ID: 1175791550

View in Genome Browser
Species Human (GRCh38)
Location 20:61743448-61743470
Sequence CAGTGGGCATGAGGGGCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 2, 1: 0, 2: 6, 3: 19, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175791550_1175791559 -10 Left 1175791550 20:61743448-61743470 CCTCATGCCCCTCATGCCCACTG 0: 2
1: 0
2: 6
3: 19
4: 360
Right 1175791559 20:61743461-61743483 ATGCCCACTGGGGGCCTGTAGGG 0: 1
1: 0
2: 0
3: 16
4: 99
1175791550_1175791562 2 Left 1175791550 20:61743448-61743470 CCTCATGCCCCTCATGCCCACTG 0: 2
1: 0
2: 6
3: 19
4: 360
Right 1175791562 20:61743473-61743495 GGCCTGTAGGGCGTCCTGCGTGG 0: 1
1: 0
2: 2
3: 11
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175791550 Original CRISPR CAGTGGGCATGAGGGGCATG AGG (reversed) Intronic
902276765 1:15345556-15345578 CAGTCGGCTTGAGGGCCATGTGG + Intronic
903017320 1:20369365-20369387 GAGTGGGCATTATGGGCATCGGG + Intergenic
905434855 1:37949242-37949264 GAGTGGGGAAGAGGGGCAAGGGG - Intergenic
905442393 1:38003953-38003975 CAGTGGGCATGTTGGGGGTGGGG - Intronic
906085895 1:43134521-43134543 AAGTGGGCAGGAGGGGAAAGGGG - Intergenic
906952291 1:50344753-50344775 CAATGGGGAAGAGGGGCATGTGG - Intergenic
907253176 1:53157039-53157061 AAGTGGGCATGAGGGGCTCTTGG - Intergenic
907325066 1:53632400-53632422 GAGTGTGACTGAGGGGCATGTGG + Intronic
907395902 1:54189728-54189750 CAGTGGGCAGGAGGGGCCACAGG - Intronic
907458514 1:54591617-54591639 CTGTGGGGAGGAGGGGCAGGAGG - Intronic
910102024 1:83587742-83587764 CAGTGGGGGTGTGGGGGATGTGG - Intergenic
911960505 1:104296210-104296232 CAGTTGGCATGAGGGGCATAAGG - Intergenic
912471209 1:109908199-109908221 CAGTGGGGCTGGGGGGCTTGCGG + Intergenic
915538222 1:156550495-156550517 GTGTGGGCATGTGTGGCATGTGG + Intronic
915839838 1:159205014-159205036 CAGGGGAAATGAGGGGCATAGGG - Intronic
915931125 1:160061677-160061699 CAGAGGGCAGCAAGGGCATGGGG + Intronic
917148588 1:171920339-171920361 CAGTGGGCAATAATGGCATGTGG - Intronic
919555371 1:199046242-199046264 CAGTGGGCAGGAGAGGCCAGTGG - Intergenic
920374332 1:205499286-205499308 CAGTGGGCCAGTGGGGCCTGCGG + Intergenic
920642459 1:207766132-207766154 AAGTGGGGATGAGGGGGAAGAGG + Intronic
920656931 1:207884069-207884091 CAGGGGGCAAGATGGCCATGAGG - Intergenic
920668658 1:207986178-207986200 CAGCCTCCATGAGGGGCATGGGG - Intergenic
920983796 1:210864281-210864303 CAGTGAGGATGTGGGGAATGAGG + Intronic
921279800 1:213555259-213555281 GAGTGGGCATGGGGGAAATGGGG - Intergenic
922785411 1:228280087-228280109 GGTGGGGCATGAGGGGCATGGGG + Exonic
923525490 1:234769435-234769457 CAGCTGGCCTGGGGGGCATGTGG - Intergenic
923946553 1:238894460-238894482 GTGTGGTCATGAGGGGCATCTGG + Intergenic
1062857229 10:785376-785398 GAGCGGGCAGGAGGGGCAGGGGG - Intergenic
1064292561 10:14049269-14049291 CAGTGGGGATTTGGGGGATGAGG + Intronic
1065625653 10:27625994-27626016 AAATGGAAATGAGGGGCATGGGG + Intergenic
1066058766 10:31704299-31704321 CAGTGGGAAGGGGGAGCATGCGG + Intergenic
1069579325 10:69554637-69554659 GGGTGGGCATCAGGGGCATCAGG + Intergenic
1069853370 10:71424900-71424922 CACTGGGCATGCGGGGACTGAGG - Intronic
1069854779 10:71434080-71434102 TAGTGCGCTTGAGGAGCATGAGG - Intronic
1070636297 10:78130863-78130885 CAGTGGGAAGAAGGAGCATGTGG - Intergenic
1070704700 10:78629219-78629241 CAGAAGGCAGGAGGGGCAGGAGG - Intergenic
1071556051 10:86602302-86602324 CAGAGGGCAGGAGGGGAGTGAGG - Intergenic
1071572824 10:86707526-86707548 CAGTGGCCATGTGGCGCATCAGG + Intronic
