic
1138719555 16:59063422-59063444 GAGGATACCCTCAGGGATTTGGG - Intergenic
1139648108 16:68346719-68346741 GAGGGTCTCTTGAGGCCCTTGGG + Intronic
1140916798 16:79501116-79501138 CAGGGTCTCCAGAGGGAGTGTGG - Intergenic
1143545691 17:7593839-7593861 GGGGGTCAGCTCAGGGATTTTGG - Intronic
1143971812 17:10801371-10801393 GAGGGCCCTCTGAAGGATTTTGG - Intergenic
1145818005 17:27809218-27809240 GAGGGGAGCCTAAGGGATTTGGG - Intronic
1147459544 17:40559469-40559491 GAGTGTCTCCTGAGGGAGGTGGG + Intronic
1147909540 17:43847272-43847294 GAGGGTCTCGGGAGGGATGTGGG + Intronic
1149390792 17:56188755-56188777 CAGGATATTCTGAGGGATTTAGG - Intronic
1151398916 17:73843026-73843048 CCGTGTCTCCTGGGGGATTTAGG - Intergenic
1156042069 18:32834262-32834284 GAGGCTATTCTGATGGATTTTGG + Intergenic
1157882952 18:51339467-51339489 GACAGTCTGCTGAGGGCTTTAGG + Intergenic
1159141410 18:64399784-64399806 GATGCTGTGCTGAGGGATTTGGG + Intergenic
1160406000 18:78646795-78646817 AAGGGTCCCATGAAGGATTTGGG - Intergenic
1161112908 19:2479579-2479601 GAGGGGCTCTTGAGGGATTGGGG + Intergenic
1165329173 19:35131830-35131852 GAGGGTCTCCAGATGGTTATTGG + Exonic
1165642078 19:37398311-37398333 GTGGGGCTGCTCAGGGATTTGGG - Intergenic
1166179477 19:41096885-41096907 GGGGCTCTCCTGATGGATCTGGG + Intergenic
1167249500 19:48392711-48392733 CAGGGGCTCCTGAGGTAGTTTGG - Intergenic
1167573952 19:50308835-50308857 GAGGCTGGCATGAGGGATTTAGG + Intronic
1167793341 19:51693732-51693754 GATGGTCTCCTCACTGATTTCGG - Intergenic
925330148 2:3052263-3052285 GAGCATCTCCTTAGGAATTTGGG + Intergenic
925352095 2:3208680-3208702 GAGTGTTTCCTGGGGGAATTGGG - Intronic
925409234 2:3629385-3629407 GAGGGTCTCCTGGGTGCTTCTGG + Intronic
926022074 2:9505138-9505160 GAGTCTCTCCACAGGGATTTTGG - Intronic
926447635 2:12963230-12963252 GATAGACTCCTGAGGGAATTAGG + Intergenic
927484490 2:23479256-23479278 GAGGTTCTGTTGAGGGATCTGGG - Intronic
927498968 2:23569375-23569397 GAGGCCCTTCTGAGGGCTTTTGG - Intronic
932330817 2:70897451-70897473 GAGGGTGTACTGGGGGATGTAGG - Intergenic
932910405 2:75800257-75800279 GAGGGTCTCCTAAGGCAGTAGGG + Intergenic
934101830 2:88660548-88660570 GAGGGTCTCCTCTGGAATTAGGG + Intergenic
936707353 2:115090433-115090455 GAGGGTTTTGTCAGGGATTTGGG + Intronic
938083438 2:128382493-128382515 GGGGGAATCCTGAGGGATTGGGG + Intergenic
940498575 2:154465502-154465524 GAGGTTCTAGTAAGGGATTTAGG - Intergenic
943145236 2:184035527-184035549 CACTGTCTTCTGAGGGATTTTGG - Intergenic
945924826 2:215792660-215792682 GAGAGTCTACTGAGGGATTCTGG - Intergenic
946236832 2:218329525-218329547 GAGGGGCTGCTGAGGGCTCTTGG - Intronic
947152773 2:227131724-227131746 GAGTTTCTCCTGGGTGATTTAGG + Intronic
1169026547 20:2376336-2376358 GAGGATGTCTTGAGGGATTCAGG - Intergenic
1171080373 20:22176197-22176219 GAGCTTCTCCTGCTGGATTTTGG + Intergenic