1072066873 10:91879913-91879935 CAGTGGGCAGGGGGGGCATGGGG - Intergenic
1072434306 10:95401422-95401444 CAGTGAGAATGAGGCCCATGAGG + Intronic
1072737560 10:97889289-97889311 GGGTGGGCATGTGGGGCTTGGGG + Intronic
1073106764 10:101036679-101036701 CAGTGGCCCTAAGGGCCATGGGG - Intronic
1073516428 10:104079520-104079542 CAGTGTGAATGAGAGTCATGTGG - Intronic
1076114556 10:127886349-127886371 GAGTGGGCATGAAGGAGATGTGG + Intronic
1076444101 10:130500184-130500206 TGGTGGAAATGAGGGGCATGGGG + Intergenic
1076889179 10:133275604-133275626 CAGCAGGCATGAGGGGCCGGGGG + Intronic
1077207817 11:1352752-1352774 CAGTGGGGATGAGGGGTGGGGGG - Intergenic
1077236778 11:1485702-1485724 GTGTGGGCATGAGGGGCCGGGGG - Intronic
1077452484 11:2657102-2657124 CAGTGGTCATTAGGGCAATGTGG - Intronic
1080257547 11:30307818-30307840 CAGTGGCCATTAGGTACATGTGG - Intergenic
1081938875 11:46923683-46923705 CAGTCGGGATCTGGGGCATGTGG + Intergenic
1083152202 11:60798839-60798861 CAGAGGGCATGGGGGGCACCAGG - Intronic
1083602662 11:63958525-63958547 CAGTGGGCAGGCGGAGCAAGAGG + Intergenic
1083812405 11:65113010-65113032 CTGTGGGGACGAGGGGCATAGGG - Intronic
1084195452 11:67521893-67521915 GAGGTGGCATGGGGGGCATGGGG - Intronic
1084264905 11:67999903-67999925 CAGTGGTGATGAGAGGCCTGTGG - Intronic
1084501133 11:69536100-69536122 GATGGGGCATGATGGGCATGAGG - Intergenic
1085259352 11:75195520-75195542 GAGTGGGGAAGTGGGGCATGGGG - Intronic
1085471466 11:76761109-76761131 CAGTGGGAATGAGGGGCAGCAGG - Intergenic
1087174306 11:95082075-95082097 ATGTGGGGATGAGGGCCATGTGG + Intergenic
1088239234 11:107756899-107756921 CAGTGGGATGGAGGGGCAAGGGG - Intergenic
1089146273 11:116331608-116331630 CAGTGGGCAGTGGGGGCATCTGG - Intergenic
1090355890 11:126140160-126140182 CAGGTGGCATGAGGGCCATTTGG - Intergenic
1090520970 11:127478844-127478866 CAGTGGGGTTGAAGAGCATGAGG + Intergenic
1090737626 11:129624154-129624176 CTGTGGGCATAGGGAGCATGGGG - Intergenic
1095263562 12:40126704-40126726 CAGTTGGCATGAGAGGTAAGTGG - Intergenic
1095374228 12:41507003-41507025 CAGTGTTCATGAGTAGCATGAGG - Intronic
1096587101 12:52629879-52629901 CAGTGGCCATGAGGCGACTGTGG - Intergenic
1097032812 12:56101758-56101780 CAGTGGGCATGATGGGTACAGGG - Exonic
1097226093 12:57477579-57477601 CAGGGGGCATGCAGGGCCTGGGG + Exonic
1097250499 12:57630054-57630076 CAGAGGGCATGGGAGGCATCTGG - Intronic
1098515031 12:71365736-71365758 CAGTTGACATGAGGGGACTGTGG - Intronic
1102173604 12:110860283-110860305 CAGTGGGTCTGGGGGGCAAGTGG + Intronic
1102777373 12:115532416-115532438 CATTGGCCATGGTGGGCATGAGG - Intergenic
1103507137 12:121449181-121449203 CAGGGGGCTTGGGGCGCATGTGG + Intronic
1103848950 12:123918604-123918626 CAGAGGGCAGGAGGGGCAGGGGG - Intronic
1104013885 12:124949939-124949961 CAGTGGGCAGGAGGGGTCCGAGG - Intronic
1104727856 12:131088653-131088675 CAGGGGTCGTGAGGGGCAGGAGG + Intronic
1104844533 12:131840247-131840269 CAGTGGGGAGCAGGGGGATGGGG + Intronic
1104906184 12:132214647-132214669 CAGAGGGTATGAGGGGGATGTGG - Intronic
1104972120 12:132535598-132535620 CAGAGAGCAGGAGGTGCATGGGG + Intronic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1106057288 13:26250439-26250461 TAGGGGGCATGAGGGAGATGGGG - Intergenic
1111647219 13:91046522-91046544 CAGTGGGGTTGTGGGGGATGAGG - Intergenic
1112185193 13:97121236-97121258 AAGTGGGCGTGTGGGGCAAGAGG + Intergenic
1113522457 13:110950523-110950545 CTGAGGGCATGGTGGGCATGAGG - Intergenic
1113846483 13:113394378-113394400 CAATGGGCAACAGGGGCATTGGG + Intergenic
1113928730 13:113955080-113955102 CAGTGGGGATGAGGAGCAGCTGG + Intergenic
1114181767 14:20373798-20373820 CTGTGGGCAGGAGGAGCACGTGG - Exonic
1117292199 14:54344757-54344779 GAGTGGGGAGGAGGAGCATGGGG - Intergenic
1118375249 14:65171151-65171173 CAGTGGGGCTGGGGGACATGAGG + Intergenic
1118771685 14:68946647-68946669 CAGTGAGCATGTGGGGCCTTGGG - Intronic
1119767646 14:77200452-77200474 CACAGGGCCTGGGGGGCATGAGG - Intronic
1120287348 14:82520672-82520694 CACTGGGCATGTTGGGCTTGTGG + Intergenic
1121604466 14:95230490-95230512 CAGTGGCAGTGATGGGCATGAGG + Intronic
1121728308 14:96168870-96168892 CAGTGGGGATGAAGACCATGTGG - Intergenic
1122690478 14:103529837-103529859 CAGTGGGCATGGGCGGGGTGTGG - Intronic
1123067349 14:105625342-105625364 ACCTGGGCATGATGGGCATGGGG + Intergenic
1123118942 14:105908223-105908245 CTGTGGGCAGGAGGAGCACGGGG + Intergenic
1124166532 15:27331099-27331121 CAGTGGGGATGTGGGGCAACAGG + Intronic
1124172846 15:27392111-27392133 CAGTGGGGATAATGGGGATGTGG - Intronic
1124244837 15:28060022-28060044 CGGGTTGCATGAGGGGCATGCGG - Intronic
1124372620 15:29112056-29112078 CACTGGGCATGGTGGGGATGGGG - Intronic
1124416309 15:29475544-29475566 CAGTGGGCAAGAGGGGCTGAGGG + Intronic
1124505068 15:30265238-30265260 AAGAGTGCATGAGGTGCATGAGG - Intergenic
1124738484 15:32273397-32273419 AAGAGTGCATGAGGTGCATGAGG + Intergenic
1125886203 15:43231478-43231500 CAGTGGGATAGAAGGGCATGTGG - Intergenic
1126177131 15:45746065-45746087 CATGGGGCATGAGGGGTTTGGGG + Intergenic
1128053558 15:64683546-64683568 CAGAGGGAATGATGGGTATGAGG - Exonic
1129327654 15:74809632-74809654 CAGTGGGCTTGAGGGGCTTGAGG + Intergenic
1129656890 15:77530300-77530322 CAGTGGGCCTGGGGTGCTTGTGG - Intergenic
1129753464 15:78082010-78082032 CAGTGGGGAAGAGGGGCCTGGGG - Intronic
1129930278 15:79404797-79404819 GGGTGGTCATGAGGGACATGTGG - Intronic
1132762700 16:1518664-1518686 CAGAGGGGATGTGGTGCATGTGG + Intronic
1133222495 16:4324808-4324830 CATTTGGGATGAGGGGGATGAGG + Intronic
1133333979 16:4994846-4994868 GAGAGGGCAGAAGGGGCATGAGG - Intronic
1134294772 16:12935914-12935936 GAGTGGACATGAGGGCCAGGAGG + Intronic
1134839846 16:17393034-17393056 AAGTGGGCAGGAGGGGAAGGAGG - Intronic
1135068419 16:19331318-19331340 CAATAGGCATTAGGAGCATGGGG + Intergenic
1135172484 16:20198205-20198227 CAGAGGGCAAAAGGGGGATGAGG - Intergenic
1137664860 16:50244238-50244260 CAGTGGCGATGAGGACCATGGGG + Intergenic
1138441955 16:57040668-57040690 CAGAGGGCATCTGGAGCATGAGG - Exonic
1138505943 16:57478357-57478379 GAGTGGGGTTGGGGGGCATGCGG - Intronic
1140155714 16:72424793-72424815 AAGTGAGCCTGAGAGGCATGAGG - Intergenic
1141442830 16:84040564-84040586 CAGAGGGCAGGTGGGGCTTGGGG - Intronic
1142291507 16:89195512-89195534 CACTGACCATGAGGGGGATGGGG + Intergenic
1142433770 16:90044469-90044491 CAGTGGGCTGGAGGGGGCTGAGG - Exonic
1143328649 17:6118374-6118396 CAGCAGGCATGGGGGGCAAGGGG - Intronic
1145014829 17:19389581-19389603 CAGTGGGGATGAGGAAGATGAGG + Intergenic
1146455786 17:33008798-33008820 TAGGGGGCATGAGGTTCATGGGG - Intergenic
1147370477 17:39989229-39989251 CAGTGGGGCTGAGGAGCAGGAGG - Intronic
1147452531 17:40514674-40514696 CAGAGGGCATGATGGGGGTGGGG + Intergenic
1148648102 17:49230688-49230710 CGGGGGGGATGAGGGGCAAGTGG - Exonic
1150372929 17:64656982-64657004 CATTGGGTATGAGTGGCAAGAGG - Intronic
1150779343 17:68107560-68107582 CACTGGGTATGAGTGGCAAGAGG + Intergenic
1151757131 17:76081480-76081502 AGGTGGGCATCGGGGGCATGGGG - Intronic
1151817251 17:76477419-76477441 CATTGGGGCTGACGGGCATGTGG - Intronic