1171433660 20:25103400-25103422 GAGGGGCTTCTGGGTGATTTTGG - Intergenic
1172308728 20:33900608-33900630 CGGGGAATCCTGAGGGATTTAGG - Intergenic
1173664423 20:44754503-44754525 GAGGGACTCCTAAGGGTTGTAGG - Intronic
1175508379 20:59503760-59503782 GAAGGTCTCTGGAGGGACTTGGG + Intergenic
1175789228 20:61731235-61731257 GAGGGTCTCCTGAGGGATTTTGG + Intronic
1176681224 21:9820342-9820364 GAGTGTCACCGGAGGGATATGGG + Intergenic
1179193117 21:39140300-39140322 GCGGCTCTCCTGAGGGTTCTGGG - Intergenic
1180175081 21:46083369-46083391 GAGGGGCCCCTGTGGCATTTCGG + Intergenic
1183231237 22:36583496-36583518 GAGCATCTCCTAAGGGACTTGGG - Intronic
1183279887 22:36926288-36926310 GAGGGTTTCTTGAGGGATGAGGG + Intronic
1184876767 22:47281247-47281269 GAGCGACTCCTGAGTAATTTGGG + Intergenic
954881408 3:53838291-53838313 GAGGGGCCCCTAAGGGATTCGGG - Intronic
958992298 3:100860856-100860878 CAGGTGCTCCTGAGGGATGTGGG + Intronic
960572096 3:119195227-119195249 GAGGTTCTCATCAGGGCTTTTGG - Intronic
963155011 3:142086905-142086927 CAGGAAATCCTGAGGGATTTAGG + Intronic
964413684 3:156425839-156425861 GAAGGTCTCCTGGGGGATTTGGG + Intronic
964684016 3:159375278-159375300 GAGGGGCTCCAGAGGGAATCTGG + Intronic
966747863 3:183295578-183295600 GGGGGTCACCTGAGGGAGGTAGG - Intronic
968468548 4:765597-765619 GAGGGTCCCCTGGGGCCTTTGGG + Intronic
969907316 4:10409299-10409321 GAGGGCCTACTGGGGGACTTAGG - Intergenic
970605303 4:17675084-17675106 GTGGTTCTCCTGATGGATCTGGG - Intronic
970847451 4:20557727-20557749 GTGGTTCTTCTGATGGATTTGGG + Intronic
971755467 4:30702253-30702275 GAGTGTGTCCTGAGGGTGTTTGG + Intergenic
971982554 4:33771771-33771793 GGGGGCCTTTTGAGGGATTTAGG - Intergenic
973854849 4:55001042-55001064 GAGGGTCTTCGGTGTGATTTAGG + Intergenic
976736817 4:88318531-88318553 GAGGGTATAATGAGGCATTTTGG - Intergenic
979237378 4:118417195-118417217 GAGGCTATCCTGAGATATTTAGG + Intergenic
981259108 4:142698590-142698612 CAGGGTCTACTGAGGAATCTGGG + Intronic
985624631 5:978741-978763 GTGGGTCTCCTTAGGGAAATGGG + Intergenic
993502469 5:88678741-88678763 GAGGGTCTGCTGAGGGTACTGGG + Intergenic
995115147 5:108471001-108471023 GAGGATCTCCAGAAGGATTGAGG + Intergenic
997698654 5:135880960-135880982 GAGGGTGTCCTCTGGCATTTAGG - Intronic
1001042425 5:168346432-168346454 GAGGGTCTCTTGAGGGTCTTAGG - Intronic
1001042487 5:168346925-168346947 GAGGGTCTCTTGAGGGTCTTAGG + Intronic
1001834948 5:174824092-174824114 GAGGGGCTCCTGAGGGGCTCTGG - Intergenic
1002345546 5:178545645-178545667 GAAGGTCTGCTGAGGGATTCTGG + Intronic
1002477876 5:179479280-179479302 GCGGATCACCTGAGGGAGTTTGG - Intergenic
1003848557 6:10198881-10198903 TAGAGTAGCCTGAGGGATTTGGG - Intronic
1006454892 6:34125983-34126005 GAGCACCTCCTGAGGGCTTTGGG + Intronic