1152637143 17:81434864-81434886 CAGGAGGGATGAGGGGGATGAGG + Intronic
1152658211 17:81529724-81529746 CTGGTGCCATGAGGGGCATGTGG + Intronic
1152716140 17:81901779-81901801 CAGTGGGCATGAAAGAAATGAGG + Intronic
1153960964 18:10139987-10140009 ATGAGGGCATGAAGGGCATGTGG + Intergenic
1153964763 18:10169177-10169199 CACTTGGCAGGAGGGGCAGGTGG + Intergenic
1155505528 18:26529070-26529092 CATTGGGCTTGAGGGGCTTATGG - Intronic
1155634135 18:27931839-27931861 CAGTCTGCATGTGGGGCAGGTGG - Intergenic
1156718692 18:40043658-40043680 CAGTTGGTTTGGGGGGCATGAGG - Intergenic
1157390127 18:47294906-47294928 GAGTGGCCATTAGGAGCATGCGG + Intergenic
1159775412 18:72598574-72598596 CAGTGGATTTGGGGGGCATGTGG - Intronic
1160107914 18:75995218-75995240 CAGAGGACAAGAGGGGCAGGTGG + Intergenic
1160175742 18:76592589-76592611 AAGAGGGCATGGGGGGCAAGGGG - Intergenic
1160530299 18:79558558-79558580 CAGGGGGCTTGAGGGGGATGGGG + Intergenic
1160691997 19:464429-464451 CAGGGTGCATGTGGGCCATGGGG - Intronic
1161058272 19:2201279-2201301 CAGGGAGGATGACGGGCATGGGG - Intronic
1161303682 19:3555733-3555755 CAGGTGGCAGGAGGGGCAGGCGG - Intronic
1161701399 19:5797911-5797933 CAGTGGGAAAGACGGGCATGTGG - Intergenic
1162117786 19:8442027-8442049 CAGTGTGATTGAGGGGCAGGTGG + Intronic
1162175155 19:8824782-8824804 CATCAGGCTTGAGGGGCATGAGG - Intronic
1162597817 19:11642307-11642329 CAGTGAGCAGGATGGGGATGGGG + Intergenic
1162840100 19:13349951-13349973 TAGTGGGCATGGGAGCCATGTGG + Intronic
1163535101 19:17872382-17872404 CAGTGGACACCAGGAGCATGAGG - Exonic
1163554353 19:17983801-17983823 CAGAGGGCAGGAGGGGCGGGGGG - Intronic
1163567181 19:18058660-18058682 CAGTGGGGATCAGGGGGAGGCGG + Intergenic
1164832200 19:31331174-31331196 CAGAGGGCACGCGGGGAATGTGG + Intronic
1165062185 19:33210385-33210407 CAGTGGGCACCAGGGGCAGGTGG - Intronic
1165924526 19:39318968-39318990 CAGTGGGTTTGAGGCCCATGTGG - Intergenic
1166317540 19:41997555-41997577 GAGTGGGCGGGAGGGGGATGGGG - Intergenic
1168278428 19:55289882-55289904 CTGGGGGCAGGAGGGGAATGGGG - Intronic
1168400813 19:56085315-56085337 AAGTGAGCATGAGAGGAATGGGG + Intergenic
925376972 2:3393327-3393349 CTGGGGGTGTGAGGGGCATGGGG + Intronic
925574788 2:5349562-5349584 GGGTGACCATGAGGGGCATGTGG + Intergenic
926847796 2:17161104-17161126 AAGTGGCAATTAGGGGCATGTGG - Intergenic
927177343 2:20419921-20419943 CAGTAGGTATGAGGGACGTGAGG + Intergenic
927255569 2:21037780-21037802 CAGTGAGCCTAAGGGGCAGGAGG + Intronic
927711793 2:25330741-25330763 CAGAGGGCATGGGGGACAGGGGG - Intronic
928108159 2:28486153-28486175 CAGGGGGCCAGAGGAGCATGAGG + Intronic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
929712690 2:44280910-44280932 AAGTGGGCAAGATGGGGATGAGG + Intronic
929804030 2:45128909-45128931 GAAAGGGCATGAGGGGGATGAGG - Intergenic
931345097 2:61439305-61439327 CACAGGGCATGAGGGTCAAGTGG - Intronic
932257105 2:70297333-70297355 TAGTTGGGATGAGGTGCATGTGG + Exonic
932406918 2:71519480-71519502 CAGGGGGCAGCAGGGGCAGGGGG - Intronic
933354384 2:81195446-81195468 CAGTGTCCATGGGGGGCAAGGGG + Intergenic
933943950 2:87268166-87268188 CAGTGGGCCCCAGGGGCAAGAGG - Intergenic
935897466 2:107753189-107753211 AAGTGGGCATGAGAAGCAGGGGG - Intergenic
936336270 2:111593413-111593435 CAGTGGGCCCCAGGGGCAAGAGG + Intergenic
938107650 2:128544378-128544400 GAGTGGGTAGGTGGGGCATGTGG + Intergenic
938581311 2:132648904-132648926 GAGGAGGCATGAGGGTCATGAGG + Intronic
938811030 2:134852810-134852832 GAGTGGGCACTAGGGGGATGGGG + Intronic
941028314 2:160483830-160483852 GAGTGGGCTTGGGTGGCATGAGG - Intronic
942381749 2:175398973-175398995 CAGTGGGCAGGGGAGTCATGAGG - Intergenic
942977301 2:182033577-182033599 CAGTGGTCATAAGGGAGATGTGG - Intronic
944465440 2:199995822-199995844 CAGGGGTCATTAGGGACATGTGG - Intronic
944857662 2:203784112-203784134 CTGTGGGCCTGAGGGGGATGTGG + Intergenic
946410301 2:219512183-219512205 AACTGGGTATAAGGGGCATGCGG - Intergenic
946931634 2:224677205-224677227 CAGTGACTAGGAGGGGCATGGGG - Intergenic
947100260 2:226613223-226613245 CAGTGGGCATGAGGGGCATGTGG - Intergenic
947150247 2:227108113-227108135 CAGTGGGTGTGAGTGGCAGGGGG + Intronic
947909082 2:233789947-233789969 CAGTGAGGTTGAGGGGCTTGAGG - Exonic
948327530 2:237137964-237137986 AAGTGGGGAAGAGGGGCAGGAGG - Intergenic
948575983 2:238950015-238950037 CAGTGGGCATGTGGGGCCCACGG - Intergenic
948737308 2:240017362-240017384 CAGTGGGAGTGAGGGACGTGTGG - Intronic
948993345 2:241565394-241565416 CAGTGGGCCTGAGGGGCAGAAGG - Intronic
1169028006 20:2386125-2386147 CAGTGAGACTGACGGGCATGGGG - Intronic
1169319427 20:4619166-4619188 CTGTCGGGATGAGGGGCAAGGGG - Intergenic
1169746234 20:8945932-8945954 CAGAGGGCAAGAGGGCCAGGTGG - Intronic
1171284129 20:23923821-23923843 GAGTGGGCTTGAGAGGCAAGAGG - Intergenic
1172657536 20:36546268-36546290 CACTCGGCATGAGGGGTACGCGG - Intronic
1172786282 20:37470824-37470846 CACGGGGCATGGGGGACATGGGG + Intergenic
1173142090 20:40493460-40493482 CAGTGGGCAGGACGTGCTTGTGG + Intergenic
1174091477 20:48052157-48052179 CAGAGAGCAGGAGGGGCATCTGG - Intergenic
1174631589 20:51962969-51962991 CAGAGGGTCTGAGGGGCAAGGGG + Intergenic
1174690969 20:52504094-52504116 CAGTGTACTTGAGGTGCATGTGG + Intergenic
1175222852 20:57427139-57427161 CAGTGGGCCTGTGGGGGAGGGGG + Intergenic
1175319221 20:58073502-58073524 CAGGAGGCATGTGGGGCCTGAGG + Intergenic
1175543422 20:59762472-59762494 CAGTGGTCATGAGGGTCTAGTGG + Intronic
1175791550 20:61743448-61743470 CAGTGGGCATGAGGGGCATGAGG - Intronic
1178373170 21:32044513-32044535 GAGTGGGGAGGCGGGGCATGCGG - Intronic
1178743522 21:35225887-35225909 CAGTGGCTCTGAGGGGCAGGTGG + Intronic
1180954195 22:19734215-19734237 CAGTGGGCAATAAGGGCACGGGG - Intergenic
1181434510 22:22902590-22902612 CAGTGGGCAGGAGGGTCTGGGGG - Intergenic
1182151480 22:28030057-28030079 CAGAGGCCCTGACGGGCATGGGG + Intronic
1182676239 22:32042130-32042152 CAGTGGGCAGGGAGGGCCTGAGG + Intergenic
1182756710 22:32686233-32686255 CAGGTGTCATGTGGGGCATGTGG + Intronic
1182893837 22:33842798-33842820 CAGTAGCCATTAGCGGCATGTGG - Intronic
1183174843 22:36215607-36215629 CAGTGGGCAGGAGGAGAAAGAGG - Intergenic
1183400684 22:37602149-37602171 CAGTTGGCTTGGGGAGCATGAGG + Intergenic
1184259298 22:43305540-43305562 CAGAGGGCATGAGGAGCCGGGGG + Intronic
1184281668 22:43440933-43440955 CAGTGGGCAGGAGGGGAATGAGG - Intronic
1184341362 22:43887820-43887842 CACTGGGCAGGAGGGGCCAGAGG + Intronic
1184455005 22:44605077-44605099 CCCTGGGGAGGAGGGGCATGAGG + Intergenic
1184840288 22:47048554-47048576 CACTGGGCCAGAGGAGCATGGGG + Intronic
1185373910 22:50473430-50473452 CAGTGGGGATGAGGACTATGTGG + Intronic
950004812 3:9684899-9684921 CAGTGGGCTTCAGGGACGTGTGG - Exonic
950657490 3:14445603-14445625 GAGAATGCATGAGGGGCATGAGG - Intronic
951160661 3:19416996-19417018 CAGTGGGCCTGAGTTTCATGCGG - Intronic
951322479 3:21262798-21262820 CAGTGGTCATGAGCTACATGTGG + Intergenic
952023156 3:29047562-29047584 AAGGTGGCATGAGGGGGATGAGG - Intergenic
952819985 3:37478111-37478133 AAGTGGCCAGGAGGGGCATTGGG - Intronic