1006716720 6:36125056-36125078 AAGTGTCCCCTGAGGGGTTTGGG + Intergenic
1007252291 6:40504015-40504037 GAGGGTCGCCAGAGGGCTTGTGG + Intronic
1007742530 6:44021645-44021667 GAGGGTGTGCAGAGGGATTAGGG + Intergenic
1008679377 6:53856307-53856329 CAGTGGCTCTTGAGGGATTTAGG + Intronic
1011693999 6:89895641-89895663 GAGGCTCACCTGAGGGTTCTGGG - Exonic
1017959488 6:159209425-159209447 GAGAGAGTCCTGATGGATTTAGG + Intronic
1018996969 6:168717359-168717381 GAGGGTCTCCAAGGGCATTTGGG + Intergenic
1019109890 6:169701641-169701663 GAGGGTCTCCAGGGGAATTCGGG - Exonic
1019119894 6:169794134-169794156 GGTGGTCTCCTTAGGGATATAGG + Intergenic
1021401485 7:20214269-20214291 GAGGGTATTCTAGGGGATTTTGG - Intronic
1023835315 7:44064317-44064339 GAGGGGCTCCAGAGGGAGATAGG + Intronic
1024793361 7:52992732-52992754 GAGAGTGTCCTGAGGGAGGTAGG + Intergenic
1026970416 7:74464397-74464419 GTGGGTGTCTTGAGAGATTTGGG + Intronic
1027233186 7:76283443-76283465 GAGGGGCTCCGGAGGGATGGCGG - Intronic
1028273273 7:88819484-88819506 GGGGGTTACCTGAGGCATTTTGG + Intronic
1029480262 7:100808000-100808022 AAGGCTCACCTGAGGGAGTTGGG - Intronic
1031846862 7:126815644-126815666 GAGGATCACCTTAGAGATTTAGG - Intronic
1032107139 7:129042003-129042025 GAGGGCCTGCTCAGTGATTTTGG - Intronic
1032988743 7:137367015-137367037 GAGGGTCTCCTAGGAGCTTTTGG - Intergenic
1037889494 8:22616039-22616061 GAGATGCTCCAGAGGGATTTTGG + Exonic
1037965654 8:23131886-23131908 GAGGGCCTCCTGAGGGCCTGCGG - Intergenic
1038722962 8:30054509-30054531 GATGGTTTCCTGAGGGATGATGG + Intergenic
1040556256 8:48479717-48479739 GAGGAACTTCTGAGAGATTTGGG - Intergenic
1048223701 8:132565572-132565594 GAGGGTGGCATGAGGGACTTTGG + Intergenic
1048568441 8:135628837-135628859 GAGTGTCTCATGAGAGATTAAGG + Intronic
1050751650 9:8945851-8945873 GAAGGTTTCCTGAAGGAATTGGG - Intronic
1051480701 9:17556847-17556869 GAGGTGCACCTGAGGGATTAGGG + Intergenic
1057340655 9:94198389-94198411 CAGAGGCTCCTGAGGGGTTTAGG + Intergenic
1060010683 9:120040705-120040727 CAGGGCATCCTGAGGGAGTTGGG - Intergenic
1060532812 9:124358162-124358184 GAGGGTCTCAGGCTGGATTTGGG - Intronic
1061250693 9:129424723-129424745 GAAGGTCCCCTGAGGGCTATAGG - Intergenic
1185629844 X:1507966-1507988 GGAGGTCTCCTGAGGGATGGCGG - Intronic
1186878311 X:13838956-13838978 GAGGGTATCATGAGGCATCTTGG - Intronic
1187133336 X:16524139-16524161 GAAGGGCACCTGAGGGACTTGGG - Intergenic
1190057272 X:47188253-47188275 GAGGGTTCCTTGTGGGATTTTGG - Intergenic
1194927755 X:99846659-99846681 GAGGGACTTCTGTTGGATTTTGG - Intergenic
1195046219 X:101056871-101056893 GAGGGTCTTCTGGCCGATTTTGG - Intergenic
1195717064 X:107827332-107827354 GGGGCTCTGCTGGGGGATTTGGG - Intronic
1197894871 X:131302083-131302105 GAGGGGCTGCTGAGAGACTTGGG + Intronic
1199844681 X:151682323-151682345 GAGGGATTCCAGATGGATTTTGG - Intergenic