954146777 3:48638358-48638380 GAGTGGGCATGAAGGGGCTGGGG - Intronic
959040289 3:101414567-101414589 TAGTTGGGATGAGGTGCATGTGG - Intronic
961353842 3:126321578-126321600 CAGAGGTCATGAGGGGCATGGGG - Intergenic
962241966 3:133757351-133757373 CAGCCGGGCTGAGGGGCATGGGG - Intronic
963858700 3:150283899-150283921 CAGTGGGGGTGAGGGGTAAGTGG + Intergenic
964302555 3:155305365-155305387 TAGTGGGGGTGAGGGGCAAGAGG + Intergenic
965534718 3:169812504-169812526 CAGTGGGTGAGAGGAGCATGGGG - Exonic
966869581 3:184281469-184281491 GAGGGAGCAGGAGGGGCATGCGG + Intronic
966983955 3:185162970-185162992 CAGTGTGCTTGAGGGGTATGTGG + Intergenic
968044515 3:195616549-195616571 CTGTGGGCTTGGGGAGCATGAGG + Intergenic
968060303 3:195722600-195722622 CTGTGGGCTTGGGGAGCATGAGG + Intronic
968120356 3:196121540-196121562 CAGCAGGCAGGAGGGCCATGGGG + Intergenic
968440828 4:623692-623714 CTGGGGGCATGAGGGCCCTGGGG - Intergenic
968470620 4:780921-780943 CAGTGGGCAGCAGGGACAGGGGG - Intergenic
968522397 4:1039894-1039916 CAGTGGGAGTGAGGGGCTGGGGG + Intergenic
968866660 4:3217302-3217324 CAGAGTGCTTGAGGGGCTTGGGG - Intronic
968925752 4:3547176-3547198 CAGTGGGGATGAGGGGGACTTGG - Intergenic
969228879 4:5816182-5816204 CGGTGGGCAGGAGGTGCATCAGG - Intronic
969669451 4:8581707-8581729 CAGTTGGCTTGAGGAGCCTGTGG + Intronic
969695131 4:8729889-8729911 GCTGGGGCATGAGGGGCATGGGG + Intergenic
969703061 4:8778195-8778217 CAGTTGGTATGAGGGTCCTGAGG + Intergenic
970661327 4:18289085-18289107 GAGTGGGCATGGGGGGTGTGGGG - Intergenic
971364988 4:25970481-25970503 CAGATGGCATGTGGGGAATGAGG - Intergenic
971816025 4:31490360-31490382 AATTGGGCATGCAGGGCATGTGG + Intergenic
972271152 4:37511723-37511745 CAGTGGACTTGGGTGGCATGTGG - Intronic
973342031 4:49015274-49015296 GAGTGGGGAGGAGGGGCATAAGG - Intronic
975665742 4:76733218-76733240 CAGTAGGCCTCAGGGGAATGGGG + Intronic
977527568 4:98163671-98163693 CAATGGGCATGAGGGTAAAGAGG - Intergenic
982499106 4:156131261-156131283 CAGTGGGAAGGAAGGGGATGAGG - Intergenic
983281952 4:165692269-165692291 CAGTGGGCATGAGGTGCATTTGG - Intergenic
983735670 4:171056317-171056339 CGGTGGGTACGAGGGGCATCTGG + Intergenic
987741727 5:21917185-21917207 CATTTGGCTTGAGGGACATGGGG + Intronic
988395145 5:30687715-30687737 CATTGGGCAACAGGGGCAGGTGG - Intergenic
988715100 5:33818277-33818299 CAGTGGTCATCAGGGGGATGGGG - Intronic
989651025 5:43690433-43690455 CAGTGGGCCTGGTGGGCCTGGGG + Intronic
990251900 5:53924681-53924703 GAGTTGGGAGGAGGGGCATGGGG - Intronic
992197252 5:74352097-74352119 CAGTGGGGATGAGGAGGATGGGG + Intergenic
995899809 5:117052372-117052394 CAAGGCACATGAGGGGCATGTGG + Intergenic
996731664 5:126723138-126723160 CAAGGGGCATGATGGGAATGAGG - Intergenic
996838712 5:127822854-127822876 CACTGGGCCTCAGGGGCCTGAGG - Intergenic
997030143 5:130118036-130118058 CAGGGAGCAAGAGGGGCAGGGGG - Intronic
997105484 5:131014301-131014323 CAGTGGGAAAGAGGGGGAAGGGG - Intergenic
998148573 5:139744470-139744492 GCGGGGGAATGAGGGGCATGGGG - Intergenic
999652093 5:153777681-153777703 CAGTGTGTGTGAGGGGGATGAGG - Intronic
1000041956 5:157491549-157491571 GAGCGGGCATCAGGGGCAGGTGG - Intronic
1000506293 5:162124040-162124062 TAGAGGGCCTGAGAGGCATGAGG + Intronic
1000573102 5:162939336-162939358 CAGAGGGCAGGAAGGGAATGGGG + Intergenic
1001148151 5:169202955-169202977 TTGTGGGCATCAGGGGCATATGG - Intronic
1001650344 5:173311372-173311394 AAGTGGGCATGAGGGGTTGGAGG - Intergenic
1003399378 6:5779148-5779170 CCCAGGGGATGAGGGGCATGTGG - Intergenic
1003503827 6:6724317-6724339 CAGAGGGGATGCGGGGGATGGGG - Intergenic
1004895253 6:20141799-20141821 CGGTGGGCATGAAGGGCAGCGGG + Intronic
1005072469 6:21874489-21874511 CAGGGGGCATGATGGGAGTGAGG + Intergenic
1005822102 6:29606828-29606850 CAGTGGCCATCAGGGCCCTGGGG - Intronic
1005823642 6:29618664-29618686 CTGTGGGCTAGAGGGGAATGTGG - Intronic
1005839252 6:29730681-29730703 CAGTGGGCATGAGAGGCAGCAGG - Intronic
1005853150 6:29838074-29838096 CAGTGGGCATGAGAGTCAGCAGG - Intergenic
1006102361 6:31693436-31693458 CAGTGGGCACGAGAGGCAAAGGG + Intronic
1007190085 6:40007416-40007438 CATGGGGCATGAGGGGCAAAGGG - Intergenic
1007242602 6:40437964-40437986 AAGTGGGCAGGAGGGGCAGTGGG + Intronic
1007622540 6:43223719-43223741 GAGTGGGCATCAGGGGATTGGGG + Intronic
1007662972 6:43497729-43497751 CAGAGGGCCTGAGGGGAAAGCGG - Intronic
1010280772 6:74020265-74020287 TAGAGGGCATGGGGGGCATGGGG + Intergenic
1010280785 6:74020475-74020497 TGGGGGGCATGGGGGGCATGGGG - Intergenic
1010280790 6:74020484-74020506 TAGAGTGCATGGGGGGCATGGGG - Intergenic
1012237883 6:96838475-96838497 CAGTGGGCATGAGCAGCAGAGGG + Intergenic
1012627475 6:101421408-101421430 CAGTGGGAATGAAGGCAATGTGG + Intronic
1013777365 6:113693349-113693371 CAGTGGGCTTGGGAGTCATGGGG - Intergenic
1015939064 6:138431134-138431156 CCGTGGTTATCAGGGGCATGGGG + Exonic
1016257221 6:142122012-142122034 AACTGGGAATGAGAGGCATGTGG - Intergenic
1017410553 6:154163192-154163214 CAGTGGGCTGGAGGGGCAGCAGG - Intronic
1019157210 6:170047321-170047343 CACAGTGCATGTGGGGCATGGGG + Intergenic
1019341746 7:511776-511798 CAGGGGGCTGGAGGGCCATGGGG + Intronic
1019515576 7:1438470-1438492 CAGTGGGCGTGTGGGGCATTAGG - Intronic
1019788009 7:2991528-2991550 AACTGAGCAGGAGGGGCATGAGG + Intronic
1019815580 7:3197435-3197457 CAGAGGGCAGGAGGGGAATTGGG + Intergenic
1023897310 7:44444742-44444764 CAGTGGGTAAGAAGGGCTTGGGG - Intronic
1024167631 7:46750391-46750413 CAGGGACCATGAGGGGAATGAGG + Intronic
1024525975 7:50349667-50349689 GAGTGGGCATGGGGGTGATGGGG + Intronic
1024527456 7:50360893-50360915 CGGCGGGCAGGAGGGGCTTGGGG - Intronic
1025030106 7:55549917-55549939 CAGTGACCATGATGGGGATGGGG - Intronic
1026374247 7:69734477-69734499 CACTGGGATTGAGGGGGATGAGG + Intronic
1026919388 7:74144185-74144207 GAGTGGGCAGGAGGGGAAGGAGG - Intergenic
1029125239 7:98290998-98291020 CAGTGGCCATGAGTCACATGGGG - Intronic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1029608394 7:101613775-101613797 CAGGGGTGATGAGGGGCAAGTGG + Intronic
1029985634 7:104920877-104920899 AAGTGGGAAAGAGGAGCATGTGG - Intergenic
1030090014 7:105850274-105850296 CATGGGGCATGACAGGCATGAGG - Intronic
1031945085 7:127831189-127831211 CAGAGGGCACAAGGGGGATGGGG + Intronic
1032382141 7:131496382-131496404 CAGAGATCATGAGGGGAATGGGG - Exonic
1032884649 7:136124498-136124520 GAATGGGCAGGAGGGGCACGAGG + Intergenic
1033173927 7:139108480-139108502 AAGCGGTGATGAGGGGCATGGGG + Intronic
1033357725 7:140614010-140614032 CAGTGAGCAGGAGGGGAAGGAGG - Intronic
1033833701 7:145283331-145283353 CAGTGGGCTTGTGGGGCACAGGG - Intergenic
1034852665 7:154509921-154509943 GAATGGGGGTGAGGGGCATGGGG + Intronic
1034978622 7:155461854-155461876 CTGTGGGAATCAGGGGCAGGTGG - Intronic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1036791598 8:11724964-11724986 CTGCGGGCATGAGGGGCACATGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1039419072 8:37420463-37420485 CAGTGGGCAGGCGGGGGAGGGGG - Intergenic
1039451638 8:37679646-37679668 CAACTGGCTTGAGGGGCATGTGG - Intergenic
1039507740 8:38064208-38064230 CAGTGAGCATGAGTGGAGTGTGG + Intergenic
1039546383 8:38414082-38414104 GAGTGGGCTTGAGGGGCAGGGGG - Intronic
1039626511 8:39059912-39059934 GAGTGGGGAGCAGGGGCATGTGG + Intronic
1041289323 8:56293779-56293801 GAGTGAGCATGAGGGGAAGGAGG + Intergenic
1041320774 8:56610470-56610492 AAGTGGGCTGGAGGGGCAAGAGG - Intergenic
1044898498 8:96918833-96918855 CATTGGGCATGAAGGGCTTAGGG + Intronic
1045317111 8:101052730-101052752 CAGCTAGCAGGAGGGGCATGTGG - Intergenic
1045818655 8:106308154-106308176 CAGAGGGCCTGAGGACCATGGGG + Intronic
1046710611 8:117506928-117506950 AAGGGGGCAGGAGGGGCAGGCGG - Intergenic
1047242124 8:123100144-123100166 CAGTGGGCATGATCTGCCTGTGG + Intronic
1048342455 8:133550816-133550838 CAGGTGGCATGAGGGGGCTGTGG - Intronic
1048787502 8:138065968-138065990 AGGTGGGGATGAGGGGCAGGTGG - Intergenic
1048994881 8:139788182-139788204 CAGGCGCCAAGAGGGGCATGTGG - Intronic
1049206413 8:141365679-141365701 CAGTGAGCATGAAGGGCCAGAGG + Intronic
1051330661 9:16022105-16022127 CAGTGGCCATGATTGGCAGGAGG + Intronic
1053800636 9:41762353-41762375 CAGTGGGGATGAGGGGGACTTGG - Intergenic
1054144557 9:61552482-61552504 CAGTGGGGATGAGGGGGACTTGG + Intergenic
1054189067 9:61974505-61974527 CAGTGGGGATGAGGGGGACTTGG - Intergenic
1054464245 9:65483441-65483463 CAGTGGGGATGAGGGGGACTTGG + Intergenic
1054649453 9:67614112-67614134 CAGTGGGGATGAGGGGGACTTGG + Intergenic
1056710293 9:88987196-88987218 CAGTGGGGATAAGCGGCTTGTGG - Intergenic
1056858409 9:90156362-90156384 CAGTGGGTATGATGGGGAGGAGG + Intergenic
1058922134 9:109627252-109627274 CAGTGGAGAGGAGGGGAATGAGG - Intergenic
1059475774 9:114546526-114546548 CAGAGAGGATGAGGGGAATGAGG + Intergenic
1059529812 9:115025512-115025534 AAGTGGGCATGGGTTGCATGGGG + Intronic
1060818537 9:126648571-126648593 CAGGGGGCATGAGAGGACTGGGG + Intronic
1061484885 9:130915205-130915227 CAGTGGGAAAGAGGGGGCTGAGG - Intronic
1061520487 9:131114685-131114707 CTGTGCGGGTGAGGGGCATGGGG + Intronic
1061682524 9:132250095-132250117 CTGTGGGCAGGAGGGGAAAGGGG - Intergenic
1062216647 9:135393035-135393057 CAGTGGGCAGGAGGGGCCATGGG - Intergenic
1062428117 9:136515428-136515450 CAGTGGGCAGGGCGGGCCTGAGG - Intronic
1062461177 9:136663157-136663179 CAGCGGGAGTGAGGGGAATGGGG - Intronic
1062606051 9:137349315-137349337 CAGAGGGCGGGAGGGGCGTGAGG + Intronic
1188326585 X:28810786-28810808 CAGTGGGCATGAGAAATATGGGG - Intronic
1190116446 X:47628788-47628810 CCGTGGGCATGGGGAGCTTGGGG - Intronic
1190331708 X:49239946-49239968 CAGTGGCCAGGAGGTACATGTGG + Intronic
1190753141 X:53379790-53379812 CAGTGGGCAAGAGGCCCAAGGGG + Exonic
1192048382 X:67700339-67700361 CAGAGGGCAGGAGGGGCATAAGG + Intronic
1192583572 X:72303727-72303749 CAGTGGTCAGGTGAGGCATGTGG - Intronic
1192618648 X:72654527-72654549 TAGTGGGCATGAGAGCCAGGTGG + Intronic
1192953637 X:76044487-76044509 CAGTGGGGATAGGGGTCATGTGG + Intergenic
1194534428 X:95087514-95087536 CAATGGGCATTTGGGACATGGGG + Intergenic
1195020690 X:100824231-100824253 GACTGGGCCTGAGGGGCCTGAGG - Exonic
1195748439 X:108141544-108141566 CACTGGGCAGGAGGGCCCTGGGG - Intronic
1198111771 X:133508518-133508540 AAGTGGTTAGGAGGGGCATGAGG + Intergenic
1198614184 X:138436563-138436585 CTGTGGGCATGTGTGGAATGGGG + Intergenic
1199522446 X:148751411-148751433 CTTTGGGAATGAGGGGCCTGTGG + Intronic
1199770629 X:150973137-150973159 CAGTGGGCATGAATTGGATGTGG + Intergenic
1200213506 X:154357205-154357227 CTCTGGGCAGGAGGGGCATTGGG + Intronic